One-step detection method of proteus mirabilis for non-disease diagnosis or non-treatment purpose

Abstract

The invention relates to the technical field of rapid detection methods, in particular to a one-step detection method for proteus mirabilis with a non-disease diagnosis or non-treatment purpose, recombinase polymerase amplification provided by the invention specifically amplifies target DNA through primers, CRISPR / Cas12a specifically recognizes a target sequence through crRNA, and through double screening of RPA and CRISPR / Cas12a, the proteus mirabilis can be rapidly detected. And rapid, sensitive and specific detection of proteus mirabilis can be realized. Meanwhile, an RPA primer, crRNA and reaction conditions are optimized, so that an RPA reaction system and a CRISPR / Cas12a reaction system can be premixed in a tube, and the reaction can be completed only by a one-step method. The method can specifically detect proteus mirabilis and has no cross reaction with common pathogenic bacteria, optimized conditions can avoid the competitive effect of CRISPR / Cas12a and RPA, the reaction rate and sensitivity are guaranteed, and meanwhile, the risk of nucleic acid aerosol pollution is also avoided due to the fact that uncovering is not needed.

Description

Technical Field

[0001] The present invention relates to the technical field of rapid detection methods, and particularly relates to a one-step detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes. Background Art

[0002] Proteus mirabilis is a specific pathogen in the genus Escherichia, belonging to a type of Escherichia coli. It is a Gram-negative bacterium with multiple virulence factors and can cause urinary tract infections (UTIs) in humans. Proteus mirabilis is one of the most common pathogens causing lower urinary tract infections (such as cystitis) and upper urinary tract infections (such as pyelonephritis). Proteus mirabilis is an important urinary tract pathogen with diverse infection routes, and its adverse effects on the human body include directly causing UTIs and their complications, as well as causing tissue damage through its virulence factors and immunopathological reactions. Therefore, rapid detection of Proteus mirabilis infection has great clinical significance because it can significantly improve the accuracy of diagnosis, accelerate the treatment process, reduce unnecessary antibiotic use, and reduce the risk of complications caused by Proteus mirabilis infection.

[0003] Conventional detection methods for Proteus mirabilis cover a variety of techniques, including microbial culture, molecular biology detection (such as polymerase chain reaction, PCR), and mass spectrometry. Microbial culture, as a traditional method for detecting Proteus mirabilis, is considered the gold standard for detection. This method involves inoculating urine samples onto specific culture media and then culturing the bacteria under suitable conditions. Based on the bacterial culture, the biochemical characteristics of the bacteria are observed to confirm whether it is Proteus mirabilis; however, this method takes a long time, usually 12 - 24 hours to complete, requires professional laboratory equipment and operators, and for some Proteus mirabilis strains that do not grow or grow slowly, they may not be detected by the culture method. Other methods include molecular biology methods, usually including PCR and its derivative technologies, as well as immunological methods such as enzyme-linked immunosorbent assay. Methods such as PCR usually require expensive laboratory equipment and professional technicians to operate, and immunological methods have detection windows. Although molecular biology methods are highly sensitive, they do not always meet the requirements of rapidity, low cost, and simple operation simultaneously. Mass spectrometry identifies Proteus mirabilis by analyzing the mass fingerprint spectra of bacterial proteins or peptides, and there are also problems such as the high cost of mass spectrometers and the need for professional training for operation and maintenance.

[0004] To overcome these limitations, researchers are developing new detection techniques, such as the RPA-CRISPR / Cas12a method, which combines isothermal nucleic acid amplification and CRISPR gene editing technology. It can complete the detection of Proteus mirabilis in a shorter time, with simple operation and no dependence on expensive laboratory equipment, and is expected to become an ideal on-site rapid detection method.

