Genetic typing detection kit for bordetella pertussis and detection method thereof

Abstract

The invention relates to a Bordetella pertussis genotyping detection kit and a detection method thereof, and the kit comprises a primer pair and a probe aiming at prn genotyping, which are used for carrying out genotyping detection on prn150 / prn1 / 2; the primer pair and the probe aiming at the ptxC gene typing are used for carrying out typing detection on the ptxC4 / ptxC1; the invention relates to a primer pair and a probe aiming at fhaB gene typing, which are used for carrying out typing detection on fhaB1 / fhaB3. The kit disclosed by the invention has the advantages of good sensitivity, high specificity, accuracy, reliability, rapidness, convenience and the like, is suitable for popularization and application in genotyping detection of pertussis bordetella prn150 / prn1, fhaB1 / fhaB3 and ptxC4 / ptxC1 types, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedical detection, and particularly to a Bordetella pertussis genotyping detection kit and a detection method thereof. Background Art

[0002] Bordetella pertussis (Bp) is the pathogen that causes whooping cough. The disease is characterized by paroxysmal spasmodic cough, inspiratory stridor, and a protracted course, and can lead to serious complications (such as pneumonia, encephalopathy) or even death in infants and young children. Although vaccination has significantly reduced the global incidence of whooping cough, in recent years, the number of reported cases has shown an upward trend in many countries, partly due to the attenuation of vaccine efficacy caused by antigen variation of the pathogen and the hidden extension of the transmission chain caused by latent infections in adults / teenagers. Therefore, the accurate detection of Bordetella pertussis and molecular epidemiological research are of great significance for clinical diagnosis and treatment and public health prevention and control.

[0003] Currently, the laboratory detection of Bordetella pertussis mainly includes the following methods: bacterial culture, serological detection, real-time fluorescence PCR, and whole-genome sequencing, etc. However, most methods focus on the qualitative detection of pathogens and cannot reveal the genetic diversity of strains; it is difficult to balance high-throughput genotyping and cost-effectiveness, which restricts large-scale epidemiological research.

[0004] Therefore, establishing a Bordetella pertussis genotyping detection system applicable to clinical and public health scenarios is the key technical requirement to address the current challenges of whooping cough prevention and control, and will provide core tool support for curbing the rebound of the disease and ensuring the long-term effectiveness of vaccines. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a Bordetella pertussis genotyping detection kit and a detection method thereof, which have the advantages of good sensitivity, high specificity, accuracy, reliability, rapidity, and convenience, are suitable for the popularization and application of Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 genotyping detection, and have broad application prospects.

[0006] In the first aspect of the present invention, a Bordetella pertussis genotyping detection kit is provided. The kit includes: primer pairs and probes for prn genotyping, which are used for genotyping detection of prn150 / prn1 / 2; primer pairs and probes for ptxC genotyping, which are used for genotyping detection of ptxC4 / ptxC1; primer pairs and probes for fhaB genotyping, which are used for genotyping detection of fhaB1 / fhaB3. Among them, the genotyping detection of prn150 / prn1 / 2 refers to distinguishing prn150 and prn1 / 2.

[0007] In the present invention, the pertussis adhesin encoded by the prn gene is an important virulence factor of Bordetella pertussis. The ptxC gene is closely related to the production and regulation of pertussis toxin. The filamentous hemagglutinin encoded by the fhaB gene is one of the main adhesion factors of Bordetella pertussis. The genotypes of the above three genes are closely related to the pathogenicity of bacteria and the ability of vaccine escape. Therefore, genotyping detection of the prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 genes of Bordetella pertussis is of great significance in the epidemiological study of pertussis, the evaluation of vaccine efficacy, and the formulation of disease prevention and control strategies.

[0008] In some embodiments of the present invention, the primer pairs and probes for genotyping the prn gene include: the upstream primer prn150-F with a nucleotide sequence as shown in SEQ ID NO.1, the downstream primer prn150-R with a nucleotide sequence as described in SEQ ID NO.2, and the probe prn150-P with a nucleotide sequence as shown in SEQ ID NO.3; the primer pairs and probes for genotyping the ptxC gene include: the upstream primer ptxC4-F with a nucleotide sequence as shown in SEQ ID NO.4, the downstream primer ptxC4-R with a nucleotide sequence as shown in SEQ ID NO.5, and the probe ptxC4-P with a nucleotide sequence as shown in SEQ ID NO.6; the primer pairs and probes for genotyping the fhaB gene include: the upstream primer fhaB1-F with a nucleotide sequence as shown in SEQ ID NO.7, the downstream primer fhaB1-R with a nucleotide sequence as shown in SEQ ID NO.8, and the probe fhaB1-P with a nucleotide sequence as shown in SEQ ID NO.9.

