Biomarker for early screening, postoperative recurrence early warning and prognosis evaluation of resectable non-small cell lung cancer and application of biomarker

By measuring the telomeres length (LTL) of peripheral blood leukocytes combined with TNM stage, the problems of early screening of non-small cell lung cancer and postoperative recurrence warning were solved, and rapid and accurate screening and early warning were achieved, improving the patient's survival prediction ability.

CN120366455APending Publication Date: 2025-07-25AFFILIATED ZHONGSHAN HOSPITAL OF DALIAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510415658.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

It is difficult for the prior art to effectively carry out early screening of non-small cell lung cancer and early warning of postoperative recurrence, resulting in failed treatment and poor prognosis.

Method used

The telomeres length (LTL) of peripheral blood leukocytes was used as a biomarker and its length was determined by polymerase chain reaction, combined with TNM staging was used for early screening, postoperative recurrence warning and prognosis evaluation.

Benefits of technology

Rapid, non-invasive early diagnosis and accurate postoperative recurrence warning are achieved, improving the predictive ability of overall and disease-free survival in patients with resectable NSCLC.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366455A_ABST
    Figure CN120366455A_ABST
Patent Text Reader

Abstract

The invention discloses a biomarker for early screening, postoperative recurrence early warning and prognosis evaluation of resectable non-small cell lung cancer and application of the biomarker, and belongs to the technical field of biological medicine. Polymerase chain reaction is adopted for quantitative evaluation of the peripheral blood leucocyte telomere length (LTL), compared with healthy donors, the LTL expression level of NSCLC-resected patients is remarkably reduced, the LTL expression level in early-stage patients is also remarkably reduced, and the LTL after resection is remarkably increased compared with that before resection, so that the LTL expression level is remarkably reduced. The total lifetime and disease-free lifetime of the postoperative long telomere length group are longer than those of the short telomere length group. Postoperative LTL is determined as an independent prognostic factor of OS in both univariate analysis and multivariate analysis. In addition, area under curve (AUC) analysis shows that the prediction capability of the LTL on the OS in five years after operation is high, and AUC is 0.606; and the prediction capability on the DFS is also very good, and the AUC is 0.751. The results show that LTL can be used as a promising biomarker for early screening, postoperative recurrence early warning and prognosis evaluation of resectable NSCLC.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to a biomarker for early screening, postoperative recurrence warning and prognosis evaluation of resectable non-small cell lung cancer (NSCLC) and its application. Background Art

[0002] Non-small cell lung cancer (NSCLC) is the most common malignant tumor, and its 3-year survival rate is only 40%, posing a major threat to health. Surgical resection remains the most effective treatment for patients with stage I-II NSCLC and some stage IIIA patients, and its 5-year survival rate ranges from 56% to 90% in stage I-II patients. However, due to the lack of specific symptoms in the early stage of NSCLC, it is often diagnosed at a relatively advanced or metastatic stage. In addition, a considerable number of patients will experience recurrence or metastasis after surgery, resulting in treatment failure and having a significant impact on the prognosis. Therefore, early diagnosis and identification of early markers for NSCLC postoperative recurrence and metastasis are a key challenge.

[0003] Telomere length is a promising biomarker for cancer risk screening. Studies have shown that there is significant variability in the telomere length of individuals, and the telomere lengths among different somatic tissues are highly correlated. Therefore, individuals with longer telomere lengths in one tissue usually also exhibit longer telomere lengths in other tissues. This synchrony also extends to the telomere lengths of blood cells, making it a reliable indicator among different tissues. Therefore, leukocyte telomere length (LTL) is often used as a surrogate indicator for the telomere lengths of other tissues to explore the relationship between individual telomere length and disease risk. Although the relevant biological mechanisms are not yet clear, both longer and shorter telomeres are associated with an increased risk of cancer. Therefore, LTL has attracted much attention due to its potential as a diagnostic and therapeutic target.

