InDelFW6 molecular marker related to single fruit weight of pear and application of InDelFW6 molecular marker

Abstract

The invention belongs to the technical field of pear molecular breeding, and discloses a pear single fruit weight related InDelFW6 molecular marker which is located at the 17786917-17787036bp position of the 11th chromosome of a 'Red fragrant pear' genome, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, the sequence of a forward primer of the molecular marker is 5 '-CTGAAGGTTGTCGCATATAAACTAC-3', and the sequence of a reverse primer of the molecular marker is 5 '-CATTGCAACAATTAGACTAT-3'; a single plant with relatively low single fruit weight of the pear shows insertion of an InDelFW6 molecular marker sequence, and a single plant with relatively high single fruit weight of the pear shows deletion of the InDelFW6 molecular marker sequence. The molecular marker can be used for identifying the fruit weight of the pear, has good application value and can be used for pear molecular breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of pear molecular breeding, and relates to an InDel_FW_6 molecular marker related to single fruit weight of pear and an application thereof. Background Art

[0002] Pear (Pyrus L.) is an important cash crop in my country, ranking first in the world in both area and yield. Fruit size is a key determinant of fruit quality and plays an important role in assessing the economic value of most horticultural crops. Large fruit has been a primary target of selection during plant domestication and improvement. This preference is largely attributed to the fact that these traits generally lead to higher quality, increased productivity, improved consumer acceptance, and ultimately greater economic benefits. Fruit size is a complex trait, influenced by an intricate interplay of genetic, environmental, and physiological factors, particularly in pears. The pear fruit primarily develops from the receptacle and the base of the inflorescence, sometimes also referred to as a false fruit. Fruit size development is influenced by multiple events before and after flowering. Molecular marker-assisted breeding is a modern breeding method that utilizes molecular marker technology to accelerate the breeding process. It primarily identifies molecular markers closely linked to target traits, allowing selection of individuals with superior traits, ultimately improving breeding efficiency and precision. Summary of the Invention

[0003] The present invention addresses the technical problems in molecular marker-assisted pear fruit weight selection and provides an InDel_FW_6 molecular marker related to single pear fruit weight, which can be used to identify high and low pear fruit weight, has good application value, and can be used for pear molecular breeding.

[0004] To achieve the above object, the present invention adopts the following technical solutions:

[0005] In a first aspect, the present invention provides an InDel_FW_6 molecular marker related to pear single fruit weight. The InDel_FW_6 molecular marker is located at 17786917-17787036bp on chromosome 11 of the 'Hongxiangsuli' genome, and its nucleotide sequence is shown in SEQ ID NO.1. The forward primer sequence of the molecular marker is 5'-CTGAAGGTTGTCGCATATA AACTAC-3', and the reverse primer sequence is 5'-CACTCATGCAACAATTAGACTCATT-3'; pear plants with lower single fruit weight show an insertion of the InDel_FW_6 molecular marker sequence, and pear plants with higher single fruit weight show a deletion of the InDel_FW_6 marker molecular sequence.

[0006] In a second aspect, the present invention provides a kit containing the above-mentioned InDel_FW_6 molecular marker amplification primer.

[0007] In a third aspect, the present invention provides the use of a kit containing the above-mentioned InDel_FW_6 molecular marker amplification primer in identifying the high and low single fruit weight of pear varieties.

[0008] Furthermore, the specific identification method includes the following steps:

[0009] a. Extract genomic DNA from pear leaves to be tested;

[0010] b. PCR amplification of the genomic DNA of the pear leaves to be tested was performed using primers labeled with InDel_FW_6;

[0011] c. PCR products were detected by electrophoresis. If there was one band, it was a pear variety with lower single fruit weight. If there were two bands and one of them was shorter than the 'Hongqie' band, it was a pear variety with higher single fruit weight.

[0012] Furthermore, the PCR amplification reaction system in step b includes 10 μL of Genster (Mix), 0.8 μL of 10 μM forward primer, 0.8 μL of 10 μM reverse primer, 1 μL of template DNA, DNA concentration of 50 ng / μL, and 7.4 μL of ddH2O, totaling 20 μL; the reaction procedure is: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 50-65°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles, and final extension at 72°C for 5 min.

