InDelFW2 molecular marker related to single fruit weight of pear and application of InDelFW2 molecular marker
By developing InDel_FW_2 molecular markers related to pear single fruit weight, and using PCR amplification and electrophoresis detection, the problem of low pear fruit size identification and breeding efficiency in the prior art was solved, and rapid, simple and accurate fruit size identification and breeding were achieved.
Patent Information
- Application Number
- CN202510589988.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-07-25
AI Technical Summary
The existing technology is difficult to efficiently and accurately identify and select the size of pear fruits. It is affected by the complex interaction between environmental and genetic factors, resulting in inefficient breeding.
A molecular marker of InDel_FW_2 located in chromosome 11 of the genome of the 'Red Crispy Pear' was developed. Through PCR amplification and electrophoresis detection, the insertion and deletion of the InDel_FW_2 molecular marker was used to distinguish the weight of the pear single fruit using the insertion and deletion of the InDel_FW_2 molecular marker, and a kit was provided for the amplification primer of the InDel_FW_2 molecular marker, which was used to quickly identify the weight of the pear single fruit.
It realizes rapid, simple and accurate identification of the weight of pear fruits, simple operation and strong specificity, reduces interference from external factors, and improves the breeding accuracy and efficiency of pear fruit size.
Smart Images

Figure CN120366502A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of pear molecular breeding, and relates to an InDel_FW_2 molecular marker related to single fruit weight of pear and its application. Background Art
[0002] Pear (Pyrus L.) is an important cash crop in China, ranking first in the world in terms of both area and output. Fruit size is a key determinant of fruit quality and plays an important role in evaluating the economic value of most horticultural crops. During the process of plant domestication and improvement, large fruits have always been the main target of human selection. This preference is largely attributed to the fact that these traits usually lead to higher quality, increased productivity, higher consumer acceptance, and ultimately greater economic benefits. Fruit size is a complex trait, affected by the intricate interplay between genetic, environmental, and physiological factors, especially in pears. The fruit of pear mainly develops from the receptacle and the base of the floral tube, and is sometimes referred to as a false fruit. The development of fruit size is affected by events at multiple stages before and after flowering. Molecular marker-assisted breeding is a modern breeding method that uses molecular marker technology to accelerate the breeding process. It mainly identifies molecular markers closely linked to target traits, thereby screening individuals with excellent traits and ultimately improving the breeding efficiency and accuracy. Summary of the Invention
[0003] Aiming at the technical problems in the selection and breeding of pear fruit weight assisted by molecular markers, the present invention provides an InDel_FW_2 molecular marker related to single fruit weight of pear, which can be used to identify the high and low of pear fruit weight, has good application value, and can be used in pear molecular breeding.
[0004] To achieve the above object, the present invention adopts the following technical solutions:
[0005] In the first aspect, the present invention provides an InDel_FW_2 molecular marker related to single fruit weight of pear. The InDel_FW_2 molecular marker is located at positions 20119258 - 20119371 bp on chromosome 11 of the 'Red Fragrant Pear' genome, and its nucleotide sequence is as shown in SEQ ID NO.1. The forward primer sequence of the molecular marker is 5'-TCTACTTATAATTCAAGTATTGAACCC-3', and the reverse primer sequence is 5'-TTCGAGCTAACTCAGCTATTTTCTTTT-3'; The single plant with lower single fruit weight of pear shows the deletion of the InDel_FW_2 molecular marker sequence, and the single plant with higher single fruit weight of pear shows the insertion of the InDel_FW_2 marker molecular sequence.
[0006] In the second aspect, the present invention provides a kit containing the amplification primers of the above InDel_FW_2 molecular marker.
[0007] In a third aspect, the present invention provides the use of a kit containing the above-mentioned amplification primers for the InDel_FW_2 molecular marker in identifying the single fruit weight of pear varieties, whether it is high or low.