[0004] Cancer biomarkers are any measurable molecular indicators of cancer occurrence, progression, transformation, and outcome. The relationship between telomere length and non-small cell lung cancer (NSCLC) is still not fully clear. New evidence supports the potential of tumor tissue telomere length as a cancer biomarker. For example, in a series of cancers, it was found that in patients with advanced lung adenocarcinoma, the median overall survival (OS) of patients with shorter telomeres was significantly lower than that of patients with longer telomeres (12.9 months vs. 17.8 months, p = 1.2×10 -4 )). Nevertheless, most biomarker-related studies have focused on tumor tissue telomere length rather than its LTL. Obviously, this limits and ignores the role of LTL in early NSCLC screening and postoperative recurrence warning. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a biomarker for early screening, postoperative recurrence warning and prognosis evaluation of resectable non-small cell lung cancer and its application. The present invention evaluates the levels of LTL in healthy donors and resectable NSCLC patients before and after surgery, and evaluates its value in screening, recurrence warning and prognosis evaluation of resectable NSCLC. The research confirms that LTL is a promising biomarker. Furthermore, it can be used for early diagnosis of resectable NSCLC in a rapid, non-invasive and quantitative manner, accurately warn patients of postoperative recurrence and evaluate prognosis, and has very broad application prospects.

[0006] The object of the present invention is achieved by the following means:

[0007] In the first aspect, the present invention provides a biomarker for screening early resectable NSCLC, warning of postoperative recurrence of resectable NSCLC and evaluating the prognosis of resectable NSCLC, and the biomarker is peripheral blood leukocyte telomere length (LTL).

[0008] In the second aspect, the present invention provides the application of the above biomarker in the preparation of a reagent or kit for screening early resectable NSCLC.

[0009] In the third aspect, the present invention provides the application of the above biomarker in the preparation of a reagent or kit for warning of postoperative recurrence of resectable NSCLC.

[0010] In the fourth aspect, the present invention provides the application of the combination of the above biomarker and TNM staging in the preparation of a reagent or kit for evaluating the prognosis of resectable NSCLC.

[0011] In the fifth aspect, the application of primers for amplifying telomeres of peripheral blood leukocytes in the preparation of a reagent or kit for screening early resectable NSCLC, warning of postoperative recurrence of resectable NSCLC and evaluating the prognosis of resectable NSCLC.

[0012] Based on the above technical solution, further, the nucleotide sequences of the primers are as follows:

[0013] Telomere-F: CGGTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT;

[0014] Telomere-R: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT.

[0015] Based on the above technical solution, further, the detection process of the kit includes the following steps: isolating leukocytes, measuring the ratio of telomere repeat copy number (T) to single-copy gene number (S) by polymerase chain reaction, and performing data analysis.

[0016] Based on the above technical solution, further, the specific process of separating white blood cells is as follows: Centrifuge the collected blood at 2500-3500g for 5-20 minutes to separate white blood cells.

[0017] Based on the above technical solution, further, the polymerase chain reaction is measured using a Light-Cycler 480 qPCR system and a SYBR Green Premix Pro Taq HS qPCR kit.

[0018] The beneficial effects of the present invention compared with the prior art are as follows:

[0019] 1. The present invention finds that compared with healthy donors, the peripheral blood LTL level in resectable NSCLC patients is significantly decreased (p < 0.0001); the peripheral blood LTL expression level in early-stage NSCLC patients is significantly decreased (p < 0.0001); and the LTL after resection is significantly increased compared with that before resection (p < 0.001), but slightly lower than that of healthy donors. Therefore, the peripheral blood LTL expression level can be used as a marker for screening resectable NSCLC.

[0020] 2. The present invention finds that the LTL level after resection is related to the overall survival (OS) and disease-free survival (DFS), and can be used as a marker for recurrence warning and prognosis evaluation.

