Functional nucleic acid sensor for rapidly and efficiently detecting brain natriuretic peptide

Abstract

The invention discloses a functional nucleic acid sensor for rapidly and efficiently detecting brain natriuretic peptide, which is characterized in that an aptamer with high affinity with BNP (brain natriuretic peptide) is screened out and modified on CuxNiyCo3-x-y-MOF to construct a biosensing system for detecting the brain natriuretic peptide. A catalytic site of the CuxNiyCo3-x-y-MOF is competitively regulated and controlled by specific binding of the BNP and Apt, when the brain natriuretic peptide and the aptamer are specifically bound, the Apt is stripped, a catalytic active site of the MOF is exposed, and then glucose is catalyzed to react. The change amount of glucose is detected by virtue of a glucometer, so that the concentration content of the brain natriuretic peptide can be detected. The sensor disclosed by the invention has the characteristics of simplicity in operation, rapidness in detection, low cost and the like, does not need complex pretreatment steps, is convenient to carry, and has important significance on clinical rapid detection of the brain natriuretic peptide and early diagnosis of cardiovascular diseases.

Description

Technical Field

[0001] The present invention relates to the field of biosensing, and particularly to a functional nucleic acid sensor for rapid and efficient detection of brain natriuretic peptide. Background Art

[0002] Brain natriuretic peptide (BNP), as a key biomarker for evaluating cardiovascular health, is crucial in clinical diagnosis, treatment plan formulation, and disease monitoring. It is closely related to various cardiovascular diseases. For example, in patients with heart failure, its blood concentration will increase significantly, which can accurately reflect the degree of heart function impairment. Accurate detection of BNP concentration is of great significance for the early diagnosis of cardiovascular diseases, the judgment of disease severity, and the evaluation of treatment effects. Currently, there are various methods for detecting BNP. Immunoassay detects by the specific binding of antigen-antibody. Although it has high sensitivity, its operation process is complex, requiring professional personnel for strict sample handling and multiple steps of operation. The detection time is long, and it is usually difficult to obtain results in a short time, unable to meet the urgent need for rapid diagnosis in clinical emergencies. Although electrochemiluminescence method has the advantages of relatively fast detection speed and high sensitivity, the cost of detection equipment is extremely high, the maintenance and operation costs of the instrument are also very high, and it has strict requirements for the detection environment, requiring professional laboratory conditions and technical support, which severely limits its popularization and use in primary medical institutions and areas with relatively scarce resources.

[0003] Nucleic acid aptamers can highly specifically recognize various targets. Compared with traditional antibodies, nucleic acid aptamers have many advantages such as being able to be prepared in large quantities by chemical synthesis, having lower costs, and better stability. Therefore, constructing biosensors using nucleic acid aptamers has become a research hotspot and is expected to overcome the deficiencies of traditional detection methods.

[0004] Paper-based microfluidic technology utilizes the porous structure and hydrophilicity of cellulose to drive liquid flow through capillary action, and combines chemical modification to achieve sample pretreatment and signal amplification. However, two-dimensional paper-based chips are limited by surface area and reaction efficiency. In recent years, three-dimensional paper-based chips have formed three-dimensional microchannels and reaction chambers through stacking, folding, or laser engraving, significantly increasing the specific surface area and improving the antibody / antigen immobilization density and reaction sensitivity. This technology has been applied to the point-of-care testing (POCT) of blood proteins such as tumor markers and inflammatory factors, and is particularly suitable for disease screening in resource-limited areas, but still faces challenges such as sensitivity improvement, batch-to-batch stability control, and mass production process optimization.

[0005] In addition, as a widely used household medical testing device, the personal glucose meter (PGM) is very popular among the public for its simple operation, rapid detection, and low cost. People can operate the glucose meter at home by themselves for blood glucose detection, which provides an idea for developing a new type of biosensor based on the glucose meter platform. If the specific element for detecting BNP can be combined with the personal glucose meter, and with the help of the mature detection technology and extensive application basis of the glucose meter, it is expected to develop a BNP detection biosensor with simple operation, rapidity, and low cost, meeting the needs of clinical point-of-care testing and home health monitoring. Summary of the Invention

[0006] The purpose of the present invention is to provide a functional nucleic acid sensor for rapid and efficient detection of brain natriuretic peptide, which can be applied to the rapid detection of brain natriuretic peptide.

