KASP marker combination for identifying cymbidium sinense floribunda odd flower variety as well as application, primer and kit of KASP marker combination for identifying cymbidium sinense floribunda odd flower variety
By developing KASP marker combination and real-time fluorescence quantitative PCR technology, the early screening problem of the merlando flower-filled strange flower varieties was solved, efficient and accurate genotyping was achieved, and breeding efficiency and cost-effectiveness were improved.
Patent Information
- Application Number
- CN202510615736.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2045-05-14
AI Technical Summary
The prior art is difficult to efficiently screen the rare flower varieties of the moranda flower, resulting in a long breeding cycle, high cost and difficult to screen early. The molecular marker system is still blank in the study of the moranda petal type.
A combination of KASP markers, including KASP1, KASP2 and KASP3, was developed. Through real-time fluorescence quantitative PCR technology, primers were designed using specific SNP sites of the CsLCR gene to achieve accurate genotyping of the merlando flower-filled strange flower varieties.
It has achieved early accurate screening of the multi-flowered strange flower varieties, improved breeding efficiency, reduced costs, and provided an effective auxiliary means for molecular breeding.
Smart Images

Figure CN120366505A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular breeding, in particular to a KASP marker combination for identifying a Molan multi-tepal odd-flowering variety and its application, primers and a kit. Background Art
[0002] As a representative species of Cymbidium sinense, Cymbidium sinense, known as the "Announcement of the New Year Orchid," is highly favored by consumers in China and East Asia due to its unique flowering period, which coincides closely with the Lunar New Year. Morphological appreciation is a core element of the Cymbidium sinense evaluation system. The morphological differentiation of floral organs is not only a key indicator for variety identification but also directly influences its market value. A typical Cymbidium sinense flower consists of six tepals, including three sepals, two petals, and a specialized lip. Based on the morphological variation of each whorl of tepals, flower forms can be subdivided into major categories: lotus petals, plum petals, butterfly petals, narcissus petals, and bamboo leaf petals. Notably, some accessions exhibit a phenotype characterized by multiple whorls of tepals (greater than six tepals), known as "strange flowers." These unique flower accessions have a higher commercial value due to their unique appearance.
[0003] The multi-petal trait of Cymbidium orchid is a typical quantitative trait regulated by multiple genes. Due to the lack of phenotypic markers during the vegetative growth period and the 3-5 years of reproductive maturity required for the plant to flower, traditional breeding faces bottlenecks such as lengthy cycles, high costs, and difficulties in early screening. Existing molecular marker systems (such as SSR markers) are mostly used for germplasm identification and genetic pedigree analysis. However, in the field of functional marker development, especially molecular markers related to Cymbidium orchid petal type, research is still blank, which seriously restricts the application efficiency of molecular breeding technology. Summary of the Invention
[0004] In order to solve the above problems, the present invention provides a KASP marker combination and application, primers and kit for identifying Mo Lan multi-tepal rare flower varieties. The KASP marker provided by the present invention can be used to identify Mo Lan multi-tepal rare flower varieties.
[0005] In order to achieve the above object, the present invention provides the following technical solutions:
[0006] The present invention provides a KASP marker for identifying a variety of Orchidaceae with multiple tepals and unusual flowers, comprising one or more of KASP1, KASP2 and KASP3;
[0007] The KASP1 is located at the 229th base of the coding region of the CsLCR gene annotated on chromosome 5 of Molan, and has a C / G mutation. The genotype C:C is a Molan variety with multiple tepals and odd flowers.
[0008] The KASP2 is located at the 687th base of the coding region of the CsLCR gene annotated on chromosome 5 of Mo Lan, and has a T / G mutation. The genotype G:G is a Mo Lan variety with multiple tepals and odd flowers.
[0009] The KASP3 is located on the 1429th and 1430th bases of the coding region of the CsLCR gene annotated on chromosome 5 of the molan. There is a T / G mutation at the 1429th base and a T / C mutation at the 1430th base. The genotype of molan is GC:GC, which is a variety with many perianth segments and strange flowers.