[0005] However, there are still some defects in the existing RPA-CRISPR / Cas12a method for the detection of Proteus mirabilis. For example, in the existing detection operation process, the RPA amplification reaction is carried out first, and then the PRA reaction product is transferred to the CRISPR / Cas12a reaction system. It is necessary to open the lid to transfer the amplification product, which increases the risk of aerosol contamination. In addition, there are also problems of relatively high cross-reactivity and the need to further improve the sensitivity and specificity. Summary of the Invention

[0006] The object of the present invention is to provide a one-step detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes in view of the problems existing in the prior art, such as the risk of aerosol contamination during detection, relatively high cross-reactivity, and the need to further improve the sensitivity and specificity. By optimizing the RPA primers, crRNA, and reaction conditions, under these optimized conditions, the RPA reaction system and the CRISPR / Cas12a reaction system can be premixed in one tube and the reaction can be completed by a one-step method. It can specifically detect Proteus mirabilis without cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensuring the reaction rate and sensitivity. At the same time, since there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided. Secondly, the method provided by the present invention can achieve rapid, sensitive, and specific detection of Proteus mirabilis.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] A one-step detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes, comprising the following steps:

[0009] Extract DNA from the sample to be tested;

[0010] Add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube; react at 37°C to 42°C for 25 min to 30 min;

[0011] Perform fluorescence method or lateral flow biosensing strip detection to check for signals indicating the presence of Proteus mirabilis;

[0012] Wherein, the RPA-CRISPR / Cas12a premix includes RPA primers;

[0013] The RPA primer sequences are: RPA-F: 5’-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3’, RPA-R: 5’-ACGATTATTATCATTATCTGCGCTATCACCC-3’;

[0014] The RPA-CRISPR / Cas12a premix includes crRNA and ssDNA signal probe;

[0015] The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUGUCGCGAAACCAUUGCUGCA GAAG-3’;

[0016] The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0017] A rapid detection method for Proteus mirabilis based on RPA-CRISPR / Cas12a provided by the present invention. The RPA provided by the present invention specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target sequence through crRNA. Through the double screening of RPA and CRISPR / Cas12a, the rapid, sensitive and specific detection of Proteus mirabilis can be realized. At the same time, the RPA-CRISPR / Cas12a premix provided by the present application can be placed in one tube to complete the reaction by a one-step method, can specifically detect Proteus mirabilis, has no cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, because there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided, and unexpected technical effects are achieved.

[0018] Further, the sample to be tested is a pretreated urine sample;

[0019] The pretreated urine sample is prepared by the following method:

[0020] Take the urine to be tested and perform centrifugation;

[0021] Discard the supernatant, take sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

[0022] Further, the specific method for DNA extraction is as follows:

[0023] Place the pretreated urine sample under the condition of heating at 95°C to 100°C, perform centrifugation, and take the supernatant to obtain the extracted DNA.

[0024] Further, heating is carried out using a metal bath or a water bath.

[0025] Furthermore, heat for 5 min to 8 min.

[0026] Furthermore, the rotation speed for the centrifugation treatment is 4000 rpm to 5000 rpm, and the time for the centrifugation treatment is 30 s to 60 s.

[0027] The DNA extraction method provided by the present invention does not require the use of a kit for extraction, has a low cost, and a short extraction time.

[0028] Furthermore, add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premixed solution in the reaction tube. Each 35 μL of the mixed material includes the following raw materials: 14.5 μL to 15 μL of RPA Basic reaction buffer, 1 μL to 1.5 μL of 280 mM MgOAc, 0.8 μL to 1.2 μL of 10 μM RPA-F, 0.8 μL to 1.2 μL of 10 μM RPA-R, 1.5 μL to 2.5 μL of DNA, 0.5 μL to 1 μL of 1 μM CRISPR / Cas12a, 1.5 μL to 2 μL of 1 μM crRNA, 0.5 μL to 1 μL of 10 μM ssDNA probe, 3 μL to 4 μL of 10X R2.1 buffer, and the balance is DEPC-treated water.

[0029] Furthermore, perform fluorescence method or lateral flow biosensing strip to detect the signal of Proteus mirabilis: if the fluorescence increases or the test line shows color, it indicates that the sample to be tested contains Proteus mirabilis.