[0008] Furthermore, the specific identification method includes the following steps:
[0009] a. Extract the genomic DNA of the pear leaves to be detected;
[0010] b. Use the primers of the InDel_FW_6 marker to perform PCR amplification on the genomic DNA of the pear leaves to be detected;
[0011] c. The PCR product is detected by electrophoresis. If there is one band, it is a pear variety with a lower single fruit weight. If there are two bands and one of the band lengths is longer than the band of 'Red Eggplant', it is a pear variety with a higher single fruit weight.
[0012] Furthermore, the reaction system for the PCR amplification in step b includes 10 μL of Genster (Mix), 0.8 μL of 10 μM forward primer, 0.8 μL of 10 μM reverse primer, 1 μL of template DNA, DNA concentration 50 ng / μL, 7.4 μL of ddH2O, totaling 20 μL; the reaction program is: pre-denaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 50 - 65 °C for 30 s, extension at 72 °C for 30 s, for a total of 30 cycles, and final extension at 72 °C for 5 min.
[0013] In a fourth aspect, the present invention provides the use of a kit containing the above-mentioned amplification primers for the InDel_FW_2 molecular marker in the breeding of pear varieties with high or low single fruit weight.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0015] In the present invention, the large-fruited pear variety 'Manpung' is used as the male parent, and the small-fruited pear variety 'Red Eggplant' is used as the female parent for hybridization. Using the fruits of the hybrid F1 generation as materials, the single fruit weight of pears is measured, and then extreme phenotype pools are constructed for SLAF-BSA sequencing and association analysis to determine the candidate interval of the gene locus related to the single fruit weight trait. Further, molecular marker research related to the single fruit weight of pears is carried out, and the molecular marker InDel_FW_2 that can significantly distinguish the high and low single fruit weights of pears is screened out.
[0016] By using the molecular marker InDel_FW_2 of the present invention, the high and low single fruit weights of pears can be quickly identified through conventional molecular experiments, thereby achieving efficient breeding of fruit size. In addition, the detection method of the present invention has the characteristics of simple operation, strong specificity, and high accuracy, and is not interfered by external factors such as climate and environment, providing reliable technical support for the precise breeding of pear fruit size, and having important economic value and broad application prospects. Description of the Drawings
[0017] Figure 1 This is the phenotypic identification result of the genetic population of the test materials of the present invention.
[0018] Figure 2 It is the main-effect QTL mapping chart for the single fruit weight of pears.
[0019] Figure 3 It is the result chart of polyacrylamide gel electrophoresis verification of the InDel_FW_2 marker in the genetic populations of 'Wanxiu' and 'Hongqie'.
[0020] Figure 4 It is the RT-qRCR verification of the candidate gene in 'Wanxiu' and 'Hongqie'.
[0021] Figure 5 It is the RT-qRCR verification of the candidate gene in the offspring.
[0022] Figure 6 It is the result chart of polyacrylamide gel electrophoresis verification of the InDel_FW_2 marker in the variety resources. Specific implementation manners
[0023] The following examples are used to illustrate the present invention, but are not used to limit the protection scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise defined, all technical and scientific terms used in the present invention are in accordance with the conventional understanding of those skilled in the art. In the present invention, unless otherwise stated, all instruments, reagents and raw materials can be obtained through commercial channels or are common materials in the art. The methods in the following examples are conventional methods in the art unless otherwise specified.
[0024] Example 1 Obtaining of molecular markers closely linked to the single fruit weight trait of pears
[0025] 1. Test materials
[0026] Using the large-fruit pear variety 'Wanxiu' as the male parent and the small-fruit pear variety 'Hongqie' as the female parent for hybridization, a total of 87 F1 generation individual plants were obtained. In addition, 26 variety resource materials in the natural population were included. All the above research materials were selected from the pear variety resource nursery of the Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences.
[0027] 2. Test methods
[0028] 2.1 Single fruit weight measurement:
[0029] At the fruit maturity stage, healthy and uniformly sized pear fruits were randomly selected for phenotypic identification of the single fruit weight.