[0010] The nucleotide sequence of the CsLCR gene is shown in SEQ ID No. 10.
[0011] The present invention also provides the use of the KASP marker described in the above technical solution in identifying varieties of Cymbidium orchids with multiple tepals and unusual flowers.
[0012] The present invention also provides a KASP primer for identifying a variety of Orchidaceae with multiple tepals and unusual flowers, comprising one or more of a KASP1 primer, a KASP2 primer, and a KASP3 primer;
[0013] The nucleotide sequences of the upstream primers F1 and F2 of the KASP1 primers are shown in SEQ ID No. 1-2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3;
[0014] The nucleotide sequences of the upstream primers F1 and F2 of the KASP2 primers are shown in SEQ ID No. 4-5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 6;
[0015] The nucleotide sequences of the upstream primers F1 and F2 of the KASP3 primers are shown in SEQ ID No. 7-8, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 9.
[0016] The present invention also provides the use of the KASP primers described in the above technical solution in identifying varieties of Cymbidium orchids with multiple tepals and unusual flowers.
[0017] Preferably, the application comprises the following steps:
[0018] 1) extracting genomic DNA from Cymbidium sinense, and using the genomic DNA as a template to perform real-time fluorescence quantitative PCR amplification using the KASP primers described in the above technical solution to obtain an amplified product;
[0019] 2) reading the fluorescence data of the amplified product obtained in step 1), converting the data into typing results, and identifying the Molan multi-tepal odd-flowering variety according to the typing results.
[0020] Preferably, the real-time fluorescence quantitative PCR amplification system is: 1.25 μL of genomic DNA (concentration 30 ng / μL), 2×KASP Mastermix 2.5 μL and PrimerMix 1.25 μL;
[0021] The volume ratio of the upstream primer F1, the upstream primer F2 and the downstream primer in the KASP primers described in the above technical solution in the Primer Mix is 1:1:3, and the concentration is 10 μM.
[0022] Preferably, the program of the real-time fluorescence quantitative PCR amplification is: 95°C for 10 min; 95°C for 20 s, 58°C for 60 s, 10 cycles; 95°C for 20 s, 55°C for 60 s, 27 cycles; 25°C for 30 s.
[0023] The present invention also provides a kit for identifying the multi-tepal strange-flowering variety of Cymbidium sinense, comprising the KASP primers and 2×KASP Mastermix described in the above technical solution.
[0024] Beneficial effects of the present invention:
[0025] This study observed the number of tepals in flowers from different germplasm resources within natural populations of Orchidaceae and conducted genome-wide association analysis. This made the tepal number SNPs derived from the association analysis more reliable and the discovery of candidate genes for tepal number and the development of genetic markers more precise. The three KASP markers designed and developed by this study can be used to select and breed Orchidaceae germplasm with multiple tepals and their hybrid offspring. They can accurately genotype Orchidaceae varieties with more than six tepals compared to normal varieties. This molecular marker combination is promising for large-scale early screening of germplasm, providing effective support for molecular breeding of Orchidaceae flower types. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0027] Figure 1 Comparison photos of normal flowers of Cymbidium indica (A) and varieties with odd flowers with multiple tepals (B and C);
[0028] Figure 2 Manhattan results (A) and QQ results (B) of GWAS analysis of the number of tepals of Cymbidium orchid;
[0029] Figure 3 The genotyping results of 75 Cymbidium orchid varieties using three KASP markers. DETAILED DESCRIPTION
[0030] The present invention provides a KASP marker for identifying a variety of Orchidaceae with multiple tepals and unusual flowers, comprising one or more of KASP1, KASP2 and KASP3;
[0031] The KASP1 is located at the 229th base of the coding region of the CsLCR gene annotated on chromosome 5 of Molan, and has a C / G mutation. The genotype C:C is a Molan variety with multiple tepals and odd flowers.
[0032] The KASP2 is located at the 687th base of the coding region of the CsLCR gene annotated on chromosome 5 of Mo Lan, and has a T / G mutation. The genotype G:G is a Mo Lan variety with multiple tepals and odd flowers.