[0030] In summary, due to the adoption of the above technical solutions, the beneficial effects of the present invention are:

[0031] 1. A rapid detection method of Proteus mirabilis based on RPA-CRISPR / Cas12a provided by the present invention. RPA specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target sequence through crRNA. Through the double screening of RPA and CRISPR / Cas12a, rapid, sensitive and specific detection of Proteus mirabilis can be achieved. At the same time, the reaction system provided by the present invention and the CRISPR / Cas12a reaction system can be premixed in one tube and the reaction can be completed by a one-step method, which can specifically detect Proteus mirabilis, has no cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, because there is no need to open the lid, the risk of nucleic acid aerosol pollution is also avoided, and unexpected technical effects are achieved.

[0032] 2. The one-step detection method for Proteus mirabilis provided by the present invention has a fast reaction speed, and the one-step RPA-CRISPR / Cas12a does not require additional lid opening or centrifugation, and can complete the detection of Proteus mirabilis in about 25 minutes.

[0033] 3. The one-step detection method for Proteus mirabilis provided by the present invention has high specificity. RPA specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target DNA through crRNA. Through the double screening of RPA and CRISPR / Cas12a, Proteus mirabilis can be specifically detected without cross-reaction with common pathogenic bacteria.

[0034] 4. The one-step detection method for Proteus mirabilis provided by the present invention has high sensitivity. Through the double amplification of RPA and CRISPR / Cas12a, the gene target of Proteus mirabilis at 2.8 copies / μL can be detected. Description of the Drawings

[0035] Figure 1 It is a data graph of RPA primer analysis in the embodiment.

[0036] Figure 2 It is a data graph of crRNA screening in the embodiment.

[0037] Figure 3 It is a data graph of the process of condition optimization in the embodiment.

[0038] Figure 4 It is a data graph of the sensitivity test results in the embodiment.

[0039] Figure 5 It is a data graph of the specificity test results in the embodiment. Detailed Embodiments

[0040] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0041] Embodiment 1

[0042] Aiming at the problems existing in the prior art, such as the risk of aerosol contamination during detection, relatively high cross-reactivity, and the need to further improve sensitivity and specificity.

[0043] This embodiment provides a one-step detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes, including the following steps:

[0044] Extract DNA from the sample to be tested;

[0045] The sample to be tested is a pretreated urine sample; the pretreated urine sample is prepared by the following method:

[0046] Take 1 mL of urine to be tested in a 1.5 mL PCR tube and centrifuge at 4000 rpm for 45 s;

[0047] Discard the supernatant, add 100 μL of sterile water to resuspend the precipitate, shake and mix well to obtain the pretreated urine sample.

[0048] Place the pretreated urine sample in a metal bath or water bath at 95 °C and heat for 5 min, centrifuge at 4000 rpm for 45 s, and take the supernatant, which is the extracted DNA sample.

[0049] Add the extracted DNA to the reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube; react at 39 °C for 25 min.

[0050] Perform fluorescence method or lateral flow biosensing test strip to detect whether there is a signal of Proteus mirabilis; if the fluorescence increases or a color change occurs, it indicates that the sample to be tested contains Proteus mirabilis.

[0051] Among them, the RPA-CRISPR / Cas12a premix includes RPA primers;

[0052] The RPA primer sequences are: RPA-F: 5’-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3’, RPA-R: 5’-ACGATTATTATCATTATCTGCGCTATCACCC-3’;

[0053] The RPA-CRISPR / Cas12a premix includes crRNA and ssDNA signal probes;

[0054] The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUGUCGCGAAACCAUUGCUGCA GAAG-3’;

[0055] The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0056] The RPA provided by the present invention amplifies the target DNA through primer specificity, and CRISPR / Cas12a specifically recognizes the target sequence through crRNA. Through the dual screening of RPA and CRISPR / Cas12a, the rapid, sensitive and specific detection of Proteus mirabilis can be achieved. At the same time, the RPA reaction system and CRISPR / Cas12a reaction system provided by the present invention can be premixed in one tube and the reaction can be completed by a one-step method, which can specifically detect Proteus mirabilis, has no cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensure the reaction rate and sensitivity. At the same time, because there is no need to open the lid, the risk of nucleic acid aerosol pollution is also avoided, and unexpected technical effects are achieved.