[0013] In a fourth aspect, the present invention provides a kit containing the above-mentioned InDel_FW_6 molecular marker amplification primer for use in the breeding of pear varieties with high and low single fruit weight.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention uses the large-fruited pear variety 'Wanxiu' as the male parent and the small-fruited pear variety 'Hongqie' as the female parent for hybridization. The hybrid F1 generation fruits are used as materials to measure the weight of single pear fruits. Then, extreme shape mixed pools are constructed and SLAF-BSA sequencing is performed for association analysis. The candidate intervals of gene loci related to the single fruit weight trait are determined. Further research on molecular markers related to single pear fruit weight is carried out, and the molecular marker InDel_FW_6 that can significantly distinguish high and low single pear fruit weight is screened out.

[0016] Using the molecular marker InDel_FW_6 of the present invention, routine molecular testing can rapidly identify high and low single-fruit weight in pears, thereby enabling efficient breeding for fruit size. Furthermore, the detection method of the present invention is characterized by ease of use, strong specificity, and high accuracy, and is unaffected by external factors such as climate and the environment. This provides reliable technical support for precise breeding of pear fruit size, possessing significant economic value and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the result of genetic population phenotype identification of the test materials of the present invention.

[0018] Figure 2 This is the location map of the major QTL for pear fruit weight.

[0019] Figure 3 This is the polyacrylamide gel electrophoresis verification result of InDel_FW_6 marker in the 'Wanxiu' and 'Hongqie' genetic populations.

[0020] Figure 4 RT-qPCR verification of candidate genes in 'Wanxiu' and 'Hongqie'.

[0021] Figure 5 RT-qPCR verification of candidate genes in progeny.

[0022] Figure 6 This is the polyacrylamide gel electrophoresis verification result of InDel_FW_6 marker in variety resources. DETAILED DESCRIPTION

[0023] The following examples are used to illustrate the present invention, but are not intended to limit the scope of protection of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise defined, all technical and scientific terms used in the present invention are consistent with the conventional understanding of those skilled in the art. In the present invention, unless otherwise specified, all instruments, reagents and raw materials can be obtained through commercial channels or are materials commonly used in the art. The methods in the following examples, unless otherwise specified, are conventional methods in the art.

[0024] Example 1 Obtaining a molecular marker tightly linked to the pear fruit weight trait

[0025] 1. Test materials

[0026] A total of 87 F1 generation plants were hybridized using the large-fruited pear cultivar 'Wanxiu' as the male parent and the small-fruited pear cultivar 'Hongqie' as the female parent. In addition, 26 cultivar resources from natural populations were included. All of these research materials were collected from the pear cultivar nursery at the Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences.

[0027] 2. Test methods

[0028] 2.1 Single fruit weight determination:

[0029] Healthy, uniform-sized pear fruits were randomly selected at the ripening stage for single fruit weight phenotyping.

[0030] 2.2 DNA extraction

[0031] All experimental leaves were collected, snap-frozen in liquid nitrogen, and stored at −80°C for subsequent SLAF-BSA analysis. DNA was extracted from leaf tissue using the Modified CTAB Plant DNA Kit (Adela Biotechnology Co., Ltd., Beijing, China) according to the manufacturer's instructions. DNA concentration was measured using a micro-spectrophotometer. A blank test was performed using 1 μL of ddH₂O, followed by subsequent tests and recording of DNA concentrations.

[0032] 2.3 SLAF-BSA sequencing association analysis and positioning

[0033] a. Sequencing: The quality of the genomic DNA of the parents and the two mixed pools was tested. After the sample DNA was qualified, it was used to construct a sequencing library. The qualified library was passed through Illumina HiSeq TM 2500 for sequencing;

[0034] b. Genotype analysis: The raw reads obtained by sequencing in 2.2a were quality controlled and aligned to the Dangshan Pear reference genome using BWA software ( http: / / peargenome.njau.edu.cn Through bioinformatics analysis, sequencing data were clustered into SLAF tags, and high-quality SNP markers were screened. Based on the mapping of sequencing reads on the reference genome, local realignment and variant detection were performed using GATK, while variant detection was performed using samtools. The intersection of the two methods was used to determine variant sites to ensure SNP accuracy, ultimately resulting in a SNP locus set.

[0035] c. ED Value Analysis: SNPs were rigorously filtered to identify high-quality and reliable SNPs. Association analysis was performed using the Euclidean Distance (ED) algorithm, with the fifth power of the ED value used as the association value.