[0033] The KASP3 is located on the 1429th and 1430th bases of the coding region of the CsLCR gene annotated on chromosome 5 of the molan. There is a T / G mutation at the 1429th base and a T / C mutation at the 1430th base. The genotype of molan is GC:GC, which is a variety with many perianth segments and strange flowers.
[0034] The nucleotide sequence of the CsLCR gene is shown in SEQ ID No. 10.
[0035] SEQ ID No.10:
[0036]
[0037] The present invention also provides the use of the KASP marker described in the above technical solution in identifying varieties of Cymbidium orchids with multiple tepals and unusual flowers.
[0038] The present invention also provides a KASP primer for identifying a variety of Molan with multiple tepals and unusual flowers, comprising one or more of a KASP1 primer, a KASP2 primer, and a KASP3 primer; the nucleotide sequences of upstream primers F1 and F2 of the KASP1 primer are shown as SEQ ID Nos. 1 and 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3; the nucleotide sequences of upstream primers F1 and F2 of the KASP2 primer are shown as SEQ ID Nos. 4 and 5, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 6; the nucleotide sequences of upstream primers F1 and F2 of the KASP3 primer are shown as SEQ ID Nos. 7 and 8, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 9.
[0039] SEQ ID No. 1:
[0040] GAAGGTCGGAGTCAACGGATTGACGAGACCCTGGCGACC;
[0041] SEQ ID No. 2:
[0042] GAAGGTGACCAAGTTCATGCTGACGAGACCCTGGCGACG;
[0043] SEQ ID No.3:
[0044] TTGTATATGCGCCGTGCCG;
[0045] SEQ ID No.4:
[0046] GAAGGTGACCAAGTTCATGCTCGTTTCATTCTGCCGGAATTT;
[0047] SEQ ID No.5:
[0048] GAAGGTCGGAGTCAACGGATTCGTTTCATTCTGCCGGAATTG;
[0049] SEQ ID No.6:
[0050] GGCGACAGATTGGGACAGAGTTA;
[0051] SEQ ID No.7:
[0052] GAAGGTCGGAGTCAACGGATTGCTCCTTCGCTACCACCTTTT;
[0053] SEQ ID No.8:
[0054] GAAGGTGACCAAGTTCATGCTCTCCTTCGCTACCACCTTGC;
[0055] SEQ ID No.9:
[0056] GAGGGTAAGCGACATCTTCTGC.
[0057] The present invention also provides the use of the KASP primers described in the above technical solution in identifying varieties of Cymbidium orchids with multiple tepals and unusual flowers.
[0058] In the present invention, the application preferably comprises the following steps:
[0059] 1) extracting genomic DNA from Cymbidium sinense, and using the genomic DNA as a template to perform real-time fluorescence quantitative PCR amplification using the KASP primers described in the above technical solution to obtain an amplified product;
[0060] 2) reading the fluorescence data of the amplified product obtained in step 1), converting the data into typing results, and identifying the Molan multi-tepal odd-flowering variety according to the typing results.
[0061] In the present invention, the preferred system for real-time fluorescence quantitative PCR amplification is: 1.25 μL of genomic DNA (concentration 30 ng / μL), 2.5 μL of 2×KASP Master mix, and 1.25 μL of Primer Mix. In the present invention, the volume ratio of upstream primer F1, upstream primer F2, and downstream primer in the KASP primers described in the above technical solution in the PrimerMix is 1:1:3, and the concentration is 10 μM. In the present invention, the preferred program for real-time fluorescence quantitative PCR amplification is: 95°C for 10 min; 95°C for 20 s, 58°C for 60 s, 10 cycles; 95°C for 20 s, 55°C for 60 s, 27 cycles; 25°C for 30 s.
[0062] The present invention also provides a kit for identifying orchid varieties with multiple tepals and unusual flowers, comprising the KASP primers and 2×KASP Mastermix described in the above technical solution 3.