[0021] 3. The overall survival (OS) and disease-free survival (DFS) of the long LTL group after resection are longer than those of the short telomere length group (OS p = 0.0024; DFS p = 0.3114); the LTL level after resection is an independent prognostic factor for OS. In addition, we combined the key prognostic factor TNM staging with the postoperative telomere length (LTL) to analyze its predictive ability for the prognosis of resectable NSCLC patients. The area under the curve (AUC) analysis shows that the postoperative LTL has good predictive ability for 5-year OS, with an AUC of 0.606; and also has relatively high predictive ability for DFS, with an AUC of 0.751. Description of the Drawings

[0022] In order to more clearly illustrate the embodiments of the present invention, the drawings involved in the embodiments will be briefly introduced below.

[0023] Figure 1 It is a flow chart of the enrolled patients;

[0024] Figure 2 It is the analysis result of the difference in LTL levels among NSCLC patients with different stages and healthy volunteers. Among them, A is the comparison between NSCLC patients and healthy volunteers, B is the comparison between stage I NSCLC and healthy volunteers, and C is the comparison between early NSCLC and healthy volunteers.

[0025] Figure 3 This is a comparison result graph of LTL before and after surgery for resectable NSCLC patients. Among them, A is the comparison of LTL before and after surgery for resectable NSCLC, B is the comparison of LTL between the healthy control group and NSCLC before and after surgery, C is the comparison of LTL before and after surgery for stage I NSCLC, D is the comparison of LTL before and after surgery for stage I-II NSCLC, and E is the comparison of LTL before and after surgery for stage III-IV NSCLC;

[0026] Figure 4 This is the result of using Kaplan-Meier analysis to predict the overall survival OS (A) and disease-free survival DFS (B) of resectable NSCLC based on the LTL level after surgery;

[0027] Figure 5 This is a graph showing the results of predicting the disease-free survival DFS and overall survival OS of resectable NSCLC by combining LTL after surgery with TNM staging. Among them, A is the analysis of the overall survival (OS) by combining LTL with TNM staging, B is the ROC curve of the 5-year OS of resectable NSCLC, C is the analysis of the disease-free survival (DFS) by combining LTL with TNM staging, and D is the ROC curve of the 5-year DFS of resectable NSCLC. Detailed implementation mode

[0028] The present invention will be described in detail below in conjunction with the embodiments, but the implementation mode of the present invention is not limited thereto. Obviously, the embodiments described below are only part of the embodiments of the present invention. For those skilled in the art, without creative efforts, obtaining other similar embodiments will fall within the protection scope of the present invention.

[0029] Example 1

[0030] This example examines the feasibility of peripheral blood leukocyte telomere length (LTL) as a marker for early screening, postoperative recurrence warning, and prognosis evaluation of resectable non-small cell lung cancer (NSCLC), and specifically includes the following contents:

[0031] 1. Experimental design

[0032] This experiment collected peripheral blood from newly diagnosed non-small cell lung cancer (NSCLC) patients and healthy volunteers in Shandong Provincial Tumor Hospital, and isolated white blood cells. The ratio of telomere repeat copy number (T) to single-copy gene number (S) was measured by polymerase chain reaction, and the differences in leukocyte telomere length (LTL) between healthy volunteers and lung cancer patients were statistically analyzed to evaluate its ability as a screening marker. And LTL quantitative evaluation was performed on patients followed up for 3 months after surgery. The recurrence and prognosis values were evaluated by disease-free survival (DFS) and overall survival (OS).

[0033] 2. Patients and Samples Involved in the Experiment

[0034] From January 1, 2017 to January 31, 2019, newly diagnosed NSCLC patients who visited Shandong Cancer Hospital Affiliated to Shandong First Medical University were screened, and 76 patients met the eligibility criteria for the study. Finally, 76 NSCLC patients and 80 healthy volunteers were included. The flow chart of the enrolled patients is as Figure 1 shown. First, patients who lacked clinicopathological features such as gender, age, smoking, pathological type, T stage, lymph node metastasis, distant metastasis, and TNM stage (a total of 9 patients) and those who lacked postoperative follow-up LTL (a total of 7 patients) were screened out. Then, the 67 selected patients were further screened. Among them, 7 patients could not be followed up for prognostic information. Finally, 60 patients could be analyzed for OS and DFS. All patients underwent preoperative and postoperative pairing (follow-up assessment at 3 months after surgery). Before peripheral blood collection, they had not received any anti-tumor treatment or had any other endocrine, immune, or metabolic diseases. The healthy volunteers did not show any diseases. The patients were followed up by phone or clinical visit. The TNM classification of the eighth edition of UICC / AJCC was used to stage the tumors, and the review of electronic medical records provided us with clinical and pathological data. The white blood cells were separated by centrifuging the collected blood at 3000g for 10 minutes. Then the samples were collected in centrifuge tubes and stored at -80 °C for later use.