[0036]

[0037] d. Candidate regions: ED values ​​were fitted using the local linear regression (LOESS) method, with the median plus three standard deviations (median + 3SD) of the fitted values ​​across all sites used as the association threshold. Candidate intervals were identified based on a set association threshold of 0.21. Sequences were extracted from the association intervals and compared with gene sequences from the scaffold version of the genome using BLAT to identify genes within the candidate intervals.

[0038] 2.4 Development of molecular markers for candidate intervals of pear single fruit relocation

[0039] 2.4.1 InDel Molecular Marker Primer Design and Screening

[0040] Based on the mapping results of SLAF-BSA sequencing analysis, a total of 517 genes were located within the candidate interval. Using natural population resequencing data from the 'Hongxiangsu Pear' reference genome (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_019419815.1 / ), IGV (Integrative Genomics Viewer) was used to identify genes with structural variations in promoter or coding regions. Primers were then designed using Premier 5 software. Primer design adhered to the following principles: amplification product length was controlled between 80 and 2500 bp, Tm values ​​were set between 50 and 65°C, and primer lengths were 15 to 30 bp. After design, primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0041] 2.4.2 PCR amplification reaction

[0042] Leaf DNA was diluted to 50 ng / μL for PCR amplification using a 20 μL system. The PCR amplification reaction system consisted of 10 μL Genstar (Mix), 0.8 μL 10 μM forward primer, 0.8 μL 10 μM reverse primer, 1 μL template DNA (DNA concentration: 50 ng / μL), and 7.4 μL ddH₂O, for a total of 20 μL. The reaction procedure was as follows: initial denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 50-65°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles, with a final extension at 72°C for 5 min.

[0043] 2.4.3 Polyacrylamide gel electrophoresis

[0044] Thoroughly mix 30.7 mL of water, 14 mL of 30% polyacrylamide (PA) gel, 5 mL of 10× TBE buffer, 33 μL of 10% TEMED, and 350 μL of APS. Use a syringe to inject the solution into the gap between two glass plates. Insert a spotting comb and let the gel stand for approximately half an hour to completely solidify. After the gel solidifies, place the glass plates in an electrophoresis tank and add diluted 0.5× TBE running buffer. Then, remove the spotting comb and begin spotting. After spotting, run electrophoresis at a constant voltage of 160 V for 1.5 to 3.5 hours, depending on the size of the target fragment. After electrophoresis, remove the gel from the tank and quickly rinse it in ddH2O for 5 seconds. Then, place the gel in a pre-prepared 0.2% (g / L) silver nitrate solution and silver-stain on a shaker for 8 minutes. After silver staining, wash the gel twice with ddH2O, each time for 2 minutes. Next, place the gel in a sodium hydroxide solution containing formaldehyde (dissolve 8g of sodium hydroxide and 4mL of formaldehyde in 0.5L of deionized water) and shake again until the bands on the gel are clearly visible. Finally, remove the gel and place it under a light box for observation. Record the test results and take photos for preservation.

[0045] 2.4.4 Agarose gel electrophoresis

[0046] To prepare a 1% gel, 1 g of agarose was added to 100 mL of 0.5× TAE buffer, mixed thoroughly, and heated in a microwave oven until the solution was clear and transparent. Then, 10 μL of StarGreen safe nucleic acid dye 10,000× (Beijing Kangrun Chengye Biotechnology Co., Ltd., Beijing, China) was added. The gel solution was then poured into an electrophoresis tank mold with a comb inserted and allowed to cool completely before sample loading. After the constant voltage run at 160 V was completed, the gel was placed in a gel imaging system for observation and preservation.

[0047] 2.4.5 Molecular marker statistical methods

[0048] According to the five separation modes of the CP model, the genotypes of the genetic population are divided into five types: nn×np, lm×ll, hk×hk, ab×cd, and ef×eg.

[0049] 2.5 Candidate gene screening and verification

[0050] 2.5.1 RNA extraction

[0051] The pulp tissue of the Hongqie and Wanxiu parents was collected, snap-frozen in liquid nitrogen, and stored at −80°C for subsequent RNA-seq analysis. Total RNA was extracted from the pulp tissue using an RNA Extraction Kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd., Beijing, China) according to the manufacturer's instructions.