[0063] In order to further illustrate the present invention, the present invention is described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0064] Example 1
[0065] (1) 195 Cymbidium ensifolium germplasm samples were used as the research objects. They were cultivated in a potted greenhouse using conventional water and fertilizer management. Phenotypic monitoring was carried out during two consecutive reproductive cycles, and the number of perianth segments of floral organs was systematically recorded during the peak flowering period. The sampling strategy was set to select 2-3 biological replicates for each germplasm, and 3 blooming flowers were collected from each plant for morphological measurement. The average value was finally taken as the observed value of the perianth segment number of each Cymbidium ensifolium germplasm.
[0066] (2) Young leaf samples of the test material were collected, and whole-genome DNA was extracted using a nucleic acid extraction kit (TIANGEN). Double quality assessment was performed by 1.2% agarose gel electrophoresis combined with NanoDrop spectrophotometry. Samples that met the quality inspection standards were then subjected to simplified genome sequencing. A total average genome coverage depth of 10.01× was obtained, with a cumulative read information of 1241.67Mb, and the sequencing quality Q30 value reached 93.13%. The original sequence was aligned to the reference genome of Cymbidium sinense, and GATK and samtools were used for parallel analysis. The SNP sites identified by the two algorithms were used to construct a high-confidence variation dataset, and 65,318,522 population-level SNP markers were finally obtained.
[0067] (3) Combining the observed values of the number of tepals and the developed SNP markers of Cymbidium sinense, genome-wide association analysis (GWAS) was performed using EMMAX to obtain the results of the EMMAX mixed linear model. Figure 2 The Manhattan and QQ results of the EMMAX model are shown. A total of 2146 SNPs significantly associated with tepal number were identified, of which 1278 were located in the UTR region of the gene and 50 were located in the exon or intron region, indicating that these regions may be involved in regulating the genetic variation of tepal number.
[0068] Example 2
[0069] A KASP marker for identifying associations with the trait of multiple tepals and odd flowers in Cymbidium orchid. The KASP marker was developed based on the significantly associated SNP sites obtained in Example 1. Four SNP sites located in the coding region of the CsLCR gene on chromosome 5 of Cymbidium orchid were selected for KASP marker development. The coding sequence of the CsLCR gene is as follows (SEQ ID No. 10):
[0070]
[0071] SNP1 (C / G) is located at the 229th base in the coding region of the CsLCR gene, SNP2 (T / G) is located at the 687th base in the coding region of the CsLCR gene, and SNP3 (T / G) and SNP4 (T / C) are two adjacent SNPs, located at the 1429th and 1430th bases in the coding region of the CsLCR gene, respectively. Since SNP3 and SNP4 are adjacent, the two SNPs are treated as one SNP for marker development. Three primers were designed for the above four SNP sites, namely upstream primer F1, upstream primer F2 and downstream primer R, where F1 and F2 include FAM and VIC fluorescent linker sequences, respectively. The primer sequences are shown in Table 1:
[0072] Table 1 KASP marker specific primers
[0073]
[0074] Example 3
[0075] A kit for SNP1 (C / G) KASP labeling, comprising a SNP1 (C / G) upstream primer F1, an upstream primer F2 and a downstream primer R, the sequences of which are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3 respectively.
[0076] Example 4
[0077] A kit for SNP2 (T / G) KASP labeling, comprising a SNP2 (T / G) upstream primer F1, an upstream primer F2 and a downstream primer R, the sequences of which are shown in SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6 respectively.
[0078] Example 5
[0079] A kit for SNP3 / 4 (TT / GC) KASP labeling, comprising a SNP3 / 4 (TT / GC) upstream primer F1, an upstream primer F2 and a downstream primer R, the sequences of which are shown in SEQ ID No. 7, SEQ ID No. 8 and SEQ ID No. 9 respectively.
[0080] Example 6
[0081] A kit for SNP1 (C / G), SNP2 (T / G) and SNP3 / 4 (TT / GC) KASP labeling, comprising SNP1 (C / G), SNP2 (T / G) and SNP3 / 4 (TT / GC) KASP upstream primer F1, upstream primer F2 and downstream primer R, which are sequences shown in SEQ ID No. 1 to SEQ ID No. 9, respectively.