[0009] In some preferred embodiments of the present invention, the specific sequences and serial numbers of the primer probes are as follows: prn150-F: GGTCCAACGCAGCGCT (SEQ ID NO.1);

[0010] prn150-R: GTCTTCCGGCTGCAATGAC (SEQ ID NO.2);

[0011] prn150-P: 5'-fluorescent reporter group-GCTTGCATATCGGCGCCCTG-fluorescent quenching group-3' (SEQ ID NO.3);

[0012] ptxC4-F: CCGGCAGCGTCGATATGT (SEQ ID NO.4);

[0013] ptxC4-R: CATTCGCGGTATCCGTCAAG (SEQ ID NO.5);

[0014] ptxC4-P: 5'-Fluorescent reporter group-GCTCGGATCTGTTCGCCTGTCCA-Fluorescent quencher group-3' (SEQ ID NO.6);

[0015] fhaB1-F: CAGCTTGTTGAGCAAGGCAAAGG (SEQ ID NO.7);

[0016] fhaB1-R: AAGCAGGCCATCGTCGTC (SEQ ID NO.8);

[0017] fhaB1-P: 5'-Fluorescent reporter group-CGAAGCGAACGCGCTGCT-Fluorescent quencher group-3' (SEQ ID NO.9).

[0018] In some preferred embodiments of the present invention, each of the probes comprises a fluorescent reporter group and a fluorescent quencher group, and the fluorescent reporter group is selected from: FAM, Cy3, Cy5, VIC, HEX, JOE, TAMRA, ROX, TET, NED, or a combination thereof; and / or the fluorescent quencher group is selected from: MGB, BHQ1, BHQ2, BHQ3, TAMRA, or a combination thereof.

[0019] In some more preferred embodiments of the present invention, the fluorescent reporter group of the probe prn150-P is FAM and the fluorescent quencher group is BHQ; the fluorescent reporter group of the probe ptxC4-P is VIC and the fluorescent quencher group is BHQ; the fluorescent reporter group of the probe haB1-P is ROX and the fluorescent quencher group is BHQ.

[0020] In some preferred embodiments of the present invention, the concentration of each of the primers is 0.2 - 0.3 mM, and the concentration of each of the probes is 0.1 - 0.2 mM.

[0021] In some embodiments of the present invention, the kit further comprises internal reference primers and a probe: the upstream primer IC-F with the nucleotide sequence shown in SEQ ID NO.10, the downstream primer IC-R with the nucleotide sequence shown in SEQ ID NO.11, and the probe IC-P with the nucleotide sequence shown in SEQ ID NO.12.

[0022] In some preferred embodiments of the present invention, the specific sequences and serial numbers of the primer probes are as follows: IC-F: TGCGGAAAATGCTTTACCTGA (SEQ ID NO.10);

[0023] IC-R: CGTAAGTCTCGAACGTTGCGT (SEQ ID NO.11);

[0024] IC-P: 5'-Fluorescent reporter group-CGTCCATGTCAGCAAGGAAGAAC-Fluorescent quencher group-3' (SEQ ID NO.12).

[0025] In some preferred embodiments of the present invention, the fluorescent reporter group of the probe IC-P is CY5, and the fluorescent quencher group is BHQ.

[0026] In some preferred embodiments of the present invention, the concentration ratio of each primer and probe in the reaction solution is: SEQ ID NO.1:SEQ ID NO.2:SEQ ID NO.3:SEQ ID NO.4:SEQ ID NO.5:SEQ ID NO.6:SEQ ID NO.7:SEQ ID NO.8:SEQ ID NO.9:SEQ ID NO.10:SEQ ID NO.11:SEQ ID NO.12 is 200 nM:200 nM:100 nM:200 nM:200 nM:100 nM:200 nM:200 nM:100 nM:200 nM:200 nM:100 nM.

[0027] In some embodiments of the present invention, the sequence of the prn150 type target gene fragment is SEQ ID NO.13; the sequence of the ptxC4 type target gene fragment is SEQ ID NO.14; the sequence of the fhaB1 type target gene fragment is SEQ ID NO.15.

[0028] In the present invention, the sequence of the prn150 type target gene fragment is:

[0029] CAATGTCACGGTCCAACGCAGCGCTATCGTCGACGGGGGCTTGCATATCGGCGCCCTGCAGTCATTGCAGCCGGAAGAC (SEQ ID NO.13);

[0030] The sequence of the ptxC4 type target gene fragment is:

[0031] CCCGGCAGCGTCGATATGTTGAGCCGCCGGCTCGGATCTGTTCGCCTGTCCATGTTTTTCCTTGACGGATACCGCGAATG (SEQ ID NO.14);

[0032] The sequence of the fhaB1 type target gene fragment is:

[0033] CAGCTTGTTGAGCAAGGCAACGGCCGCCGTCAGCCGGGCGTTGCCGCCCGCCTCGATCAGCGCGGCCCGTTTATTGGTGATGTTCTGCGCCTTGACGGTCAGCTCCCCGGCGGCCCACAGCAGCGCGTTCGCTTCGTTGGCCACGTTGCCGTGCGCCGAACTCAGCGTCAGGTCCTTGCCGACGACGATGGCCTGCTT(SEQ ID NO.15);

[0034] The sequence of the reference gene fragment for the target gene is:

[0035] TGCGGAAAATGCTTTACCTGATCTACGTGGCCGGCATCTCCGTACGCGTCCATGTCAGCAAGGAAGAACAGTATTACGACTATGAGGACGCAACGTTCGAGACTTACG(SEQ ID NO.16).