[0007] To achieve the above purpose, the technical solution of the present invention is as follows:

[0008] A functional nucleic acid sensor for rapid and efficient detection of brain natriuretic peptide. The biosensor mainly consists of an aptamer with high affinity for BNP and a Cu x Ni y Co 3-x-y -MOF material to form the key detection part, and is used in combination with a personal glucose meter. The biosensor includes a housing, and the interior is divided into 5 layers stacked in sequence.

[0009] The first layer is the sample addition layer. The sample addition layer is provided with a blood sample addition port and a glucose solution addition port, and the blood sample addition port and the glucose solution addition port are isolated from each other;

[0010] The second layer is the blood treatment layer. The blood treatment layer is provided with a whole blood separation membrane and a glucose solution channel, and the rest of the area is a hydrophobic area. The whole blood separation membrane corresponds to the position of the blood sample addition port, and the glucose solution channel corresponds to the position of the glucose solution addition port;

[0011] The third layer is the reaction layer. The reaction layer is prepared with filter paper. The reaction layer is provided with a hydrophilic channel hole and an Apt@Cu x Ni y Co 3-x-y -MOF loading area. The two areas are connected by a hydrophilic microchannel, and the rest of the area is a hydrophobic area. The hydrophilic channel hole is aligned with the right end of the whole blood separation membrane, and the glucose solution channel is aligned with the left end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area;

[0012] The fourth layer is the water absorption channel layer, which is prepared with filter paper. The water absorption channel layer is provided with a waste liquid export channel, and the waste liquid export channel is aligned with the Apt@Cu x Ni y Co3-x-y -At the right end of the MOF loading area, a foldable and expandable high-capacity water-absorbing pad is provided on the right side of the channel hole, and the rest is a hydrophobic area;

[0013] The fifth layer is an embedded blood glucose meter test strip interface layer. An embedded blood glucose meter test strip interface is provided on the embedded blood glucose meter test strip interface layer. The blood collection area of the blood glucose meter test strip is aligned with the waste liquid export channel.

[0014] The Apt is at least one of the following gene sequences:

[0015] Apt-1: ATCCAGAGTGACGCAGCATCCAGAGTGACGCAGCATCCAGAGT GACGCAGCATCCAGAGTGTGGACACGGTGGCTTAGT;

[0016] Apt-2: ATCCAGAGTGACGCAGCAGTTGCGGCAATAATTATACGTCATGAGTGATAGTTCCTGGACACGGTGGCTTAGT;

[0017] Apt-3: ATCCAGAGTGACGCAGCAAGGCTTAATCCTGGGGGCGCGATAGGCTTATCTCGCTCTGGACACGGTGGCTTAGT.

[0018] The Apt@Cu x Ni y Co 3-x-y -The preparation method of MOF includes:

[0019] Disperse 100 mg of Co-MOF in 100 ml of absolute ethanol, and mix it evenly with 14 ml of an ethanol mixture of Cu 2+ / Ni 2+ (42.2 mg of Cu(NO3)2·3H2O and 152.6 mg of Ni(NO3)2·6H2O). Ultrasonically treat the mixture for 1.5 h, centrifuge the mixture, and wash it three times with ethanol and then dry it. Obtain Cu x Ni y Co 3-x-y -MOF, where x / y = 1 / 3.

[0020] The preparation method of the Co-MOF includes: Dissolve 1.46 g of Co(NH3)2·6H2O and 1.64 g of 2-methylimidazole in a mixture of 40 mL of ethanol and 40 mL of methanol respectively. Rapidly add the 2-methylimidazole solution to the Co(NH3)2·6H2O solution and stir vigorously for 60 s until evenly mixed. Stir and incubate at room temperature for 24 h. Centrifuge and wash with methanol 3 times and dry for standby.

[0021] Weigh 6 mg of Cu x Ni y Co 3-x-y -MOF, add 2 ml of 250 nM Apt, stir at room temperature for 2 h, then centrifuge to remove the supernatant, and wash with PBS buffer to obtain a precipitate of Apt@Cu x Ni y Co 3-x-y -MOF.

[0022] The nucleic acid aptamer is obtained by screening with HIS-BNP.