[0052] 2.5.2 Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR)

[0053] The pulp samples were quick-frozen in liquid nitrogen and then ground into powder. Total RNA was extracted using an RNA extraction kit (ZOMANBIO, Beijing, China) according to the manufacturer's instructions. cDNA synthesis was performed using TransGen One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). RT-qPCR analysis was performed using TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) on a Roche LightCycler 480 system (Roche, Basel, Switzerland). All RT-qPCR experiments were performed in triplicate using the pear PcTubulin gene as an internal reference gene. Relative expression levels were calculated based on 2 -ΔΔCt Calculation method (LIVAK et al., 2001). 2.6 Verification of candidate genes in variety resources

[0054] The above-screened InDel molecular marker primers were used to further conduct genotyping in pear germplasm resources with higher and lower levels of single fruit weight traits in natural populations, and the accuracy of genotypes and phenotypes in natural populations was analyzed.

[0055] 2.6.1 PCR amplification reaction

[0056] Leaf DNA was diluted to 50 ng / μL for PCR amplification using a 20 μL system. The PCR amplification reaction system consisted of 10 μL Genstar (Mix), 0.8 μL 10 μM forward primer, 0.8 μL 10 μM reverse primer, 1 μL template DNA (DNA concentration: 50 ng / μL), and 7.4 μL ddH₂O, for a total of 20 μL. The reaction procedure was as follows: initial denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 50-65°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles, with a final extension at 72°C for 5 min.

[0057] 2.6.2 Polyacrylamide gel electrophoresis.

[0058] Thoroughly mix 30.7 mL of water, 14 mL of 30% polyacrylamide (PA) gel, 5 mL of 10× TBE buffer, 33 μL of 10% TEMED, and 350 μL of APS. Use a syringe to inject the solution into the gap between two glass plates. Insert a spotting comb and let the gel stand for approximately half an hour to completely solidify. After the gel solidifies, place the glass plates in an electrophoresis tank and add diluted 0.5× TBE running buffer. Then, remove the spotting comb and begin spotting. After spotting, run electrophoresis at a constant voltage of 160 V for 1.5 to 3.5 hours, depending on the size of the target fragment. After electrophoresis, remove the gel from the tank and quickly rinse it in ddH2O for 5 seconds. Then, place the gel in a pre-prepared 0.2% (g / L) silver nitrate solution and silver-stain on a shaker for 8 minutes. After silver staining, wash the gel twice with ddH2O, each time for 2 minutes. Next, place the gel in a sodium hydroxide solution containing formaldehyde (dissolve 8g of sodium hydroxide and 4mL of formaldehyde in 0.5L of deionized water) and shake again until the bands on the gel are clearly visible. Finally, remove the gel and place it under a light box for observation. Record the test results and take photos for preservation.

[0059] 3. Test results

[0060] 3.1 Analysis of the genetic patterns of pear fruit weight

[0061] In order to analyze the genetic pattern of pear fruit weight, this experiment measured the fruit weight of the hybrid population of 'Wanxiu'×'Hongqie' and its F1 generation (see Table 1). Figure 1 As shown, the average single fruit weight of the male and female parents of this population is 419.51g and 89.29g (see Figure 1 A), the Shapiro-Wilk test was performed on the distribution of the number of fruit replants per plant in the F1 generation for two consecutive years (2023 and 2024). The results showed that the fruit weight was skewed normally distributed (see Figure 1 B) and exists in a unimodal form, which indicates that pear fruit weight is a quantitative trait controlled by multiple genes.

[0062] Table 1 Phenotype of single fruit weight in the F1 hybrid of 'Wanxiu' × 'Hongqie'

[0063]

[0064]

[0065] 3.2 SLAF-BSA Sequencing Analysis of Pear Fruit Weight

[0066] In the F1 generation, lines with a fruit weight of less than 250g were defined as lines with low single fruit weight, and lines with a fruit weight of more than 250g were defined as lines with high single fruit weight. In order to obtain QTL loci related to the pear single fruit weight trait, 29 single fruit weight-type plants and 32 single fruit weight-type plants were selected from the F1 generation of the hybrid of 'Wanxiu' × 'Hongqie' to form two extreme trait pools, respectively. Association analysis was performed using SLAF-BSA sequencing technology. The results of SLAF-BSA sequencing association analysis of pear single fruit weight traits are shown in Figure 2 The horizontal axis in the Manhattan diagram is the physical position of the chromosome numbers of the pear arranged from small to large, and the vertical axis is the ED value. Figure 2 As shown, the colored dots represent the ED value for each SNP locus, the black line is the fitted ED value, and the red dashed line represents the dominant association threshold; higher ED values ​​indicate stronger associations. Based on the association threshold, six association regions were located, totaling 10.44 Mb, all located on chromosome 11. A total of 517 genes were annotated within these association regions.