[0035] 3. LTL Detection

[0036] The ratio of the number of telomere repeat copies (T) to the number of single-copy genes (S) was determined by qPCR as an indicator of relative telomere length. The expression of gene copy number was detected using the Light-Cycler 480 qPCR system (Roche Diagnostics) and SYBR Green Premix Pro Taq HS qPCR kit (Accurate Biotechnology) according to the manufacturer's instructions. The calculation formula for the average LTL is as follows:

[0037] Mean LTL = lg2 Ct(36B4)-Ct(Telomere)

[0038] Primer sequences:

[0039] Telomere-F: CGGTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT (SEQ ID NO: 1);

[0040] Telomere-R: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT (SEQ ID NO: 2):

[0041] 36B4-F: CAGCAAGTGGGAAGGTGTAATCC (SEQ ID NO: 3);

[0042] 36B4-R: CCCATTCTATCATCAACGGGTACAA (SEQ ID NO: 4).

[0043] Table 1 LTL levels in NSCLC patients and healthy individuals

[0044]

[0045] 4. Mathematical statistical analysis

[0046] Statistical analysis was performed using SPSS 26.0 (IBM Corp., NY, USA), GraphPad Prism 9.0 (GraphPad, CA, USA), and R 4.4.2. Disease-free survival (DFS) was measured from the time of surgery to clinical or radiological progression or death from any cause. Overall survival (OS) was the time from the start of treatment to death from all causes. The Kolmogorov-Smirnov test was used to check the normality of the distribution. For comparison of measurement data, if the data followed a normal distribution, parametric tests were used and presented as mean ± standard deviation; if the data did not follow a normal distribution, non-parametric tests were used with the Mann-Whitney test and presented as median and interquartile range. The receiver operating characteristic curve (ROC curve) was used to evaluate sensitivity and specificity, and the area under the ROC curve (AUC) was used as a performance indicator. Kaplan-Meier analysis and univariate and multivariate Cox proportional hazards regression analysis were used to evaluate disease-free survival (DFS) and overall survival (OS). A p < 0.05 was considered statistically significant.

[0047] 5. Summary of case characteristics of NSCLC patients and the relationship with LTL expression levels

[0048] Table 2 The results analyzed the clinical characteristics of NSCLC patients, including age, gender, smoking status, pathological type, stage, lymph node and distant metastasis, and the LTL level was not related to these clinicopathological parameters.

[0049] Table 2 Summary of case characteristics of NSCLC patients and the relationship with LTL levels

[0050]

[0051]

[0052] 6. Differences in LTL levels between healthy volunteers and NSCLC patients

[0053] The levels of LTL in NSCLC patients and healthy donors were measured by qPCR to determine whether LTL could be used as a biomarker for lung cancer screening. The results showed that the level of LTL was significantly decreased in NSCLC patients, with a statistically significant difference (p < 0.0001), as shown in Figure 1 A. Similarly, the levels of LTL in early NSCLC patients and healthy donors were quantified to determine whether LTL could be used as a biomarker for early NSCLC screening. The results showed that the level of LTL was significantly decreased in early NSCLC patients, as shown in Figure 1 B - C, with a statistically significant difference (p < 0.0001).