[0057] In some embodiments, the specific method for DNA extraction is as follows:

[0058] The pretreated urine sample is heated under the condition of 95°C - 100°C, centrifuged, and the supernatant is taken to obtain the extracted DNA.

[0059] In some embodiments, heating is carried out using a metal bath or a water bath.

[0060] In some embodiments, heating is carried out for 5 min - 8 min.

[0061] In some embodiments, the rotation speed for centrifugation is 4000 rpm - 5000 rpm, and the centrifugation time is 30 s - 60 s.

[0062] In some embodiments, the extracted DNA is added to a reaction tube and mixed with the RPA-CRISPR / Cas12a premix in the reaction tube. Each 35 μL of the mixed material includes the following raw materials: 14.5 μL - 15 μL of RPA Basic reaction buffer, 1 μL - 1.5 μL of 280 mM MgOAc, 0.8 μL - 1.2 μL of 10 μM RPA-F, 0.8 μL - 1.2 μL of 10 μM RPA-R, 1.5 μL - 2.5 μL of DNA, 0.5 μL - 1 μL of 1 μM CRISPR / Cas12a, 1.5 μL - 2 μL of 1 μM crRNA, 0.5 μL - 1 μL of 10 μM ssDNA probe, 3 μL - 4 μL of 10X R2.1 buffer, and the balance is DEPC-treated water.

[0063] Specifically, this embodiment provides the exploration process of the rapid detection method in the embodiment:

[0064] Step 1. Plasmid and clinical sample preparation

[0065] The ureC gene of Proteus mirabilis (NC_010554.1) was selected as the detection target gene, and a plasmid carrying the ureC gene was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Clinical strains were cultured in Luria-Bertani (LB) broth culture medium at 37 °C with constant shaking (120 r / min) for 12 hours. After heating at 95 °C for 5 minutes, rationally, the supernatant was taken as the template.

[0066] Step 2: Primer design

[0067] Using the ureC gene of Proteus mirabilis as the detection target gene, according to the RPA primer design principle, 3 pairs of RPA forward and reverse candidate primers were designed using the primer design software Primer Premier 6, and the specificity of the primers was verified online using NCBI-BLAST.

[0068] The primers and the target fragment are shown in Table 1, and all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0069] Table 1 Primer sequences

[0070] Name Sequence (5’→3’) F1 GTCTGTCATCATCTCGATCCCTCTATTCCTG R1 ACGATTATTATCATTATCTGCGCTATCACCC F2 GTCTGTCATCATCTCGATCCCTCTATTCCTG R2 AGTGCGTAAGATAACTTCTCCGACTCGTCCC F3 CATTAATACCGTGGACGAGCATCTTGATATGTTGA R3 GCCAAGTGCGTAAGATAACTTCTCCGACTC

[0071] Step 3: RPA amplification reaction system

[0072] 14.75 μL of RPA Basic reaction buffer (DNA isothermal rapid amplification kit (basic type) purchased from AmpFuture (Changzhou) Biotechnology Co., Ltd.), 1.25 μL of 280 mM MgOAc, 1 μL of 10 μM upstream primer (F), 1 μL of 10 μM downstream primer (R), 2 μL of template, 5 μL of DEPC-treated water, a total of 25 μL. The prepared reaction system was reacted at 39 °C for 15 minutes, and the results could be observed.

[0073] Step 4: Reaction system of one-step RPA-CRISPR / Cas12a reaction

[0074] The one-step reaction is to combine the RPA reaction with CRISPR / Cas12a (( The Lba Cas12a (Cpf1) nuclease was purchased from NEB England Biolabs (Beijing), and the reaction was integrated in one tube. The reaction system was as follows: 14.75 μL of RPA Basic reaction buffer, 1.25 μL of 280 mM MgOAc, 1 μL of 10 μM upstream primer (F), 1 μL of 10 μM downstream primer (R), 2 μL of template, 0.875 μL of 1 μM CRISPR / Cas12a, 1.75 μL of 1 μM crRNA, 0.875 μL of 10 μM ssDNA probe, 3.5 μL of 10X R2.1 buffer, 8 μL of DEPC-treated water, and the total volume of the system was 35 μL. Subsequently, the reaction was carried out at 37 °C for 25 minutes in a real-time fluorescence quantitative PCR instrument, and the fluorescence signal was observed in real time.