[0023] The functional nucleic acid sensor for detecting brain natriuretic peptide BNP is prepared by the following method:

[0024] (1) Preparation of the sample addition layer: Take a PET plate, punch holes on the PET plate for the blood sample addition hole and the glucose solution addition hole respectively;

[0025] (2) Preparation of the blood treatment layer: Set up a whole blood separation membrane, let the glucose solution pass through the pore channels, and perform hydrophobic treatment on the remaining areas;

[0026] (3) Preparation of the reaction layer: Take a filter paper, set up hydrophilic channel holes to align with the right end of the whole blood separation membrane, align the glucose solution channel with the left end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area, and connect the two areas through hydrophilic channels. Perform hydrophobic treatment on the remaining areas;

[0027] (4) Preparation of the water absorption channel layer: Take a filter paper, set up hydrophilic channel holes to align with the right end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area, and set up a foldable-unfoldable high-capacity water absorption pad on the right side of the channel hole. Perform hydrophobic treatment on the remaining areas;

[0028] (5) Preparation of the interface layer of the embedded blood glucose meter test strip: Take a PET plate, cut out a socket area that fits the size of the blood glucose meter test strip, and align the blood collection area of the blood glucose meter test strip with the channel hole.

[0029] A modified Cu x Ni y Co 3-x-y -MOF as an application of a functional nucleic acid sensor for detecting brain natriuretic peptide, characterized in that the modified Cu x Ni y Co 3-x-y -MOF is obtained by modifying an aptamer with high affinity for BNP on the modified Cu x Ni yCo 3-x-y -MOF, and the aptamer is at least one of the following gene sequences:

[0030] Apt-1: ATCCAGAGTGACGCAGCATCCAGAGTGACGCAGCATCCAGAGT GACGCAGCATCCAGAGTGTGGACACGGTGGCTTAGT;

[0031] Apt-2: ATCCAGAGTGACGCAGCAGTTGCGGCAATAATTATACGTCATGAGTGATAGTTCCTGGACACGGTGGCTTAGT;

[0032] Apt-3: ATCCAGAGTGACGCAGCAAGGCTTAATCCTGGGGGCGCGATAGGCTTATCTCGCTCTGGACACGGTGGCTTAGT.

[0033] A method for detecting the degree of cardiovascular health, which uses the functional nucleic acid sensor for detecting B-type natriuretic peptide (BNP) described in claim 1. A whole blood sample is dropped from the blood sampling port. After the waste liquid is transferred to the high-capacity absorbent pad, the absorbent layer is unfolded. Glucose solution is injected into the glucose solution sampling port, and the glucose solution infiltrates the reaction area to catalyze the glucose oxidation reaction. The reaction products migrate through the hydrophilic channel to the embedded blood glucose meter test strip. After transferring the embedded blood glucose meter test strip to the blood glucose meter to complete signal amplification, analog-to-digital conversion, and calibration, the quantitative detection result of the target protein is finally obtained. By comparing with the quantitative mapping relationship table of the glucose signal change caused by the concentration gradient of the heart failure biomarker BNP, the degree of cardiovascular health is evaluated.

[0034] The principle of the present invention is as follows:

[0035] The aptamer is modified on Cu x Ni y Co 3-x-y -MOF by electrostatic adsorption, and its catalytic site is competitively regulated by the specific binding of BNP and Apt. When a sample containing B-type natriuretic peptide is dropped onto Apt@Cu x Ni y Co 3-x-y -MOF, the aptamer quickly binds to B-type natriuretic peptide by virtue of its specific recognition ability, and Apt dissociates from Cu x Ni y Co 3-x-y-The surface of the MOF is peeled off, and the catalytic active sites of the MOF are exposed. The exposed MOF catalytic sites catalyze the glucose solution. The designed three-dimensional paper-based microfluidic biosensing chip is combined with a blood glucose meter to quickly measure the change in the concentration of the glucose solution and calculate the concentration value of brain natriuretic peptide in the sample, realizing the quantitative detection of brain natriuretic peptide.

[0036] The beneficial effects of the present invention are as follows:

[0037] 1. Combining with the operation mode of the blood glucose meter, ordinary users can easily get started without professional training and can complete the detection by themselves at home, greatly facilitating patients to carry out daily health monitoring.

[0038] 2. From adding the sample to obtaining the test result, the whole process can be completed in a short time, meeting the needs of rapid clinical emergency diagnosis, helping to detect the risk of cardiovascular diseases in time, and striving for precious treatment time for patients.