[0030] 2.2 DNA extraction
[0031] All leaves of experimental materials were collected and quickly frozen in liquid nitrogen and stored at -80°C for subsequent SLAF-BSA analysis. DNA was extracted from leaf tissue using the Modified CTAB Plant DNA Kit (Adlai Biotechnology Co., Ltd., Beijing, China) according to the manufacturer's instructions, and the concentration of DNA was measured using a micro-spectrophotometer. 1 μL of ddH2O was used for blank detection first, and then the DNA concentration was detected and recorded in sequence.
[0032] 2.3 SLAF-BSA sequencing association analysis and localization
[0033] a. Sequencing: The quality of the genomic DNA of the parents and the two mixed pools was tested. After the sample DNA was qualified, it was used to construct a sequencing library. The qualified library was run through Illumina HiSeq TM 2500 for sequencing;
[0034] b. Genotype analysis: The raw reads obtained by 2.2a sequencing were quality controlled and the reads were aligned to the reference genome of 'Dangshan Pear' using BWA software ( http: / / peargenome.njau.edu.cn ). Through bioinformatics analysis, the sequencing data were clustered into SLAF tags, and high-quality SNP markers were screened. Based on the positioning results of the sequencing reads on the reference genome, GATK was used for local realignment and variation detection, and samtools was used for variation detection. The intersection of the two methods was taken to ensure the accuracy of the SNP, and finally the SNP site set was obtained.
[0035] c. ED value analysis: SNP sites are strictly filtered to select high-quality and reliable SNP sites. Euclidean distance (ED) algorithm is used for association analysis, and the fifth power of ED value is used as the association value for analysis.
[0036]
[0037] d. Candidate region: The ED value was fitted using the local linear regression (LOESS) method, and the median of the fitted values of all sites plus 3 times the standard deviation (median+3SD) was used as the association threshold. Based on the set association threshold of 0.21, the candidate interval was determined. Sequences were extracted from the association interval and BLAT alignment was performed with the gene sequence of the genome scaffold version to determine the genes in the candidate interval.
[0038] 2.4 Development of molecular markers for candidate intervals of pear single fruit relocation
[0039] 2.4.1 Design and screening of InDel molecular marker primers
[0040] Based on the mapping results of SLAF-BSA sequencing analysis, there are a total of 517 genes in the candidate interval. Using the resequencing data of the natural population with 'Red Delicious Pear' as the reference genome (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_019419815.1 / ), genes with structural variations in the promoter region or coding region were viewed using IGV (Integrative Genomics Viewer), and primers were designed with the help of Premier 5 software. The primer design follows the following principles: the length of the amplification product is controlled between 80 and 2500 bp, the Tm value is set at 50 - 65 °C, and the primer length is 15 - 30 bp. After the design was completed, the primers were entrusted to Genewiz (Suzhou) Co., Ltd. for synthesis.
[0041] 2.4.2 PCR Amplification Reaction
[0042] Dilute the leaf DNA concentration to 50 ng / μL for PCR amplification experiments and operate according to a 20 μL system. The reaction system for PCR amplification includes 10 μL of Genstar (Mix), 0.8 μL of 10 μM forward primer, 0.8 μL of 10 μM reverse primer, 1 μL of template DNA, DNA concentration 50 ng / μL, 7.4 μL of ddH2O, totaling 20 μL; the reaction program is: pre-denaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 50 - 65 °C for 30 s, extension at 72 °C for 30 s, for a total of 30 cycles, and final extension at 72 °C for 5 min.