[0075] Step 5. Condition optimization

[0076] (1) RPA primer screening: Using the plasmid with the ureC gene of Proteus mirabilis at a concentration of 10 4 copies / μL as the template, and using DEPC-treated water instead of the plasmid as the control, different RPA primer pairs were used for amplification according to the conditions in Step 3. Subsequently, an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) extraction solution was added to the reaction tube, mixed well, centrifuged at 12,000 rpm for 5 min, the supernatant was aspirated, and the amplification product was extracted. The amplification product was added with 6×SuperStain Loading Buffer at a ratio of 5:1, mixed well, and electrophoresed on a 1.5% agarose gel at a constant voltage of 90 V for 30 min, and the result was observed by developing with a gel imager. The result is as Figure 1 shown in A of. According to the thickness of the bands of the amplification product, the effect of primer 1 was the best. The sensitivity of primer 1 was verified and could reach 10 0 copies / μL, as shown in Figure 1 B of.

[0077] Figure 1 In A of, screening of RPA primers for Proteus mirabilis. Lane 1: 250 bp DNA Ladder; Lane 2: F1R1 (246 bp); Lane 3: F1R1 control; Lane 4: F2R2 (171 bp); Lane 5: F2R2 control; Lane 6: F3R3 (212 bp); Lane 7: F3R3 control.

[0078] Figure 1 In B of, sensitivity analysis of RPA amplification of F1R1 primer set. Lane 1: 250 bp DNA Ladder; Lane 2: plasmid concentration 10 2 copies / μL; Lane 3: plasmid concentration 10 1copies / μL; Lane 4: plasmid concentration 10 0 copies / μL; Lane 5: negative control.

[0079] (2) Design crRNA according to the optimal RPA primer amplification sequence. The specific sequences are shown in Table 2. React with different crRNAs in the system described in step 4, and select the best crRNA according to the intensity of the fluorescence signal and the time to reach the plateau. The results are as Figure 2 shown. The time for crRNA1 to reach the plateau is shorter and the fluorescence value at the end point is higher. Therefore, crRNA1 is selected for the following experiments.

[0080] Table 2 crRNA and ssDNA probe sequences

[0081]

[0082] (3) Optimization of the CRISPR / Cas12a system: Using the plasmid (2.82×10 4 copies / μL) as a template, optimize the reaction conditions such as the concentration of Cas12a (25 nM, 50 nM, 75 nM, 100 nM), the ratio of Cas12a / crRNA (1:1, 1:1.5, 1:2), and the concentration of ssDNA probe (150 nM, 250 nM, 350 nM). Plot the fluorescence values at 25 min of the reaction. The results are as Figure 3 A, B, and C. The fluorescence values under different Cas12a concentrations vary little. Considering the cost - effectiveness, the lowest concentration of 25 nM is selected as the final concentration. As the ratio of crRNA:Cas12a increases, the fluorescence value gradually increases, and finally the ratio of Cas12a:crRNA = 1:2 is selected as the final ratio. As the concentration of the ssDNA probe increases, the fluorescence value also increases, but there is no significant difference in the fluorescence values of the 250 nM and 300 nM ssDNA probes. Therefore, the 250 nM probe is selected as the final concentration. Figure 3 A. Optimization of Cas12a concentration in Figure 3 B. Optimization of the ratio of Cas12a / crRNA in Figure 3 C. Optimization of the concentration of ssDNA probe in; The concentration of the plasmid template used is 10 4 copies / μL; Error bars represent the standard deviation of three repeated experiments.

[0083] Step 6, Sample pretreatment

[0084] Extract nucleic acid from Proteus mirabilis by boiling method. The Proteus mirabilis suspension is directly heat - lysed at 95 °C for 5 min, centrifuged, and the supernatant is used as the template for the RPA - CRISPR / Cas12a reaction.