[0082] Example 7
[0083] A method for screening varieties or germplasms of blue orchids with multiple tepals and rare flowers, comprising the following steps:
[0084] (1) Seventy-five cultivated Cymbidium orchid varieties, including 14 odd-flowered varieties with multiple tepals (numbered 1-14 in Table 1) and 61 normal-flowered varieties (numbered 15-75 in Table 1), were randomly selected as experimental materials to verify the effectiveness of KASP markers.
[0085] Table 2 75 Cymbidium orchid varieties used for KASP marker testing
[0086] Serial number Variety name Serial number Variety name Serial number Variety name 1 Millennium Goddess 26 Guihua 51 Gold inlaid with jade 2 Wenshan Strange Butterfly 27 Yaolin Rouge 52 Beihai plain flower thread art 3 Green Cloud 28 Hooked green 53 Golden Suhe 4 Bird's Nest King 29 Black Bao Gong 54 Purple 5 Wonderful Butterfly of China 30 Colorful Plum Butterfly 55 Aolimei 6 Red roses 31 Happy Butterfly Thread Art 56 White Jade Brocade 7 Tianfuqi 32 Heart blossoming 57 blue waves 8 Jade Lion 33 Rouge Butterfly 58 Hongtashan 9 Cuixiang 34 Tang Sancai 59 Purple Air Coming from the East 10 Xiju 35 Green Claws and White Ink 60 Red Lotus Thread Art 11 Baoshan Claw 36 Big Tabby 61 Golden Princess Thread Art 12 Zhuhai Fisher Girl 37 Number One Scholar Butterfly 62 Red Lip Plum 13 Datun Qilin 38 Qio Butterfly 63 Xiqiao Suhe 14 Treasure Island Wonder 39 Jin Su 64 Red chrysanthemum 15 Amber Flower 40 Willow Leaf White Ink 65 Fuqianzhong 16 Imperial Concubine 41 Golden Jadeite 66 Round Lotus 17 Chinese Red 42 Black 67 Southern Peony 18 Heavenly General 43 Medium-dwarf red gold flower 68 Alpine red wine 19 Long March 44 Hongchan 69 Purple Lotus 20 soaring crane 45 Medium white ink 70 Hidden Dragon 21 Hanging green 46 Go down the mountain to Jinzui 71 Lotus flower emerging from water 22 Yaotai Watching the Moon 47 Golden Sun Wheel Art 72 Xiaoxiang 23 Far East Star 48 Chaozhou Suhe 73 Dawn 24 Rainbow Clouds 49 Black brother 74 Emerald Butterfly 25 Monarch Butterfly 50 Purple Lotus Fairy 75 Guangzhou Peony
[0087] (2) Genomic DNA from the 75 samples of Cymbidium orchids to be tested was extracted using a DNA extraction kit (TIANGEN), dissolved in ddH2O, and then the DNA quality and concentration were determined by 1.2% agarose gel electrophoresis and a NanoDrop spectrophotometer. After the DNA quality test was qualified, the concentration was uniformly diluted to 30 ng / μL.
[0088] (3) KASP markers were developed for the SNP sites SNP1 (C / G), SNP2 (T / G) and SNP3 / 4 (TT / GC) associated with the peculiar flower trait of Cymbidium sinense with multiple perianth segments. The primer sequences of the markers are shown in Table 1. The Cymbidium sinense genomic DNA extracted in step (2) was used as a template and PCR amplification was performed with the corresponding primers F1, F2 and R, respectively. The reaction was performed in QuantStudio TM PCR amplification products were obtained using the 7Flex Real-Time PCR System. The amplification system consisted of 1.25 μL of 30 ng / μL DNA template from a Cymbidium orchid sample, 2.5 μL of 2× KASP Master Mix, and 1.25 μL of Primer Mix (F1:F2:R = 1:1:3, volume ratio) (primer concentration: 10 μM). Each of the 75 Cymbidium orchid samples was assigned to one well, and two additional wells were filled with ddH2O instead of DNA template as a water control. PCR reaction conditions are shown in Table 3:
[0089] Table 3 PCR reaction conditions
[0090]
[0091] (4) PCR amplification of 75 samples of Cymbidium orchid was performed using the KASP molecular marker primers described in Table 1 on a real-time fluorescence quantitative PCR instrument. TM The 7Flex real-time fluorescence quantitative PCR system reads the fluorescence data of the reaction products and converts them into typing results, thereby performing genotyping on the samples.