[0043] 2.4.3 Polyacrylamide Gel Electrophoresis
[0044] Mix 30.7 mL of water, 14 mL of 30% polyacrylamide (PA) gel, 5 mL of 10×TBE buffer, 33 μL of 10% TEMED, and 350 μL of APS thoroughly. Inject the mixture into the gap between two glass plates using a syringe. Insert the sample comb and let it stand for about half an hour until the gel completely solidifies. After the gel solidifies, place the glass plates in the electrophoresis tank and add the diluted 0.5×TBE electrophoresis buffer into the tank. Then, pull out the sample comb and load the samples. After loading the samples, set a constant voltage of 160 V for electrophoresis and set the electrophoresis time to 1.5 - 3.5 h according to the size of the target fragment. After electrophoresis, take out the gel from the electrophoresis tank and quickly rinse it with ddH2O for 5 s. Then place the gel into the pre-prepared 0.2% (g / L) silver nitrate solution and silver stain it on a shaker for 8 min. After silver staining, wash the gel twice with ddH2O, with each washing time being 2 min. Then, place the gel into the sodium hydroxide solution containing formaldehyde (dissolve 8 g of sodium hydroxide and 4 mL of formaldehyde in 0.5 L of deionized water), and place it on the shaker again until the bands on the gel are clearly visible. Finally, take out the gel, place it on the light box for observation, record the test results, and take pictures for preservation.
[0045] 2.4.4 Agarose Gel Electrophoresis
[0046] Prepare a 1% gel by adding 1 g of agarose to 100 mL of 0.5×TAE buffer, mixing well, and heating it in a microwave oven until the solution is clear and transparent. Then add 10 μL of StarGreen safe nucleic acid dye 10,000× (Beijing Kangrun Chengye Biotechnology Co., Ltd., Beijing, China). Then pour the gel solution into the electrophoresis tank mold with the inserted comb. After it completely cools and solidifies, load the samples. After running at a constant voltage of 160 v, place the gel in the gel imaging system, observe the results, and save them.
[0047] 2.4.5 Molecular Marker Statistical Method
[0048] According to the 5 separation methods of the CP model, divide the genotypes of the genetic population into 5 types: nn×np, lm×ll, hk×hk, ab×cd, ef×eg.
[0049] 2.5 Candidate Gene Screening and Verification
[0050] 2.5.1 RNA Extraction
[0051] Collect the pulp tissues of Solanum integrifolium Poir. and Wanxiu parents, quickly freeze them in liquid nitrogen, and store them at -80 °C for subsequent RNA-seq analysis. Use the RNA Extraction Kit (Beijing Zhuangmeng International Biotechnology Co., Ltd., Beijing, China) to extract total RNA from the pulp tissues according to the manufacturer's instructions.
[0052] 2.5.2 Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR)
[0053] The pulp samples were quickly frozen in liquid nitrogen and then ground into powder. Total RNA was extracted using an RNA extraction kit (ZOMANBIO, Beijing, China) according to the manufacturer's instructions. cDNA synthesis was performed using TransGen One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). RT-qPCR analysis was carried out using TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) on a Roche LightCycler 480 system (Roche, Basel, Switzerland). All RT-qPCR experiments were performed with the PcTubulin gene of pear as the internal reference gene and repeated three times. The relative expression level was calculated according to the 2 -ΔΔCt -ΔΔCt method (LIVAK et al., 2001).
[0054] 2.6 Validation of candidate genes in cultivar resources
[0055] The InDel molecular marker primers screened above were further used for genotype identification in pear germplasm resources with higher and lower single fruit weight traits in the natural population, and the accuracy of genotype and phenotype in the natural population was analyzed.
[0056] 2.6.1 PCR amplification reaction
[0057] The leaf DNA concentration was diluted to 50 ng / μL for PCR amplification experiments and operated according to a 20-μL system. The reaction system for PCR amplification included 10 μL of Genstar (Mix), 0.8 μL of 10 μM forward primer, 0.8 μL of 10 μM reverse primer, 1 μL of template DNA, DNA concentration 50 ng / μL, and 7.4 μL of ddH2O, totaling 20 μL; the reaction program was: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 50 - 65°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles, and final extension at 72°C for 5 min.
[0058] 2.6.2 Polyacrylamide gel electrophoresis.