[0036] In the present invention, the primer pairs and probes for genotyping the prn gene, the primer pairs and probes for genotyping the ptxC gene, the primers for genotyping the fhaB gene, and the reference primers and probes are designed and prepared according to the above-mentioned prn150-type target gene fragment, ptxC4-type target gene fragment, fhaB1-type target gene fragment, and reference gene fragment for the target gene, respectively.

[0037] In some embodiments of the present invention, the kit further includes a reaction solution, an enzyme mixture, a positive control, and a blank control.

[0038] In some embodiments of the present invention, the kit includes: a reaction solution, a detection solution, an enzyme mixture, a positive control, and a blank control;

[0039] Wherein, the detection solution contains: the Bordetella pertussis prn150-type amplification primers prn150-F, prn150-R, and the probe prn150-P; the Bordetella pertussis ptxC4-type amplification primers ptxC4-F, ptxC4-R, and the probe ptxC4-P; the Bordetella pertussis fhaB1-type amplification primers fhaB1-F, fhaB1-R, and the probe fhaB1-P; the Bordetella pertussis reference primers IC-F, IC-R, and the probe IC-P.

[0040] In some preferred embodiments of the present invention, the reaction solution contains 5×PCR buffer, 40-60 mM MgCl2, and 0.4-0.6 mM dNTP.

[0041] In some preferred embodiments of the present invention, the positive control is: the specific amplification fragments of Bordetella pertussis prn150, fhaB1, and ptxC4 are ligated to a pUC57 plasmid vector, and the amplification fragment of the Bordetella pertussis internal reference gene is ligated to another pUC57 plasmid vector. The two plasmids are respectively diluted to 10 6 copies / mL with sterile purified water, and then the two diluted plasmids are mixed in equal volumes.

[0042] In some preferred embodiments of the present invention, the enzyme mixture includes a hot-start Taq enzyme and a DNA UDG enzyme. Preferably, the hot-start Taq enzyme and the DNA UDG enzyme are each 5 U / μl.

[0043] In some preferred embodiments of the present invention, the blank control is sterile purified water.

[0044] In a second aspect of the present invention, there is provided a detection method for genotyping Bordetella pertussis DNA samples for prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1 genes using the above kit, comprising the following steps:

[0045] S1. Sample preparation: Amplify the Bordetella pertussis DNA sample.

[0046] S2. Preparation and loading of the PCR reaction system: In a fluorescence PCR amplification system with a total volume of 25 μl, add 15 μl of the reaction solution, 4 μl of the detection solution, 1 μl of the enzyme mixture, and 5 μl of the DNA specimen to be tested.

[0047] S3. Place the PCR reaction tube into a fluorescence PCR amplifier for amplification detection.

[0048] In some embodiments of the present invention, in step S3, the cycling parameters for the amplification detection are set as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 30 s, for 45 cycles.

[0049] In some embodiments of the present invention, using the Bordetella pertussis DNA solution as a template, and simultaneously using the positive control and the blank control, perform fluorescence quantitative PCR detection with the Bordetella pertussis prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1 gene typing detection kit of the present invention; after the reaction, adjust the baseline and the threshold line, and determine the result based on the Ct value of the sample.

[0050] In the present invention, the detection principle of the kit is based on ARMS-qPCR. ARMS-qPCR is Real-time Fluorescent Quantitative PCR (Quantitative Real-time PCR, qPCR) based on the Amplification Refractory Mutation System (ARMS), which is a highly specific gene mutation detection method. The following is a detailed description of its working principle and implementation process:

[0051] (1) The basic principle of ARMS-qPCR is to utilize the complementarity between the 3'-end base of the primer and the template DNA to achieve specific amplification. When the 3'-end base of the primer is completely complementary to the template DNA, the primer can be normally extended to form a DNA amplification product. However, if the 3'-end base of the primer is not complementary to the template DNA, that is, there is a mismatch, the primer extension will be inhibited or even completely terminated.

[0052] (2) In ARMS-qPCR, primer-probes are designed for mutant (MT) template DNA, and the last base at the 3'-end of the upstream primer is set as the corresponding mutant base. Therefore, when PCR amplification is carried out, only the primer that is completely matched with the template DNA can perform effective amplification, thereby realizing the detection of specific gene mutations. To facilitate the distinction between the amplification curves of the mutant type and the wild type, usually an additional set of universal primer-probe combinations is designed as an internal reference primer group, and the difference between the detected Ct and the internal reference Ct is used to facilitate the determination of the specific genotype of the sample.

[0053] (3) In addition, the Real-time Fluorescent Quantitative PCR technology adds a fluorescent dye or a fluorescent-labeled probe to the PCR reaction system to monitor the change of the fluorescent signal during the PCR amplification process in real time, thereby realizing the quantitative analysis of the DNA amplification product.

[0054] In the present invention, the implementation process of ARMS-qPCR generally includes the following steps:

[0055] (1) Sample preparation: Extract the DNA of the sample to be tested as the template for PCR amplification. This usually involves steps such as cell lysis, DNA extraction, and purification.