[0054] 7. Differences in LTL before and after NSCLC surgery

[0055] The results of the measurement of the differences in LTL before and after NSCLC surgery are as Figure 3 , compared with before surgery, the level of LTL was significantly increased after surgery, with a statistically significant difference (P < 0.001), as shown in Figure 3 A. The level of LTL after surgery was still significantly lower than that of the healthy control group (P < 0.0001), as shown in Figure 3 B. There was no significant difference in LTL between stage I and stage I - II NSCLC before and after surgery ( Figure 3 C - D), but the LTL after surgery in stage III - IV NSCLC was significantly decreased compared with that before surgery (P < 0.0001), as shown in Figure 3 E.

[0056] 8. Relationship between the level of LTL after NSCLC surgery and OS and DFS

[0057] All patients were divided into a long group (2.21 to 2.96, mean 2.37) and a short group (0.98 to 2.21, mean 1.91) according to the median of LTL after surgery. The overall survival (OS) and disease - free survival (DFS) of the long telomere length (LTL) group after surgery were longer than those of the short telomere length group, but the difference in DFS was not statistically significant (OS p = 0.0024; DFS p = 0.3114), as shown in Figure 4 . LTL after surgery was determined to be an independent prognostic factor for OS in both univariate analysis (p = 0.006) and multivariate analysis (p = 0.003), as shown in Table 3; but it did not show significance in the DFS analysis, as shown in Table 4.

[0058] In addition, we combined the key prognostic factor TNM stage with postoperative telomere length (LTL) and analyzed its predictive ability for the prognosis of resectable NSCLC patients. The prognosis of the short LTL + stage I / II group after surgery was the best, while that of the long LTL + stage III / IV group after surgery was the worst, whether it was overall survival (OS) (p < 0.001, Figure 5 A) or disease-free survival (DFS) (p < 0.001, Figure 5 C). Area under the curve (AUC) analysis showed that the combination of postoperative LTL and TNM stage had good predictive ability for 5-year OS ( Figure 5 B), with an AUC of 0.680; it also had relatively high predictive ability for DFS ( Figure 5 D), with an AUC of 0.652, and both were higher than the predictive ability of using TNM stage alone.

[0059] Table 3 Univariate and multivariate analyses (Cox proportional hazards) of LTL and clinicopathological factors related to OS in NSCLC patients

[0060]

[0061] Table 4 Univariate and multivariate analyses (Cox proportional hazards) of LTL and clinicopathological factors related to DFS in NSCLC patients

[0062]

[0063] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A biomarker for screening early resectable NSCLC, warning of recurrence after resection of resectable NSCLC, and evaluating the prognosis of resectable NSCLC, characterized in that, The biomarker is the telomere length (LTL) of peripheral blood leukocytes.

2. Use of the biomarker according to claim 1 in the preparation of a reagent or kit for screening early resectable NSCLC.

3. Use of the biomarker according to claim 1 in the preparation of a reagent or kit for warning of recurrence after resection of resectable NSCLC.

4. Use of the combination of the biomarker according to claim 1 and TNM staging in the preparation of a reagent or kit for evaluating the prognosis of resectable NSCLC.

5. Use of primers for amplifying telomeres of peripheral blood leukocytes in the preparation of a reagent or kit for screening early resectable NSCLC, warning of recurrence after resection of resectable NSCLC, and evaluating the prognosis of resectable NSCLC.

6. The application according to claim 5, characterized in that, The nucleotide sequences of the primers are as follows: Telomere-F: CGGTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT; Telomere-R: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT.

7. The application according to claim 5, wherein The detection process of the kit includes the following steps: isolating leukocytes, measuring the ratio of telomere repeat copy number (T) to single-copy gene number (S) by polymerase chain reaction, and performing data analysis.

8. The application according to claim 7, characterized in that, The specific process of isolating leukocytes is: centrifuging the collected blood at 2500 - 3500 g for 5 - 20 minutes to isolate leukocytes.

9. The application according to claim 7, wherein The polymerase chain reaction is performed using a Light-Cycler480 qPCR system and a SYBR Green Premix Pro Taq HS qPCR kit.