[0039] 3. The chemical synthesis cost of the aptamer is relatively low, the price of the MOF material is relatively reasonable, and the existing blood glucose meter platform is used for transformation, avoiding the purchase of expensive special detection equipment, greatly reducing the detection cost, and being conducive to wide promotion and application in primary medical institutions and families.

[0040] 4. The aptamer has a highly specific recognition ability for brain natriuretic peptide, effectively reducing the interference of other biomolecules, ensuring the accuracy and reliability of the detection results, and providing more accurate data support for clinical diagnosis. Description of the Drawings

[0041] Figure 1 is the detection process and detection principle of the paper-based microfluidic biosensing chip for detecting the heart failure biomarker - brain natriuretic peptide BNP of the present invention;

[0042] Figure 2 is the ultraviolet absorbance curve of the nucleic acid aptamer library obtained in each round of screening;

[0043] Figure 3 is the affinity determination curve of aptamer Apt-1 and BNP;

[0044] Figure 4 is the affinity determination curve of aptamer Apt-2 and BNP;

[0045] Figure 5 is the affinity determination curve of aptamer Apt-3 and BNP;

[0046] Figure 6 is the material Apt@Cu provided by the present invention x Ni y Co 3-x-y -The electron microscopy characterization diagram of MOF;

[0047] Figure 7 It is Cu x Ni y Co 3-x-y -MOF, Apt and Apt@Cu x Ni y Co 3-x-y The Zeta potential of -MOF;

[0048] Figure 8 It is the curve of brain natriuretic peptide corresponding to the decrease in glucose concentration;

[0049] Figure 9 It is the curve of the change in the difference of brain natriuretic peptide corresponding to the glucose concentration;

[0050] Figure 10 It is Co-MOF and Cu x Ni y Co 3-x-y- The comparison of the catalytic performance of MOF for glucose;

[0051] Figure 11 It is the schematic structural diagram of a paper-based microfluidic biosensing chip for a heart failure biomarker of the present invention;

[0052] Reference numerals: 1 - sample addition layer; 1-1 blood sample addition port; 1-2 glucose solution sample addition port; 2 - blood treatment layer; 2-1 whole blood separation membrane; 2-2 glucose solution channel; 3 - reaction layer; 3-1 hydrophilic channel hole; 3-2 Apt@Cu x Ni y Co 3-x-y -MOF loading area; 4 - water absorption channel layer; 4-1 waste liquid export channel; 4-2 high-capacity water absorption pad; 5 - embedded blood glucose meter test strip interface layer; 5-1 embedded blood glucose meter test strip interface. Detailed implementation manners

[0053] The present invention will be further described below in conjunction with specific embodiments. The following are the implementation examples of the present invention, which are not intended to limit the present invention. Any modifications, substitutions, and improvements made on the basis of the present invention are all included in the protection scope of the present invention. In the following embodiments, the experimental methods are all conventional methods unless otherwise specified; the experimental materials used are all conventional biochemical reagents and can be obtained through commercial channels.

[0054] Example 1

[0055] This example relates to the screening of a nucleic acid aptamer for brain natriuretic peptide BNP.

[0056] Aptamer screening method based on BLI-SELEX. Immerse the HIS1K sensor disk on a pre-wetted plate for 10 minutes and then place it into the instrument. Follow the steps of "equilibration - immobilization - equilibration - binding - elution", edit the sample placement positions, set wells A1 and B1 of the sample plate as Baseline 1, add TE buffer with pH = 8.0 for 180 s; set A2 and B2 as Loading, add the prepared B-type natriuretic peptide (BNP) with HIS tag (200 nmol / L), and the buffer is TE buffer with pH = 8.0 for 300 s; set A3 and B3 as Baseline 2, add TE buffer with pH = 8.0 for 180 s; set A4 and B4 as Association, add 2 μmol / L DNA library for 300 s; set A5 - A9 and B5 - B9 as Dissociation, add 200 μL TE buffer, with 180 s for each well. The volume of the liquid added to each well is 200 μL. Then place the sample plate into the instrument and close the instrument chamber door. Then run the screening program, collect the DNA dissociated from columns 6 - 9 and store it at 4 °C.