[0056] (2) Primer design: Design specific primers for mutant template DNA according to the known mutation sites of the target gene. The design of the primers needs to follow certain principles, such as primer length, GC content, annealing temperature, etc., to ensure the specificity and amplification efficiency of the primers.

[0057] (3) Preparation of PCR reaction system: Mix the extracted DNA template, designed primers, dNTPs, DNA polymerase, reaction buffer, and fluorescent dye or fluorescently labeled probe, etc., to prepare a PCR reaction system.

[0058] (4) PCR amplification: Place the PCR reaction system on a PCR instrument for amplification. During the amplification process, DNA amplification is achieved by controlling temperature cycles (denaturation, annealing, extension). At the same time, the change in fluorescence signal is monitored in real time to obtain the kinetic curve of PCR amplification.

[0059] (5) Result analysis: Determine the specific genotype of the test sample based on the kinetic curve of PCR amplification.

[0060] The above technical solutions of the present invention have the following advantages compared with the prior art:

[0061] (1) The present invention designs specific amplification primer probes targeting the sequences where the differential bases of three gene genotypes of Bordetella pertussis, namely prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1, are located. The primer probe sequences are novel and uniquely designed, with good specificity and high sensitivity, and can efficiently and accurately detect the DNA of Bordetella pertussis of prn150, fhaB1, and ptxC4 types. However, the detection efficiency for Bordetella pertussis of prn1, fhaB3, and ptxC1 types is extremely low. Through comparison with the internal reference Ct value, the genotyping detection of Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 can be achieved.

[0062] (2) The present invention is a single-tube quadruple PCR detection reagent, which can achieve the genotyping detection of 3 loci of Bordetella pertussis in a single tube, with accurate results and convenient application.

[0063] In summary, the present invention introduces an internal reference of Bordetella pertussis and specific primer probes for prn150 / fhaB1 / ptxC4 types. The quadruple primer probe group has high amplification efficiency and no interference with each other, and can achieve the genotyping detection of Bordetella pertussis DNA of prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 types in a single tube. The present invention is not only the first publicly disclosed real-time fluorescence quantitative PCR method for the genotyping of Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 types, but also has advantages such as good sensitivity, high specificity, accuracy, reliability, rapidity, and convenience, thus realizing the rapid genotyping of prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1 genes of Bordetella pertussis DNA. Description of the Drawings

[0064] To make the content of the present invention easier to be clearly understood, the following further describes the present invention in detail according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein,

[0065] Figure 1 is the detection result of Bordetella pertussis prn1 type DNA with a concentration of 10 8 copies / mL in Example 2 of the present invention;

[0066] Figure 2 is the detection result of Bordetella pertussis prn1 type DNA with a concentration of 10 6 copies / mL in Example 2 of the present invention;

[0067] Figure 3 is the detection result of Bordetella pertussis prn1 type DNA with a concentration of 10 4 copies / mL in Example 2 of the present invention;

[0068] Figure 4 is the detection result of Bordetella pertussis prn150 type DNA with a concentration of 10 8 copies / mL in Example 2 of the present invention;

[0069] Figure 5 is the detection result of Bordetella pertussis prn150 type DNA with a concentration of 10 6 copies / mL in Example 2 of the present invention;

[0070] Figure 6 is the detection result of Bordetella pertussis prn150 type DNA with a concentration of 10 4 copies / mL in Example 2 of the present invention;

[0071] Figure 7 is the detection result of Bordetella pertussis PtxC1 type DNA with a concentration of 10 8 copies / mL in Example 2 of the present invention;

[0072] Figure 8 is the detection result of Bordetella pertussis PtxC1 type DNA with a concentration of 10 6 copies / mL in Example 2 of the present invention;

[0073] Figure 9 is the detection result of Bordetella pertussis PtxC1 type DNA with a concentration of 10 4 copies / mL in Example 2 of the present invention;

[0074] Figure 10 is the detection result of Bordetella pertussis PtxC1 type DNA with a concentration of 10 8Detection results of Bordetella pertussis PtxC4 type DNA at copies / mL;

[0075] Figure 11 are the detection results of Bordetella pertussis PtxC4 type DNA at a concentration of 10 6 copies / mL in Example 2 of the present invention;

[0076] Figure 12 are the detection results of Bordetella pertussis PtxC4 type DNA at a concentration of 10 4 copies / mL in Example 2 of the present invention;

[0077] Figure 13 are the detection results of Bordetella pertussis fhaB3 type DNA at a concentration of 10 8 copies / mL in Example 2 of the present invention;

[0078] Figure 14 are the detection results of Bordetella pertussis fhaB3 type DNA at a concentration of 10 6 copies / mL in Example 2 of the present invention;

[0079] Figure 15 are the detection results of Bordetella pertussis fhaB3 type DNA at a concentration of 10 4 copies / mL in Example 2 of the present invention;

[0080] Figure 16 are the detection results of Bordetella pertussis fhaB1 type DNA at a concentration of 10 8 copies / mL in Example 2 of the present invention;

[0081] Figure 17 are the detection results of Bordetella pertussis fhaB1 type DNA at a concentration of 10 6 copies / mL in Example 2 of the present invention;

[0082] Figure 18 are the detection results of Bordetella pertussis fhaB1 type DNA at a concentration of 10 4 copies / mL in Example 2 of the present invention. Detailed implementation manners

[0083] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the specific embodiments cited do not limit the present invention.