[0092] (5) The molecular marker KASP1 can clearly separate the two genotypes C / G. All 75 varieties can be successfully typed. Figure 3 As shown in Figure A, the black dots near the Y-axis represent varieties with homozygous C:C SNPs, the dark gray dots near the X-axis represent varieties with homozygous G:G SNPs, and the light gray dots in the center represent varieties with heterozygous C:G SNPs. The small black square in the lower left corner represents the water control. Varieties with the C:C genotype are characterized by odd flowers with multiple tepals, while varieties with the C:G and G:G genotypes are characterized by normal flowers. Sixty-five of the 75 varieties were successfully identified, for an accuracy rate of 86.7% (Table 4).
[0093] Table 4 Typing results of KASP1 markers
[0094]
[0095] The molecular marker KASP2 can clearly separate the two genotypes T / G. All 75 varieties can be successfully typed. Figure 3 As shown in Figure B, the black dots near the Y-axis represent varieties with homozygous T:T SNPs, the dark gray dots near the X-axis represent varieties with homozygous G:G SNPs, and the light gray dots in the middle represent varieties with heterozygous G:T SNPs. The small black square in the lower left corner is the water control. Varieties with the G:G genotype are characterized by odd flowers with multiple tepals, while varieties with the G:T and T:T genotypes are characterized by normal flowers. 64 of the 75 varieties were successfully identified, for an accuracy rate of 83.3%.
[0096] Table 5 Typing results of KASP2 markers
[0097]
[0098] The molecular marker KASP3 can also clearly separate the two genotypes of TT / GC, and all 75 varieties were successfully typed. Figure 3As shown in Figure C, the black dots near the Y-axis represent varieties with homozygous TT:TT SNPs, the dark gray dots near the X-axis represent varieties with homozygous GC:GC SNPs, and the light gray dots in the center represent varieties with heterozygous GC:TT SNPs. The small black square in the lower left corner represents the water control. Varieties with the GC:GC genotype are characterized by odd flowers with multiple tepals, while varieties with the GC:TT and TT:TT genotypes are characterized by normal flowers. 64 of the 75 varieties were successfully identified, for an accuracy rate of 85.3%.
[0099] Table 6 Typing results of KASP3 markers
[0100]
[0101] Comparison revealed that KASP2 and KASP3 successfully identified identical varieties and yielded identical results, allowing for either to be selected. However, both were not identical to the varieties identified by KASP1. When combining different markers, the KASP1+KASP2 and KASP1+KASP3 combinations demonstrated equivalent identification results. With the exception of eight normal-flowering varieties (Huangfei, Far East Star, Gualü, Yaotai Wangyue, Chongtianhe, Zhongguohong, Changzheng, and Tianjiang), all other varieties, including 14 multi-tepal, unusual-flowering varieties, were successfully identified, with an accuracy rate of 89.3%. This indicates that the three Mo Lan KASP markers developed based on four SNPs in the Mo Lan CsLCR gene are ideal for identifying Mo Lan varieties with multiple tepals and unusual-flowering varieties.
[0102] Table 7 Identification results of KASP marker combinations
[0103]
[0104] This study observed the number of tepals in flowers from different germplasm resources within natural populations of Orchidaceae and conducted genome-wide association analysis. This made the tepal number SNPs derived from the association analysis more reliable and the discovery of candidate genes for tepal number and the development of genetic markers more precise. The three KASP markers designed and developed by this study can be used to select and breed Orchidaceae germplasm with multiple tepals and their hybrid offspring. They can accurately genotype Orchidaceae varieties with more than six tepals compared to normal varieties. This molecular marker combination is promising for large-scale early screening of germplasm, providing effective support for molecular breeding of Orchidaceae flower types.