[0059] Mix 30.7 mL of water, 14 mL of 30% polyacrylamide (PA) gel, 5 mL of 10×TBE buffer, 33 μL of 10% TEMED, and 350 μL of APS thoroughly. Inject the mixture into the gap between two glass plates using a syringe. Insert the sample comb and let it stand for about half an hour until the gel is completely solidified. After the gel solidifies, place the glass plates in the electrophoresis tank and add the diluted 0.5×TBE electrophoresis buffer into the tank. Then, pull out the sample comb and load the samples. After loading the samples, set a constant voltage of 160 V for electrophoresis and set the electrophoresis time to 1.5 - 3.5 h according to the size of the target fragment. After electrophoresis, take out the gel from the electrophoresis tank and quickly rinse it in ddH2O for 5 s. Then place the gel into the pre-prepared 0.2% (g / L) silver nitrate solution and stain it on a shaker for 8 min. After silver staining, wash the gel twice with ddH2O, with each washing time being 2 min. After that, place the gel into the sodium hydroxide solution containing formaldehyde (dissolve 8 g of sodium hydroxide and 4 mL of formaldehyde in 0.5 L of deionized water), and place it on the shaker again until the bands on the gel are clearly visible. Finally, take out the gel, place it on a light box for observation, record the experimental results, and take pictures for preservation.
[0060] 3. Experimental Results
[0061] 3.1 Analysis of the Genetic Law of Single Fruit Weight of Pear
[0062] To analyze the genetic law of single fruit weight of pear, the single fruit weights of 'Wanxiu' × 'Hongqie' and their F1 hybrid population were measured in this experiment (see Table 1). After identification and statistics, as Figure 1 shown, the average single fruit weights of the male and female parents of this population were 419.51 g and 89.29 g (see Figure 1 A). Using the frequency distribution diagram of the single fruit weights of F1 individuals in two consecutive years (2023 and 2024) for the Shapiro-Wilk test, the results showed that the single fruit weight of the fruit was skewed-normally distributed (see Figure 1 B), and it existed in a single-peak form, indicating that the single fruit weight of pear is a quantitative trait jointly controlled by multiple genes.
[0063] Table 1 Phenotypes of Single Fruit Weights of the F1 Generation of 'Wanxiu' × 'Hongqie'
[0064]
[0065]
[0066] 3.2 SLAF-BSA Sequencing Analysis of Single Fruit Weight of Pear
[0067] The lines with a single fruit weight less than 250 g in the F1 generation were defined as low single fruit weight lines, and the lines with a single fruit weight greater than 250 g were defined as high single fruit weight lines. To obtain QTL loci related to the single fruit weight trait of pears, 29 high single fruit weight individuals and 32 low single fruit weight individuals were selected from the F1 generation of the 'Wanxiu' × 'Hongqie' cross to form two extreme trait mixed pools, and association analysis was carried out using the SLAF-BSA sequencing technology. The results of the SLAF-BSA sequencing association analysis of the single fruit weight trait of pears are shown in Figure 2 . The abscissa in the Manhattan plot is the physical position arranged from small to large according to the chromosome numbers of pears, and the ordinate is the ED value. As Figure 2 shown, the colored dots represent the ED values of each SNP locus, the black line is the fitted ED value, and the red dotted line represents the dominant association threshold. The higher the ED value, the better the association effect of the point. According to the association threshold judgment, 6 association regions were located, with a total size of 10.44 Mb, all on chromosome 11, and the total number of genes annotated in the association regions was 517.
[0068] 3.3 Development of molecular markers for the candidate interval of pear single fruit weight mapping
[0069] Based on the results of the SLAF-BSA sequencing association analysis, there were 517 genes in the candidate interval. Based on the resequencing data of the variety resources of the 'Hongxiangsu Pear' reference genome, IGV was used to view the genes with structural variations in the promoter region or coding region, and 171 genes with structural variations were initially obtained.
[0070] According to the structural variation sites, corresponding InDel molecular marker primers were designed, and the specificity of the primers was verified in the F1 generation of the 'Wanxiu' × 'Hongqie' cross. Five extreme phenotype individuals were selected from each (line numbers: 10-98, 10-28, 10-131, 10-158, 10-120, 10-25, 10-160, 10-146, 10-3, and 10-147) for primer screening, and finally 21 molecular marker corresponding primers were screened out that could amplify specific bands.