[0084] Example 1: A kit for genotyping Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, ptxC4 / ptxC1 genes

[0085] In this example, a genotyping detection kit for Bordetella pertussis prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1 genes was prepared. The kit includes: reaction solution, detection solution, enzyme mixture, positive control, and blank control. Among them:

[0086] (1) The reaction solution contains: 5×PCR buffer, 50 mM MgCl2, and 0.5 mM dNTP.

[0087] (2) The positive control is: the specific amplification fragments of Bordetella pertussis prn150, fhaB1, and ptxC4 types are ligated to a pUC57 plasmid vector, and the amplification fragment of the Bordetella pertussis internal reference gene is ligated to a pUC57 plasmid vector. The two plasmids are respectively diluted 10 6 times with sterile purified water, and then the two diluted plasmids are mixed in equal volume as the final positive control.

[0088] (3) The PCR enzyme mixture includes 5 U / μl hot start Taq enzyme and 5 U / μl DNA UDG enzyme.

[0089] (4) The detection solution contains: Bordetella pertussis prn150 type amplification primers prn150-F, prn150-R and probe prn150-P; Bordetella pertussis ptxC4 type amplification primers ptxC4-F, ptxC4-R and probe ptxC4-P; Bordetella pertussis fhaB1 type amplification primers fhaB1-F, fhaB1-R and probe fhaB1-P; Bordetella pertussis internal reference primers IC-F, IC-R and probe IC-P. Further, the concentration of each primer is 0.2 mM, and the concentration of each probe is 0.1 mM. The 5' end of probe prn150-P is labeled with the reporter fluorescent dye FAM, and the 3' end is labeled with the quenching fluorescent dye BHQ; the 5' end of probe ptxC4-P is labeled with the reporter fluorescent dye VIC, and the 3' end is labeled with the quenching fluorescent dye BHQ; the 5' end of probe fhaB1-P is labeled with the reporter fluorescent dye ROX, and the 3' end is labeled with the quenching fluorescent dye BHQ; the 5' end of probe IC-P is labeled with the reporter fluorescent dye CY5, and the 3' end is labeled with the quenching fluorescent dye BHQ. The primer and probe sequences are shown in Table 1.

[0090] Table 1. List of primers and probes

[0091]

[0092] (5) The blank control is sterile purified water.

[0093] Bordetella pertussis is the pathogen of whooping cough, and its genome contains multiple genes related to virulence, immune response, and epidemiological characteristics. Among them, the genotyping of prn (encoding pertussis adhesin), ptxC (encoding the regulatory gene of pertussis toxin), and fhaB (encoding the key gene of pertussis filamentous hemagglutinin) is of great significance in the research, diagnosis, treatment, prevention, and control of whooping cough. The following is a detailed elaboration on the significance of the genotyping of these three genes:

[0094] Significance of prn genotyping: The pertussis adhesin encoded by the prn gene is an important virulence factor of Bordetella pertussis and is involved in the adhesion process of bacteria to host cells. Through prn genotyping, the genetic variation and epidemic trend of Bordetella pertussis can be monitored, and new genotypes or variant strains can be discovered in a timely manner. Current whooping cough vaccines are mostly designed based on certain antigens of Bordetella pertussis, including pertussis adhesin. Through prn genotyping, the sensitivity of different genotypes of Bordetella pertussis to the vaccine can be evaluated, thereby understanding the efficacy of the vaccine. Different genotypes of Bordetella pertussis may have different sensitivities to antibiotics. Through prn genotyping, it can provide a basis for clinicians to select appropriate antibiotics, thus improving the treatment effect.

[0095] Significance of ptxC genotyping: The ptxC gene is part of the regulatory gene of pertussis toxin and is closely related to the production and regulation of pertussis toxin. Through ptxC genotyping, the regulatory mechanism of pertussis toxin can be deeply understood, providing important clues for the study of the pathogenesis of whooping cough. Pertussis toxin is one of the important diagnostic markers of whooping cough. Through ptxC genotyping, it can assist in the diagnosis of whooping cough and monitor the progression and severity of the disease.

[0096] Significance of fhaB genotyping: The filamentous hemagglutinin encoded by the fhaB gene is one of the main adhesion factors of Bordetella pertussis and is involved in the adhesion process of bacteria to host cells. Through fhaB genotyping, the virulence and adhesion mechanism of Bordetella pertussis can be deeply understood, providing an important basis for the study of the pathogenesis of whooping cough. Filamentous hemagglutinin is one of the important antigens of whooping cough vaccine. Through fhaB genotyping, antigens with better immune effects can be screened, guiding the research and optimization of the vaccine and improving the protective effect of the vaccine. Different genotypes of Bordetella pertussis may have differences in transmission ability and pathogenicity. Through fhaB genotyping, the transmission risk of whooping cough and the effectiveness of prevention and control strategies can be evaluated, providing a basis for formulating scientific prevention and control measures.