[0067] 3.3 Development of molecular markers for candidate intervals of pear single fruit relocation

[0068] Based on SLAF-BSA sequencing association analysis, a total of 517 genes were identified within the candidate interval. Using IGV to identify genes with structural variations in promoter or coding regions, 171 genes with structural variations were initially identified based on resequencing data from the 'Hongxiangsu Pear' reference genome.

[0069] Based on the structural variation sites, corresponding InDel molecular marker primers were designed and their specificity was verified in the F1 hybrid of 'Wanxiu' and 'Hongqie'. Five individual plants with extreme phenotypes (line numbers: 10-98, 10-28, 10-131, 10-158, 10-120, 10-25, 10-160, 10-146, 10-3, and 10-147) were selected for primer screening, resulting in 21 pairs of molecular marker primers that amplified specific bands.

[0070] Further screening was performed using 87 individual F1 progeny from the 'Wanxiu' x 'Hongqie' hybrid to determine the genotype-phenotype concordance rates for these genes within the individual plants of this hybrid. Finally, 14 pairs of molecular marker primers (Table 2) achieved high concordance rates, with two reaching 82.75%, nine reaching 81.6%, two reaching 80.45%, and one reaching 79.31%.

[0071] These 14 molecular markers are all located in the promoter region of the corresponding genes. Figure 3As shown in the figure, the electrophoresis results for the low-fruit-weight 'Hongqie' strain showed only a single band, while the electrophoresis results for low-fruit-weight F1 strains (e.g., numbers 1 and 3) also showed a single band. This indicates that, using the 'Hongxiangsu' reference genome, the low-fruit-weight strains showed an insertion of the InDel_FW_6 marker sequence. The high-fruit-weight 'Wanxiu' strain showed two bands, one of which was shorter than the 'Hongqie' band. The high-fruit-weight F1 strains (e.g., numbers 52 and 53) also showed two bands, one of which was shorter than the 'Hongqie' band, indicating that the high-fruit-weight strains showed a deletion of the InDel_FW_6 marker sequence. Therefore, based on phenotypic and genotypic analysis of the genetic population, the coincidence rate for InDel_FW_6 in the 'Wanxiu' × 'Hongqie' genetic population was 81.6%.

[0072] Table 2 Molecular marker and primer information

[0073]

[0074]

[0075] 3.4 Fluorescence quantitative analysis of candidate genes

[0076] Functional annotation analysis and RT-qPCR validation were performed on 14 genes initially screened, suggesting that these genes may be involved in influencing pear fruit weight development. The flesh of 'Hongqie' cultivar, 30, 58, and 80 days after full anthesis, and 'Wanxiu' cultivar, 30, 72, and 128 days after full anthesis, was used as the material for early, mid, and late development.

[0077] The expression of these 14 genes in two varieties with significant differences in single fruit weight between the parents of 'Wanxiu' and 'Hongqie' was determined by RT-qPCR fluorescence quantitative analysis ( Figure 4Specific primer information for RT-qPCR analysis is detailed in Table 3. The results showed that the expression of different candidate genes was differential between the two types of pear fruit, with five candidate genes showing significant differential expression: Pear_GLEAN_10000523, Pear_GLEAN_10004691, Pear_GLEAN_10012534, Pear_GLEAN_10012497, and Pear_GLEAN_10012547. Specifically, the expression levels of Pear_GLEAN_10000523 in the three developmental stages of red eggplant and late show were significantly different. The expression level of late show in the middle and late development stages was significantly higher than that of red eggplant. The overall expression trends of Pear_GLEAN_10004691, Pear_GLEAN_10012534, Pear_GLEAN_10012497 and Pear_GLEAN_10012547 were consistent. The expression levels were the highest in the middle development stage of late show, that is, during the fruit expansion period, and were significantly higher than those of red eggplant.