[0071] Then, 87 fruiting individuals of the F1 progeny of the 'Wanxiu' × 'Hongqie' cross were used for further screening to obtain the coincidence rate of the genotypes and phenotypes of these genes in the individuals of this combination. Finally, 14 molecular marker primers (Table 2) had a relatively high coincidence rate of genotypes and phenotypes, with 2 reaching a maximum of 82.75%, 9 reaching 81.6%, 2 reaching 80.45%, and 1 reaching 79.31%.
[0072] These 14 molecular markers were all located in the promoter region of the corresponding genes. Among them, the primer amplification product results of the InDel_FW_2 molecular marker are shown in Figure 3As shown, it can be seen that the electrophoresis result of the 'Red Eggplant' with a lower single fruit weight has only one band, while the electrophoresis results of the individual plants with a lower single fruit weight in F1 (such as No. 1 and No. 3) also have only one band, indicating that: taking 'Red Fragrant Crisp' as the reference genome, the individual plants with a lower single fruit weight show the deletion of the InDel_FW_2 molecular marker sequence; while the electrophoresis result of the 'Wanxiu' with a higher single fruit weight has two bands, and the length of one of the bands is longer than that of the 'Red Eggplant' band, and the electrophoresis results of the individual plants with a higher single fruit weight in F1 (such as No. 52 and No. 53) also have two bands, and the length of one of the bands is longer than that of the 'Red Eggplant' band, indicating that: taking 'Red Fragrant Crisp' as the reference genome, the individual plants with a higher single fruit weight show the insertion of the InDel_FW_2 molecular marker sequence. Therefore, based on the phenotypic and genotypic analysis of the genetic population, the coincidence rate of InDel_FW_2 in the genetic population of 'Wanxiu' × 'Red Eggplant' is 81.6%.
[0073] Table 2 Basic Information of Molecular Markers
[0074]
[0075]
[0076] 3.4 Fluorescent Quantitative Analysis of Candidate Genes
[0077] The 14 genes preliminarily screened were subjected to functional annotation analysis and RT-qPCR verification. These genes may be involved in affecting the development of the single fruit weight of pears. The pulp at the initial, middle and late stages of development of 'Red Eggplant' at 30 d, 58 d and 80 d after full bloom and 'Wanxiu' at 30 d, 72 d and 128 d after full bloom was used as the material.
[0078] The expression of these 14 genes in two cultivar types with significant differences in the single fruit weight of the 'Wanxiu' and 'Red Eggplant' parents was determined by RT-qPCR fluorescence quantification ( Figure 4)。Specific primer information for RT-qPCR analysis is shown in Table 3. The results showed that the expression of different candidate genes varied in the two types of pear fruits. Among them, 5 candidate genes were significantly differentially expressed, namely Pear_GLEAN_10000523, Pear_GLEAN_10004691, Pear_GLEAN_10012534, Pear_GLEAN_10012497, and Pear_GLEAN_10012547. Specifically, there were significant differences in the expression levels of Pear_GLEAN_10000523 at three developmental stages of Hongqie and Wanxiu. The expression levels of Wanxiu in the middle and late developmental stages were significantly higher than those of Hongqie. While the overall expression trends of Pear_GLEAN_10004691, Pear_GLEAN_10012534, Pear_GLEAN_10012497, and Pear_GLEAN_10012547 were consistent. They all had the highest expression levels during the middle developmental stage of Wanxiu, that is, during fruit swelling, and were significantly higher than those of Hongqie.
[0079] Table 3 Fluorescent quantitative primers for candidate genes
[0080]
[0081]
[0082] The 5 obtained candidate genes were further verified in the large-fruit plant lines (line number: 10-60) and small-fruit plant lines (line number: 10-122) of the F1 progeny of 'Wanxiu' and 'Hongqie'. It was found that the differential expression of 3 candidate genes was consistent with the results verified by fluorescence quantitative analysis in the parents ( Figure 5 ), namely Pear_GLEAN_10000523, Pear_GLEAN_10012534, and Pear_GLEAN_10012547.