[0057] Perform PCR amplification on the screened product, and then repeat the above screening steps for a total of 5 rounds. After each round of screening, collect and integrate the DNA solutions dissociated from columns 6 - 9 in the 96-well plate. Use the collected solution as a template for PCR amplification. Take 1 μL of the template, 1 μL of primer 1 (20 μmol / L), 1 μL of primer 2 (20 μmol / L), 25 μL of Premix Taq (LATaq Version 2.0 plus dye), and 23 μL of sterilized water, and perform 25 rounds of PCR amplification under the conditions of denaturation at 98 °C for 10 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. After the amplification is completed, measure its OD value using an ultraviolet-visible spectrophotometer. The ultraviolet absorption wavelength of DNA is 260 nm, and the ultraviolet absorbance curves during each round of screening are as Figure 2 shown. Take 1 μL of the PCR product from the last round of screening and mix it with 1 μL of pMD18-T Vector vector, 3 μL of sterilized water, and 5 μL of Quick Ligation Enzyme Solution I, and incubate at 16 °C for 30 min. Take 2 μL of the ligation solution into another microcentrifuge tube, ice-bath for 5 minutes, take 50 μL of E. coli DH5a Competent Cell and mix it with the above ligation product, mix well and ice-bath for 10 minutes. Add SOC medium, and finally place it in a shaker at 37 °C for 3 h. After the culture is completed, culture it on an LB plate containing X-Gal, IPTG, and ampicillin (Amp) (100 μg / mL) to form single colonies. Positive clones can be selected according to the blue-white color of the grown colonies and their plasmids can be sequenced.

[0058] Finally, the following 3 nucleic acid aptamers were screened out:

[0059] Apt-1: ATCCAGAGTGACGCAGCATCCAGAGTGACGCAGCATCCAGAGTGACGCAGCATCCAGAGTGTGGACACGGTGGCTTAGT;

[0060] Apt-2: ATCCAGAGTGACGCAGCAGTTGCGGCAATAATTATACGTCATGAGTGATAGTTCCTGGACACGGTGGCTTAGT;

[0061] Apt-3: ATCCAGAGTGACGCAGCAAGGCTTAATCCTGGGGGCGCGATAGGCTTATCTCGCTCTGGACACGGTGGCTTAGT.

[0062] Example 2

[0063] This example relates to the determination of the affinity of the brain natriuretic peptide BNP nucleic acid aptamer.

[0064] The dissociation constant of the screened aptamer was determined using the BLI method. The SA sensor disk was placed on a pre-wetted plate and soaked for 10 minutes, and then placed into the instrument. The steps of "equilibration - immobilization - equilibration - binding - dissociation" were carried out. Edit the sample placement positions. The A1 - F1 wells of the sample plate were set as Baseline 1, and PBS buffer with pH = 7.4 was added for 180 s; the A2 - F2 wells of the sample plate were set as Loading, and 50 nmol / L 5'-biotinylated aptamer (PBS buffer, pH = 7.4) was added for 300 s; the A3 - F3 wells of the sample plate were set as Baseline 2, and PBS buffer with pH = 7.4 was added for 180 s; the A4 - F4 wells of the sample plate were set as Association, and different concentrations of brain natriuretic peptide (BNP) (2000 nmol / L, 1600 nmol / L, 1200 nmol / L, 800 nmol / L, 400 nmol / L, PBS buffer) were added for 600 s; the A5 - F5 wells of the sample plate were set as Dissociation, and PBS buffer with pH = 7.4 was added for 600 s. The volume of the liquid added to each well was 200 μL. Then the sample plate was placed into the instrument and the instrument cabin door was closed. Then the program was run. The binding and dissociation curves obtained from the instrument operation were analyzed to obtain the kinetic data dissociation equilibrium constant KD. Figures 3 - 5 They are the affinity determination curves of Apt-1, Apt-2, and Apt-3 with BNP, respectively.

[0065] Example 3

[0066] This example relates to a method for preparing Co-MOF, including:

[0067] Dissolve 1.46 g of Co(NH3)2·6H2O and 1.64 g of 2-methylimidazole in a mixture of 40 mL of ethanol and 40 mL of methanol respectively. Add the 2-methylimidazole solution to the Co(NH3)2·6H2O solution and stir vigorously until evenly mixed. Stir and incubate at room temperature for 24 h. Wash by centrifugation with methanol three times and dry for standby.

[0068] Example 4

[0069] This example relates to the preparation of Apt@Cu x Ni y Co 3-x-y -MOF, where x / y = 1 / 3.