[0078] Table 3 Primers for target fragments of candidate genes using fluorescence quantitative amplification

[0079]

[0080]

[0081] The five candidate genes were further verified in the large-fruited lines (line number: 10-60) and small-fruited lines (line number: 10-122) of the F1 progeny of 'Wanxiu' and 'Hongqie'. It was found that the differential expression of three candidate genes was consistent with the results of fluorescence quantitative analysis in the parents ( Figure 5 ), namely Pear_GLEAN_10000523, Pear_GLEAN_10012534 and Pear_GLEAN_10012547.

[0082] 3.5 Verification of candidate genes controlling single fruit weight phenotype

[0083] The specificity of the primers was verified in natural populations. Based on the research team's survey data on mature resources, 15 large fruits and 11 small fruits were selected (Table 4). The leaf DNA of these 26 materials was used as a template to identify the expression of the three candidate genes in natural populations.

[0084] Table 4 Single fruit weight phenotypes of 26 cultivars in natural populations

[0085]

[0086]

[0087] According to the phenotypic and genotypic analysis of the natural population, the consistency rates between the genotypes verified by three pairs of molecular marker primers corresponding to the three candidate genes (Pear_GLEAN_10000523, Pear_GLEAN_10012534 and Pear_GLEAN_10012547) and the actual phenotypes were 76.92%, 26.92% and 69.23%, respectively.

[0088] The results of primer amplification of InDel_FW_6 molecular marker in natural population variety resources are as follows: Figure 6 As shown in the figure, one band was amplified from varieties with lower fruit weight (such as numbers 3 and 4), indicating that the low-fruit-weight varieties showed an insertion of the InDel_FW_6 marker sequence, while two bands were amplified from varieties with higher fruit weight (such as numbers 13 and 14), and one of the bands was shorter than that of 'Hongqie', indicating that the high-fruit-weight varieties showed a deletion of the InDel_FW_6 marker sequence.

[0089] The sequence of the InDel_FW_6 molecular marker is as follows: CTGAAGGTTGTCGCATATAAACTACTTTAGCTA AAGAACCATGTAAGAAAGCATTTTGAACATCAAGTTGTCTGATAGTGAAGGGCAATGGAGAGAATGAGTCTAATTGTTGCATGAGTG (SEQ ID NO. 1).

[0090] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker InDel_FW_6 related to single fruit weight of pear, characterized in that: The InDel_FW_6 molecular marker is located at 17786917-17787036bp on chromosome 11 of the 'Hongxiangsuli' genome, and its nucleotide sequence is shown in SEQ ID NO.

1. The forward primer sequence of the molecular marker is 5'-CTGAAGGTTGTCGCATATAAACTAC-3', and the reverse primer sequence is 5'-CACTCATGCAACAATTAGACTCATT-3'; pear plants with lower single fruit weight show insertion of the InDel_FW_6 molecular marker sequence, and pear plants with higher single fruit weight show deletion of the InDel_FW_6 marker molecular sequence.

2. A kit comprising the InDel_FW_6 molecular marker amplification primer according to claim 1.

3. Use of a kit containing the InDel_FW_6 molecular marker amplification primer according to claim 1 in identifying high and low single fruit weight pear varieties.

4. The use according to claim 3, characterized in that The specific identification method includes the following steps: a. Extract genomic DNA from pear leaves to be tested; b. PCR amplification of the genomic DNA of the pear leaves to be tested was performed using primers labeled with InDel_FW_6; c. PCR products were detected by electrophoresis. If there was one band, it was a pear variety with lower single fruit weight. If there were two bands and one of them was shorter than the 'Hongqie' band, it was a pear variety with higher single fruit weight.

5. The use according to claim 4, characterized in that The PCR amplification reaction system in step b includes 10 μL of Genstar (Mix), 0.8 μL of 10 μM forward primer, 0.8 μL of 10 μM reverse primer, 1 μL of template DNA, DNA concentration of 50 ng / μL, and 7.4 μL of ddH2O, totaling 20 μL; the reaction procedure is: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 50-65°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles, and final extension at 72°C for 5 min.

6. Use of a kit containing the InDel_FW_6 molecular marker amplification primer according to claim 1 in breeding pear varieties with high and low single fruit weight.

Images