[0105] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A KASP marker for identifying the multi-tepal strange-flower variety of Cymbidium sinense, characterized in that, including one or more of KASP1, KASP2, and KASP3; The KASP1 is located at the 229th base of the coding region of the CsLCR gene annotated on chromosome 5 of Cymbidium sinense, with a C / G mutation. Those with the genotype C:C are the strange-flower varieties of Cymbidium sinense with multiple flower sepals; The KASP2 is located at the 687th base of the coding region of the CsLCR gene annotated on chromosome 5 of Cymbidium sinense, with a T / G mutation. Those with the genotype G:G are the strange-flower varieties of Cymbidium sinense with multiple flower sepals; The KASP3 is located at the 1429th and 1430th bases of the coding region of the CsLCR gene annotated on chromosome 5 of Cymbidium sinense. There is a T / G mutation at the 1429th base and a T / C mutation at the 1430th base. Those with the genotype GC:GC are the strange-flower varieties of Cymbidium sinense with multiple flower sepals; The nucleotide sequence of the CsLCR gene is as shown in SEQ ID No.
10.
2. Use of the KASP marker according to claim 1 in identifying the strange-flower varieties of Cymbidium sinense with multiple flower sepals.
3. A KASP primer for identifying the multi-tepal odd-flower variety of Cymbidium sinense, characterized in that, including one or more of the KASP1 primer, the KASP2 primer, and the KASP3 primer; The nucleotide sequences of the upstream primers F1 and F2 of the KASP1 primer are as shown in SEQ ID Nos. 1 to 2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No. 3; The nucleotide sequences of the upstream primers F1 and F2 of the KASP2 primer are as shown in SEQ ID Nos. 4 to 5, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No. 6; The nucleotide sequences of the upstream primers F1 and F2 of the KASP3 primer are as shown in SEQ ID Nos. 7 to 8, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.
9.
4. Use of the KASP primer according to claim 3 in identifying the strange-flower varieties of Cymbidium sinense with multiple flower sepals.
5. The application according to claim 4, wherein The use includes the following steps: 1) Extract the genomic DNA of Cymbidium sinense, and perform real-time fluorescence quantitative PCR amplification with the genomic DNA as a template using the KASP primer according to claim 3 to obtain an amplification product; 2) Read the fluorescence data of the amplification product obtained in step 1), convert it into a genotyping result, and identify the strange-flower varieties of Cymbidium sinense with multiple flower sepals according to the genotyping result.
6. The application according to claim 5, characterized in that, The system for the real-time fluorescence quantitative PCR amplification is: 1.25 μL of genomic DNA with a concentration of 30 ng / μL, 2.5 μL of 2×KASP Master mix, and 1.25 μL of Primer Mix; In the Primer Mix, the volume ratio of the upstream primer F1, the upstream primer F2, and the downstream primer in the KASP primer according to claim 3 is 1:1:3, and the concentration is 10 μM.
7. The application according to claim 5, characterized in that, The program for the real-time fluorescence quantitative PCR amplification is: 95°C for 10 min; 95°C for 20 s, 58°C for 60 s, 10 cycles; 95°C for 20 s, 55°C for 60 s, 27 cycles; 25°C for 30 s.
8. A kit for identifying the strange-flower variety of the perianth of Cymbidium sinense, characterized in that, including the KASP primer according to claim 3 and 2×KASP Master mix.
Citation Information
Patent Citations
Cymbidium sinense 'labellum and petal sepalody' character-related functional molecular marker and identification method thereof
CN106755526A
Phalaenopsis bottom color SNP molecular marker primer composition and application thereof
CN112725515A
Cymbidium sinense SSR (Simple Sequence Repeat) primer group and method for constructing cymbidium sinense variety fingerprint spectrum by applying primer group
CN114736977A
KASP marker, primer and kit for identifying cymbidium sinense floribunda odd flower variety and application of KASP marker, primer and kit for identifying cymbidium sinense floribunda odd flower variety
CN117904353A