[0097] The research on Bordetella pertussis antigen genes is of great significance for vaccine development, analysis of virulence mechanisms, epidemiological surveillance, and assessment of vaccine escape phenomena. By deeply understanding the variations and functions of these genes, a scientific basis can be provided for controlling pertussis. Currently, the mainstream research on Bordetella pertussis antigen genes mainly focuses on the following categories of genes: PT-related genes (ptxA, ptxB, ptxC, ptxD, ptxE, ptxP), PRN gene (prn), fimbrial protein genes (fim2, fim3), and FHA gene (fhaB).

[0098] In the study of genotyping and sorting of Bordetella pertussis samples in (China), it was found that among the above genes, ptxA, ptxB, ptxD, ptxE, fim2, and fim3 are of single genotypes without gene mutation. However, prn, ptxC, ptxP, and fhaB have gene mutations in China. The domestic prn genotypes are prn1, prn2, and prn150 types, ptxC is ptxC1 type and ptxC4 type, and fhaB is fhaB1 and fhaB3 types. Based on the above research, it can be known that the mutated Bordetella pertussis antigen genes in China are four antigen genes, namely ptxP, ptxC, fhaB, and prn. Since ptxP and ptxC are linked genes, only three antigen genes, namely ptxC, fhaB, and prn, need to be selected to develop a typing detection kit for the study of Bordetella pertussis epidemiology in China.

[0099] In summary, the genotyping of prn, ptxC, and fhaB genes of Bordetella pertussis is of great significance in the research, diagnosis, treatment, and prevention and control of pertussis. The genotyping of these genes not only helps to deeply understand the pathogenesis of pertussis, evaluate the vaccine efficacy, and guide treatment, but also provides an important basis for formulating scientific prevention and control strategies.

[0100] Example 2: A method for genotyping Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, ptxC4 / ptxC1 genotypes

[0101] A method for genotyping Bordetella pertussis prn150 / prn1, fhaB1 / fhaB3, ptxC4 / ptxC1 genotypes, using the kit of Example 1, includes the following experimental steps:

[0102] (1) Main reagents and instruments: Use the kit reagents in Example 1; the fluorescence quantitative PCR instrument is the Shanghai Hongshi SLAN-96 type fluorescence quantitative PCR instrument.

[0103] (2) Sample requirements: Use Bordetella pertussis DNA solution as the template.

[0104] (3) PCR Amplification and Result Interpretation:

[0105] A. Primer and Probe Design: Based on the universal DNA sequence of Bordetella pertussis, reference primers and probes were designed. Specific amplification primer-probes were designed using the sequences where the differential bases of the three gene typing, prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1, are located as targets for the specific detection of the DNA of prn150, fhaB1, and ptxC4 types of Bordetella pertussis. The primer-probes are shown in Table 1.

[0106] B. Positive Control: The specific amplification fragments of prn150, fhaB1, and ptxC4 types of Bordetella pertussis were ligated to a pUC57 plasmid vector, and the amplification fragment of the reference gene of Bordetella pertussis was ligated to a pUC57 plasmid vector. The two plasmids were respectively diluted 10 6 times with sterile purified water, and then the two diluted plasmids were mixed in equal volumes as the final positive control.

[0107] C. Negative Control: The negative control was sterile purified water, containing no DNA fragments.

[0108] D. Detection on the Machine: In a 25 μL fluorescence quantitative PCR amplification system, 15 μl of reaction solution, 4 μl of detection solution, 1 μl of enzyme mixture, and 5 μl of nucleic acid specimen were respectively added. The reaction conditions for PCR amplification were pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing and extension at 61 °C for 30 s, for 45 cycles. The amplification system of fluorescence quantitative PCR is shown in Table 2 below, and the reaction conditions of fluorescence quantitative PCR are shown in Table 3 below:

[0109] Table 2. PCR Amplification System

[0110]

[0111] Table 3. PCR Amplification Program

[0112]

[0113] E. Data Processing: After the reaction, the Start value, End value of the baseline of the FAM / VIC channels and the value of the threshold line were respectively adjusted according to the actual situation (the Start value is recommended to be set between 3 - 15, the End value is recommended to be set between 5 - 20, and the threshold lines of both channels are adjusted to 120). Click Analysis to obtain the analysis results and get the Ct values of the FAM and VIC channels.

[0114] F. Validity Judgment: The positive control and negative control must meet the standards in Table 4, otherwise the experimental results are judged invalid.

[0115] Table 4. Validity Judgment Criteria

[0116]

[0117] G. Result Interpretation: The results shall be interpreted according to Table 5.