[0085] Step 7, Sensitivity test of the one-step RPA-CRISPR / Cas12a detection method

[0086] Sensitivity detection using plasmid as template: The plasmid standard containing the target fragment of the ureC gene of Proteus mirabilis was serially diluted to 2.8×10 2 copies / μL, 2.8×10 1 copies / μL and 2.8×10 0 copies / μL. At the same time, DEPC-treated water was used as a negative control. According to the optimized reaction system in Step 4, 1.2 μL of the plasmid dilution was taken and subjected to a 30-min RPA-CRISPR / Cas12a reaction at 39°C. The real-time fluorescence signal was collected using a real-time fluorescence quantitative PCR instrument, and the fluorescence value at 25 min of the reaction was plotted ( Figure 4 ). The reaction results showed that this method can detect plasmid standards as low as 1×10 0 copies / μL.

[0087] Step 8, Specificity test of the one-step RPA-CRISPR / Cas12a detection method

[0088] The DNA of pathogenic bacteria such as Klebsiella oxytoca and Streptococcus pneumoniae was extracted by the boiling method and used as a template for one-step RPA-CRISPR / Cas12a detection. The fluorescence value at 25 min of the reaction was plotted ( Figure 5 ). The results showed that this method has high specificity for Proteus mirabilis and there is no cross-reaction during the detection process.

[0089] From the results of the above various embodiments, it can be seen that the present invention can quickly, sensitively, specifically and accurately detect Proteus mirabilis. It avoids cross-contamination of samples or the environment. This method has strong anti-interference ability, does not require complex nucleic acid extraction steps, and only simple thermal lysis can complete the sample pretreatment process. This method realizes one-step RPA-CRISPR / Cas12a detection, does not require complex liquid preparation and liquid transfer steps, simplifies the experimental steps, and reduces the possibility of aerosol contamination. In summary, this method can achieve rapid and accurate on-site detection of Proteus mirabilis.

[0090] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A one-step detection method for Proteus mirabilis for non-diagnostic or non-therapeutic purposes, characterized in that, It includes the following steps: Extract DNA from the sample to be tested; Add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube; React at 37°C to 42°C for 25 min to 30 min; Perform fluorescence method or lateral flow biosensing strip detection to check for the signal of Proteus mirabilis; Among them, the RPA-CRISPR / Cas12a premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3’, RPA-R: 5’-ACGATTATTATCATTATCTGCGCTATCACCC-3’; The RPA-CRISPR / Cas12a premix includes crRNA and ssDNA signal probes; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUGUCGCGAAACCAUUGCUGCAGA AG-3’; The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

2. The one-step detection method according to claim 1, wherein The sample to be tested is a pretreated urine sample; The pretreated urine sample is prepared by the following method: Take the urine to be tested and perform centrifugation; Discard the supernatant, take sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

3. The one-step detection method according to claim 2, wherein The specific method for extracting DNA is as follows: Place the pretreated urine sample under the condition of 95°C to 100°C and heat for 5 min to 8 min, perform centrifugation, and take the supernatant to obtain the extracted DNA.

4. The one-step detection method according to claim 1, wherein Add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube. Every 35 μL of the mixed material includes the following raw materials: 14.5 μL to 15 μL of RPA Basic reaction buffer, 1 μL to 1.5 μL of 280 mM MgOAc, 0.8 μL to 1.2 μL of 10 μM RPA-F, 0.8 μL to 1.2 μL of 10 μM RPA-R, 1.5 μL to 2.5 μL of DNA, 0.5 μL to 1 μL of 1 μM CRISPR / Cas12a, 1.5 μL to 2 μL of 1 μM crRNA, 0.5 μL to 1 μL of 10 μM ss DNA probe, 3 μL to 4 μL of 10X R2.1 buffer, and the balance is DEPC-treated water.

5. The one-step detection method according to any one of claims 1 to 4, characterized in that, Perform fluorescence method or lateral flow biosensing strip detection to check for the signal of Proteus mirabilis: If the fluorescence increases or the test line shows color, it indicates that Proteus mirabilis is contained in the sample to be tested.

Images