[0070] Disperse 99 mg of Co-MOF in 10 mL of absolute ethanol, and mix it with a mixed ethanol solution of 14 mL of Cu 2+ / Ni 2+ (42.2 mg of Cu(NO3)2·3H2O and 152.6 mg of Ni(NO3)2·6H2O). Ultrasonically treat the mixed solution for 1.5 h, centrifuge the mixed solution, and wash with ethanol three times and then dry. Obtain Cu x Ni y Co 3-x-y -MOF, where x / y = 1 / 3. The electron micrograph of the material is as shown in Figure 6 shown.

[0071] Weigh 6 mg of Cu x Ni y Co 3-x-y -MOF, add 2 mL of 250 nM Apt and stir at room temperature for 2 h, then centrifuge to remove the supernatant, and wash with PBS buffer solution to obtain a precipitate of Apt@Cu x Ni y Co 3-x-y -MOF. The Zeta potential of the material is as shown in Figure 7 shown.

[0072] Example 5

[0073] This example relates to the detection of BNP by Apt@Cu x Ni y Co 3-x-y- MOF.

[0074] Add to Apt@Cu x Ni y Co 3-x-y- Add 200 μL of BNP at different concentrations to Co-MOF, react for 20 minutes, and centrifuge to remove the supernatant. Then add 100 μL of glucose solution with an initial concentration of 24.6 mM and pH = 9, react for 20 minutes, take 10 μL of the supernatant and drop it onto the glucose meter test strip, and wait for 10 seconds to read the change in glucose concentration. The response curve of the glucose concentration change detected for BNP is as Figure 8 、 Figure 9 shown.

[0075] According to the heart failure risk stratification criteria and the clinical application specifications of biomarkers established in the "Chinese Guidelines for the Diagnosis and Treatment of Heart Failure (2024 Update)" recently released by the National Center for Cardiovascular Diseases, in this example, based on the conversion of the target biomarker into a glucose signal and its amplification mechanism in the biosensing paper-based chip, a quantitative mapping relationship of the glucose signal change caused by the concentration gradient of the heart failure biomarker BNP at different heart failure risk warning levels was constructed.

[0076] Table 1. Quantitative mapping relationship of glucose signal changes caused by the concentration gradient of the heart failure biomarker BNP

[0077]

[0078] Example 6

[0079] This example involves the comparison of the catalytic performance of Co-MOF and modified Cu x Ni y Co 3-x-y- MOF for glucose.

[0080] Weigh 1 mg of Co-MOF and 1 mg of Cu x Ni y Co 3-x-y- MOF into microcentrifuge tubes, add 100 μL of glucose solution with an initial concentration of 24.6 mM and pH = 9, react for 20 minutes, take 10 μL of the supernatant and add it to the glucose meter test strip, and wait for 10 seconds to read its glucose concentration. The comparison of the catalytic ability of the materials for glucose is as Figure 10 shown.

[0081] Example 7

[0082] This example involves the design of the three-dimensional paper-based microfluidic biosensing chip.

[0083] (1) Preparation of the sample addition layer: Take a PET plate and punch holes in it for the blood sample addition port and the glucose solution addition port respectively.

[0084] (2) Preparation of the blood treatment layer: Set up a whole blood separation membrane and a glucose solution channel, and perform hydrophobic treatment on the remaining areas.

[0085] (3) Preparation of the reaction layer: Take a filter paper and set hydrophilic channel holes. Align the hydrophilic channel holes with the right end of the whole blood separation membrane, and align the glucose solution channel with the left end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area. Connect the two areas through hydrophilic microchannels. Treat the remaining areas with hydrophobic treatment.

[0086] (4) Preparation of the water absorption channel layer: Take a filter paper and set a waste liquid export channel. Align the waste liquid export channel with the right end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area, and set a foldable - unfoldable high-capacity water absorption pad on the right side of the waste liquid export channel. Treat the remaining areas with hydrophobic treatment.

[0087] (5) Preparation of the interface layer of the embedded blood glucose meter test strip: Take a PET board and cut out a socket area that fits the size of the blood glucose meter test strip. Align the blood collection area of the blood glucose meter test strip with the waste liquid export channel.

[0088] The structural schematic diagram of the paper-based microfluidic biosensing chip is as Figure 11 shown.