[0083] 3.5 Verification of candidate genes controlling single fruit weight phenotype
[0084] Verify the specificity of the primers in the natural population. According to the data of the research group's resource survey at the maturity stage, 15 larger fruits and 11 smaller fruits were selected (Table 4). Using the leaf DNA of these 26 materials as templates, the performance of 3 candidate genes in the natural population was identified.
[0085] Table 4 Single fruit weight phenotypes of 26 variety resources in the natural population
[0086]
[0087]
[0088] According to the phenotypic and genotypic analysis of natural populations, the coincidence rates between the genotypes corresponding to the three candidate genes (Pear_GLEAN_10000523, Pear_GLEAN_10012534, and Pear_GLEAN_10012547) verified by three pairs of molecular marker primers and the actual phenotypes were 76.92%, 26.92%, and 69.23%, respectively.
[0089] Among them, the primer amplification results of the InDel_FW_2 molecular marker in the natural population variety resources are as Figure 6 shown. It can be seen that a single band can be amplified from the varieties with lower single fruit weight (such as No. 1 and No. 3), indicating that the varieties with lower single fruit weight show the deletion of the InDel_FW_2 molecular marker sequence, while two bands can be amplified from the varieties with higher single fruit weight (such as No. 20 and No. 21), and the length of one of the bands is longer than that of the 'Red Eggplant' band, indicating that the varieties with lower single fruit weight show the insertion of the InDel_FW_2 molecular marker sequence.
[0090] The sequence of the InDel_FW_2 molecular marker is as follows: TCTACTTATAATTCAAGTATTGAACCCAAGCAA GCCATAAATCGATCCTATATATATATATATTAAGAATGGAAGGATCAATGAATTAAAAGA AAATAGCTGAGTTAGCTCGAA (SEQ ID NO.1).
[0091] The above-described embodiments are only the preferred embodiments of the present invention, and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art of this technology, of course, according to the technical content disclosed in this specification, other implementation manners can be easily made by means of substitution or change. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. An InDel_FW_2 molecular marker related to the single fruit weight of pears, characterized in that, The InDel_FW_2 molecular marker is located at positions 20119258 - 20119371 bp on chromosome 11 of the 'Red Fragrant Pear' genome. Its nucleotide sequence is as shown in SEQ ID NO.
1. The forward primer sequence of the molecular marker is 5'-TCTACTTATAATTCAAGTATTGAACCC-3', and the reverse primer sequence is 5'-TTCGAGCTAACTCAGCTATTTTCTTTT-3'. Low single-fruit weight pear plants show deletion of the InDel_FW_2 molecular marker sequence, while high single-fruit weight pear plants show insertion of the InDel_FW_2 molecular marker sequence.
2. A kit containing the amplification primers of the InDel_FW_2 molecular marker as claimed in claim 1.
3. Use of the kit containing the amplification primers of the InDel_FW_2 molecular marker as claimed in claim 1 in the identification of high and low single-fruit weight varieties of pears.
4. The application according to claim 3, wherein The specific identification method includes the following steps: a. Extract the genomic DNA of the pear leaves to be detected; b. Perform PCR amplification on the genomic DNA of the pear leaves to be detected using the primers of the InDel_FW_2 marker; c. The PCR products are detected by electrophoresis. If there is one band, it is a low single-fruit weight pear variety. If there are two bands and one of the band lengths is longer than the 'Red Eggplant' band, it is a high single-fruit weight pear variety.
5. The application according to claim 4, wherein The reaction system of the PCR amplification in step b includes 10 μL of Genstar (Mix), 0.8 μL of 10 μM forward primer, 0.8 μL of 10 μM reverse primer, 1 μL of template DNA, DNA concentration 50 ng / μL, 7.4 μL of ddH2O, totaling 20 μL. The reaction program is: pre-denaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 50 - 65 °C for 30 s, extension at 72 °C for 30 s, a total of 30 cycles, and final extension at 72 °C for 5 min.
6. Use of the kit containing the amplification primers of the InDel_FW_2 molecular marker as claimed in claim 1 in the breeding of high and low single-fruit weight pear varieties.