[0118] Table 5. Genotyping Interpretation Criteria

[0119]

[0120] (4) Experimental Results:

[0121] A. Genotyping Specificity Detection Results of Bordetella pertussis prn1 Type Nucleic Acid Samples: Dilute the Bordetella pertussis prn1 type DNA sample to dilutions of 10 8 、10 6 and 10 4 copies / mL, and perform genotyping detection using the fluorescence PCR method established in the present invention. The detection results of the samples with concentrations of 10 8 、10 6 and 10 4 copies / mL are shown in Figures 1-3 . As can be seen from the results, the Ct difference between the FAM channel and the CY5 channel is always greater than 8 (or the Ct value of the CY5 channel is less than 35 while the Ct value of the FAM channel is not detected). According to the genotyping interpretation criteria in Table 5, for the Bordetella pertussis prn1 type DNA sample, the kit designed in the present invention can make an accurate genotyping judgment through the Ct difference between the FAM channel and the CY5 channel.

[0122] B. Genotyping Specificity Detection Results of Bordetella pertussis prn150 Type Nucleic Acid Samples: Dilute the Bordetella pertussis prn150 type DNA sample to concentrations of 10 8 、10 6 and 10 4 copies / mL, and perform genotyping detection using the fluorescence PCR method established in the present invention. The detection results of the samples with concentrations of 10 8 、10 6 and 10 4 copies / mL are shown in Figures 4-6 . As can be seen from the results, the Ct difference between the FAM channel and the VIC channel is always less than 8. According to the genotyping interpretation criteria in Table 5, for the Bordetella pertussis prn150 type DNA sample, the kit designed in the present invention can make an accurate genotyping judgment through the Ct difference between the FAM channel and the CY5 channel.

[0123] C. Genotyping Specificity Detection Results of Bordetella pertussis PtxC1 Type Nucleic Acid Samples: Dilute the Bordetella pertussis PtxC1 type DNA sample to 10 8 、106 and 10 4 copies / mL dilution solution, and the typing detection was carried out by the fluorescence PCR method established by the present invention. 10 8 、10 6 and 10 4 The detection results of samples with concentrations of copies / mL are shown in Figures 7-9 . It can be seen from the results that the Ct difference between the VIC channel and the CY5 channel is always greater than 8 (or the Ct value of the CY5 channel is less than 35 while the Ct value of the VIC channel is not detected). According to the typing interpretation criteria in Table 5, for the Bordetella pertussis DNA sample of PtxC1 type, the kit designed by the present invention can make an accurate typing judgment through the Ct difference between the VIC channel and the CY5 channel.

[0124] D. Typing specificity detection results of Bordetella pertussis PtxC4 type nucleic acid samples: Dilute the Bordetella pertussis PtxC4 type DNA sample to 10 8 、10 6 and 10 4 copies / mL concentration, and the typing detection was carried out by the fluorescence PCR method established by the present invention. 10 8 、10 6 and 10 4 The detection results of samples with concentrations of copies / mL are shown in Figures 10-12 . It can be seen from the results that the Ct difference between the VIC channel and the VIC channel is always less than 8. According to the typing interpretation criteria in Table 5, for the Bordetella pertussis DNA sample of PtxC4 type, the kit designed by the present invention can make an accurate typing judgment through the Ct difference between the VIC channel and the CY5 channel.

[0125] E. Typing specificity detection results of Bordetella pertussis fhaB3 type nucleic acid samples: Dilute the Bordetella pertussis fhaB3 type DNA sample to 10 8 、10 6 and 10 4 copies / mL dilution solution, and the typing detection was carried out by the fluorescence PCR method established by the present invention. 10 8 、10 6 and 10 4 The detection results of samples with concentrations of copies / mL are shown in Figures 13-15 . It can be seen from the results that the Ct difference between the ROX channel and the CY5 channel is always greater than 8 (or the Ct value of the CY5 channel is less than 35 while the Ct value of the VIC channel is not detected). According to the typing interpretation criteria in Table 5, for the Bordetella pertussis DNA sample of fhaB3 type, the kit designed by the present invention can make an accurate typing judgment through the Ct difference between the ROX channel and the CY5 channel.

[0126] F. Typing-specific detection results of Bordetella pertussis fhaB1-type nucleic acid samples: Dilute the Bordetella pertussis fhaB1-type DNA sample to concentrations of 10 8 , 10 6 and 10 4 copies / mL, and perform typing detection using the fluorescence PCR method established in the present invention. The detection results of the samples with concentrations of 10 8 , 10 6 and 10 4 copies / mL are shown in Figures 16-18 . It can be seen from the results that the Ct difference between the ROX channel and the VIC channel is always less than 8. According to the typing interpretation criteria in Table 5, for the Bordetella pertussis fhaB1-type DNA sample, the kit designed in the present invention can make an accurate typing judgment through the Ct difference between the ROX channel and the CY5 channel.

[0127] G. Results of the lowest detection limit and repeatability test: Mix 4 kinds of plasmids of prn150 / ptxC4 / fhaB1 / internal reference to a plasmid mixture with a final concentration of 10 4 copies / mL to simulate the Bordetella pertussis DNA of the prn150-ptxC4-fhaB1 type; mix 4 kinds of plasmids of prn1 / ptxC1 / fhaB3 / internal reference to a plasmid mixture with a final concentration of 10 4 copies / mL to simulate the Bordetella pertussis DNA of the prn1-ptxC1-fhaB3 type; repeat the detection of the above samples 20 times with the amplification system of the present invention. The experimental results are shown in Table 6, indicating that the lowest detection limit of the present invention for the above two samples can reach 10 4 copies / mL.