[0089] Example 8

[0090] This example relates to the application of the three-dimensional paper-based chip for detecting brain natriuretic peptide BNP.

[0091] Add 10 - 20 uL of whole blood sample dropwise through the blood sampling port 1-1. The whole blood sample flows through the whole blood separation membrane 2-1 under the drive of capillary force, filtering out interfering components such as red blood cells to obtain plasma. The plasma is directionally transported through the hydrophilic channel holes 3-1 to the Apt@Cu x Ni y Co 3-x-y -MOF loading area 3-2, where BNP reacts with Apt@Cu x Ni y Co 3-x-y- MOF. After the binding reaction between BNP and the aptamer is completed, the excess liquid is absorbed by the water absorption channel layer 4 of the folded cellulose: The waste liquid is transferred to the high-capacity water absorption pad 4-2 through the waste liquid export channel 4-1 to ensure the dryness of the reaction area; Manually unfold the folded water absorption layer to activate the next detection stage. Inject glucose solution into the glucose solution sampling port 1-2, and the glucose solution wets the Apt@Cu x Ni y Co 3-x-y- The MOF loading area 3-2 catalyzes the glucose oxidation reaction, and the reaction products migrate through the waste liquid export channel 4-1 to the interface of the embedded blood glucose meter test strip, triggering the redox reaction of the test strip electrode to generate a microcurrent signal; the signal is amplified, analog-to-digital converted and calibrated by the built-in circuit of the blood glucose meter, and finally the quantitative detection result of the target protein is displayed.

[0092] Matters not covered in this invention are well-known technologies.

[0093] The above embodiments are only used to illustrate the technical concept and features of the present invention, and their purpose is to enable those skilled in the art to understand the content of the present invention and implement it accordingly, and should not be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.

Claims

1. A functional nucleic acid sensor for detecting brain natriuretic peptide (BNP), characterized in that, It includes a housing, which is internally divided into 5 layers stacked in sequence. Among them, the first layer is the sample addition layer. The sample addition layer is provided with a blood sample addition port and a glucose solution sample addition port, and the blood sample addition port and the glucose solution sample addition port are isolated from each other. The second layer is the blood treatment layer. A whole blood separation membrane and a glucose solution channel are provided on the blood treatment layer, and the remaining area is a hydrophobic area. The whole blood separation membrane corresponds to the position of the whole blood sampling port, and the glucose solution channel corresponds to the position of the glucose solution sampling port; The third layer is the reaction layer, which is prepared with filter paper. The reaction layer is provided with hydrophilic channel holes and an Apt@Cu x Ni y Co 3-x-y -MOF loading area. The two areas are connected by hydrophilic microchannels, and the remaining area is a hydrophobic area. The hydrophilic channel holes are aligned with the right end of the whole blood separation membrane, and the glucose solution channel is aligned with the left end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area; The fourth layer is the water absorption channel layer, which is prepared with filter paper. The water absorption channel layer is provided with a waste liquid export channel, and the waste liquid export channel is aligned with the right end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area, and a foldable and expandable high-capacity water absorption pad is arranged on the right side of the channel hole, and the rest is a hydrophobic area; The fifth layer is the interface layer of the embedded blood glucose meter test strip. An interface of the embedded blood glucose meter test strip is provided on the interface layer of the embedded blood glucose meter test strip. The blood sampling area of the blood glucose meter test strip is aligned with the waste liquid export channel; The Apt@Cu x Ni y Co 3-x-y -MOF is modified with an aptamer having a high affinity for BNP on the modified Cu x Ni y Co 3-x-y -MOF, where x / y = 1 / 3.

2. The functional nucleic acid sensor for detecting brain natriuretic peptide (BNP) according to claim 1, wherein The Apt is at least one of the following gene sequences: Apt-1: ATCCAGAGTGACGCAGCATCCAGAGTGACGCAGCATCCAGAGT GACGCAGCATCCAGAGTGTGGACACGGTGGCTTAGT; Apt-2: ATCCAGAGTGACGCAGCAGTTGCGGCAATAATTATACGTCATGAGTGATAGTTCCTGGACACGGTGGCTTAGT; Apt-3: ATCCAGAGTGACGCAGCAAGGCTTAATCCTGGGGGCGCGATAGGCTTATCTCGCTCTGGACACGGTGGCTTAGT.

3. The functional nucleic acid sensor for detecting brain natriuretic peptide (BNP) according to claim 1, wherein The Apt@Cu x Ni y Co 3-x-y -MOF, where x / y = 1 / 3, and the preparation method includes: Disperse Co-MOF in absolute ethanol, mix it with an ethanol mixture of Cu(NO3)2·3H2O and Ni(NO3)2·6H2O, subject the mixture to ultrasonic treatment, centrifugation, ethanol washing, and drying to obtain Cu x Ni y Co 3-x-y -MOF, where x / y = 1 / 3; Cu x Ni y Co 3-x-y -MOF was added with Apt and stirred at room temperature, the supernatant was removed by centrifugation, and the precipitate was Apt@Cu x Ni y Co 3-x-y -MOF, where x / y=1 / 3.

4. The functional nucleic acid sensor for detecting brain natriuretic peptide (BNP) according to claim 3, characterized in that, The Co-MOF is prepared by the following method: Dissolve Co(NH3)2·6H2O and 2-methylimidazole in a mixed solution of ethanol and methanol respectively. Rapidly add the 2-methylimidazole solution to the Co(NH3)2·6H2O solution and stir vigorously until evenly mixed. Stir and incubate at room temperature, wash by centrifugation with methanol, and obtain Co-MOF after drying.

5. A detection method for evaluating cardiovascular health, characterized in that, Using the functional nucleic acid sensor for detecting brain natriuretic peptide BNP described in claim 1, drop a whole blood sample from the blood sample addition port. After the waste liquid is transferred to the high-capacity absorbent pad, unfold the absorbent layer; inject glucose solution into the glucose solution sample addition port. The glucose solution infiltrates the reaction area, catalyzes the glucose oxidation reaction, and the reaction product migrates to the embedded blood glucose meter test strip through the hydrophilic channel. Transfer the embedded blood glucose meter test strip to the blood glucose meter. After signal amplification, analog-to-digital conversion, and calibration, finally obtain the quantitative detection result of the target protein. Compare through the quantitative mapping relationship table between the detection result and the glucose signal change caused by the concentration gradient of the heart failure biomarker BNP, so as to evaluate the cardiovascular health degree.

6. A modified Cu x Ni y Co 3-x-y -MOF's application as a functional nucleic acid sensor for detecting brain natriuretic peptide, characterized in that, The modified Cu x Ni y Co 3-x-y -MOF is formed by modifying the aptamer with high affinity for BNP on the modified Cu x Ni y Co 3-x-y -MOF, and the nucleic acid aptamer is at least one of the following gene sequences: Apt-1: ATCCAGAGTGACGCAGCATCCAGAGTGACGCAGCATCCAGAGT GACGCAGCATCCAGAGTGTGGACACGGTGGCTTAGT; Apt-2: ATCCAGAGTGACGCAGCAGTTGCGGCAATAATTATACGTCATGAGTGATAGTTCCTGGACACGGTGGCTTAGT; Apt-3: ATCCAGAGTGACGCAGCAAGGCTTAATCCTGGGGGCGCGATAGGCTTATCTCGCTCTGGACACGGTGGCTTAGT.

7. The functional nucleic acid sensor for detecting brain natriuretic peptide (BNP) according to claim 1, characterized in that, It is prepared by the following method: (1) Preparation of the sample addition layer: Take a PET board and punch holes on the PET board as the blood sample addition hole and the glucose solution sample addition hole respectively. (2) Preparation of the blood treatment layer: Set up a whole blood separation membrane, allow the glucose solution to pass through the pores, and perform hydrophobic treatment on the remaining areas; (3) Preparation of the reaction layer: Take a filter paper and align the hydrophilic channel holes with the right end of the whole blood separation membrane, and align the glucose solution channel with the left end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area. The two areas are connected through hydrophilic channels. The remaining areas are treated with hydrophobicity; (4) Preparation of the water absorption channel layer: Take a filter paper, align the hydrophilic channel holes with the right end of the Apt@Cu x Ni y Co 3-x-y -MOF loading area, and set a foldable-unfoldable high-capacity water absorption pad on the right side of the channel holes. The remaining areas are treated with hydrophobicity; (5) Preparation of the interface layer of the embedded blood glucose meter test strip: Take a PET board, cut out a socket area that fits the size of the blood glucose meter test strip, and align the blood collection area of the blood glucose meter test strip with the channel hole.

Images