[0128] The CV value is the coefficient of variation, which is a statistic measuring the degree of variation of each observed value in the measurement index. The fluorescence PCR platform usually uses the CV value of the CT value to measure the detection repeatability. The data in Table 6 show that in the 20 repeated experiments of low-concentration samples, the CV of each index < 3% (CV = standard deviation of CT ÷ average value of CT), indicating that the detection repeatability of the fluorescence PCR method established in this example according to the present invention is good.

[0129] Table 6. Results of the lowest detection limit test

[0130]

[0131]

[0132] In summary, the detection results in this example show that the method of the present invention has good sensitivity, high specificity, good repeatability, and accurate and reliable typing results.

[0133] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.

Claims

1. A Bordetella pertussis genotyping detection kit, characterized in that, The kit includes: Primer pairs and probes for genotyping the prn gene, used for genotyping detection of prn150 / prn1 / 2; Primer pairs and probes for genotyping the ptxC gene, used for genotyping detection of ptxC4 / ptxC1; Primer pairs and probes for genotyping the fhaB gene, used for genotyping detection of fhaB1 / fhaB3.

2. The kit according to claim 1, wherein Wherein: The primer pairs and probes for genotyping the prn gene include: upstream primer prn150-F with a nucleotide sequence as shown in SEQ ID NO.1, downstream primer prn150-R with a nucleotide sequence as described in SEQ ID NO.2, and probe prn150-P with a nucleotide sequence as shown in SEQ ID NO.3; The primer pairs and probes for genotyping the ptxC gene include: upstream primer ptxC4-F with a nucleotide sequence as shown in SEQ ID NO.4, downstream primer ptxC4-R with a nucleotide sequence as shown in SEQ ID NO.5, and probe ptxC4-P with a nucleotide sequence as shown in SEQ ID NO.6; The primer pairs and probes for genotyping the fhaB gene include: upstream primer fhaB1-F with a nucleotide sequence as shown in SEQ ID NO.7, downstream primer fhaB1-R with a nucleotide sequence as shown in SEQ ID NO.8, and probe fhaB1-P with a nucleotide sequence as shown in SEQ ID NO.

9.

3. The kit according to claim 2, wherein Each of the probes contains a fluorescent reporter group and a fluorescent quenching group, wherein: The fluorescent reporter group of the probe prn150-P is FAM, and the fluorescent quenching group is BHQ; The fluorescent reporter group of the probe ptxC4-P is VIC, and the fluorescent quenching group is BHQ; The fluorescent reporter group of the probe haB1-P is ROX, and the fluorescent quenching group is BHQ.

4. The kit according to claim 2, wherein The concentration of each of the primers is 0.2 - 0.3 mM, and the concentration of each of the probes is 0.1 - 0.2 mM.

5. The kit according to claim 1, characterized in that, The kit further includes internal reference primers and probes: upstream primer IC-F with a nucleotide sequence as shown in SEQ ID NO.10, downstream primer IC-R with a nucleotide sequence as described in SEQ ID NO.11, and probe IC-P with a nucleotide sequence as shown in SEQ ID NO.

12.

6. The kit according to claim 1, wherein The target gene fragment sequence of the prn150 type is SEQ ID NO.13; the target gene fragment sequence of the ptxC4 type is SEQ ID NO.14; the target gene fragment sequence of the fhaB1 type is SEQ ID NO.

15.

7. The kit according to claim 1, wherein The kit further includes a reaction solution, an enzyme mixture, a positive control product, and a blank control product.

8. The kit according to claim 7, wherein The reaction solution contains 5×PCR buffer, 40 - 60 mM MgCl2, 0.4 - 0.6 mM dNTP; and / or The positive control product is: the specific amplification fragments of Bordetella pertussis prn150, fhaB1, and ptxC type 4 are ligated to a pUC57 plasmid vector, and the amplification fragment of the Bordetella pertussis internal reference gene is ligated to another pUC57 plasmid vector. The two plasmids are respectively diluted to 10 6 copies / mL with sterile purified water, and then the two diluted plasmids are mixed in equal volumes; and / or The enzyme mixture includes hot start Taq enzyme, DNA UDG enzyme; and / or The blank control product is sterile purified water.

9. A detection method for the kit according to any one of claims 1-8, characterized in that, It includes the following steps: S1. Sample preparation: Amplify the Bordetella pertussis DNA sample; S2. Preparation and sample loading of the PCR reaction system: Add reaction solution, detection solution, enzyme mixture, and the DNA specimen to be tested into the fluorescence PCR amplification system respectively; S3. Place the PCR reaction tube into a fluorescence PCR amplifier for amplification detection.

10. The detection method according to claim 9, wherein In step S3, the cycling parameters for the amplification detection are set as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 30 s, for 45 cycles.

Images