Aflatoxin (AFB1) liver injury prevention and treatment method based on tea polyphenol

Abstract

The invention relates to medical application of tea polyphenol, in particular to a tea polyphenol-based aflatoxin (AFB1) liver injury prevention and treatment method. Aiming at the problem that serious economic loss is often caused by AFB1 in livestock and poultry breeding, the invention firstly proposes that pure natural tea polyphenol is taken as a unique active component, and AFB1 poisoning is intervened by oral administration of a preparation. The invention shows that the tea polyphenol can effectively relieve the hepatotoxicity induced by the AFB1, provides a new strategy for application of natural components in prevention and treatment of the hepatotoxicity of the AFB1, and has the characteristics of safety, high efficiency and easiness in industrialization.

Description

Technical Field

[0001] The present invention relates to the technical field of the application of tea polyphenols, and particularly relates to an application of using tea polyphenols as the sole active ingredient in alleviating liver injury in mice caused by aflatoxin (AFB1). Background Art

[0002] Aflatoxins (AFTs) are highly toxic secondary metabolites produced by fungi such as Aspergillus flavus and Aspergillus parasiticus, which widely contaminate food crops and feeds and have extremely strong carcinogenic, mutagenic, and immunosuppressive effects. Among them, aflatoxin B1 (AFB1) has the strongest toxicity. It is mainly metabolized in the liver and can cause liver injury by inducing oxidative stress, inflammatory responses, and affecting the cell cycle. On the one hand, the metabolites of AFB1 can bind to biological macromolecules such as DNA, RNA, and proteins in liver cells, thereby interfering with the normal physiological functions of cells; on the other hand, AFB1 induces the body to produce a large number of free radicals, and the free radicals attack the cell membranes and mitochondria of liver cells, further damaging the structure and function of liver cells. Long-term intake of AFB1 can cause liver injury and may lead to serious diseases such as liver cancer. Existing treatment methods mostly rely on chemical drugs, but they have relatively large side effects and limited efficacy.

[0003] Tea polyphenols (TP), as a natural plant active ingredient, are important tea by-products in China. Tea polyphenols have the effects of antioxidation, anti-inflammation, antibacterial, and detoxification. There have been research reports on the role of tea polyphenols in the treatment of liver diseases. Most of these studies aim to prove the synergistic effect of tea polyphenols and other compounds or active substances in alleviating liver injury. However, the protective effect of tea polyphenols themselves on liver injury and their detoxification efficacy still need to be further studied. Exploring the prevention and treatment effects of tea polyphenols in AFB1-induced liver injury has important scientific research significance and application prospects. Summary of the Invention

[0004] The purpose of the present invention is to provide a new means for protecting livestock and poultry liver injury caused by AFB1, and provides an application of tea polyphenols as an antidote in liver injury caused by AFB1.

[0005] To achieve the above purpose, in the first aspect of the present invention, a tea polyphenol preparation is provided. The tea polyphenol preparation includes double-distilled water and tea polyphenols, wherein the concentration of the tea polyphenols is 50 mg / mL.

[0006] In the second aspect of the present invention, a method for constructing a mouse liver injury model using AFB1 is provided. The construction method of the liver injury model includes: mixing AFB1 with DMSO to form a 0.35 mg / mL solution, and gavage-feeding mice at a dose of 0.35 mg / kg body weight / day for 14 consecutive days.

[0007] In the third aspect of the present invention, there is provided the use of tea polyphenols in alleviating AFB1-induced liver injury in mice. The said use includes: constructing a mouse liver injury model using AFB1 as described above, and applying tea polyphenols for liver protection, specifically including: gavage-administering a tea polyphenol preparation and AFB1 to mice every day according to the body weight of the mice, with an interval of ≥2 hours between the two gavages, wherein the dose of tea polyphenols is 200 mg / kg body weight per day, and the dose of AFB1 is 0.35 mg / kg body weight per day, and continuously gavage-administering for 21 days.

[0008] Through the above technical solution, the tea polyphenol preparation of the present invention reduces the expression levels of inflammatory cytokines in the mouse liver and the levels of liver ALT, AST and ALP, and inhibits the necrosis of mouse stem cells, thereby reducing the liver injury of mice, and has a good protective effect on AFB1-induced liver injury in mice. The research results of the present invention provide a theoretical basis for the application of tea polyphenols in AFB1-induced liver injury, and help to break the dilemma of economic losses caused by aflatoxin that cannot be avoided in the current livestock and poultry breeding process. Description of the Drawings

[0009] Figure 1 For the body weights and liver indices of mice in each group of Example 1; Figure 2 For the morphological pictures of the livers of mice in each group of Example 1; Figure 3 For the serum liver function results of mice in each group of Example 1; Figure 4 For the IL-6 mRNA expression levels in the livers of mice in each group of Example 2; Figure 5 For the serum IL-6 levels of mice in each group of Example 2. Detailed Embodiments

[0010] The present invention discloses the use of an aqueous tea polyphenol solution in alleviating AFB1-induced liver injury. Those skilled in the art can draw on the content of this article and appropriately modify the technical parameters. It should be particularly noted that all similar substitutions and modifications are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. All other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the protection scope of the present invention.

[0011] The present invention provides an optimal tea polyphenol preparation, which is characterized in that the preparation includes distilled water and tea polyphenols, wherein the most preferred concentration of the tea polyphenols is 50 mg / mL.

[0012] According to the present invention, feeding the tea polyphenol preparation according to the body weight of animals can effectively protect against liver injury caused by AFB1, and the preferred dose is 200 mg / kg body weight per day.

[0013] In the following examples, Kunming white mice were purchased from Chengdu Dashuo Experimental Animal Co., Ltd.; tea polyphenols were purchased from Shanghai Jingke Chemical Technology Co., Ltd.; AFB1 was purchased from Qingdao Pribolab Bioengineering Co., Ltd.; ELISA detection kits were purchased from Wuhan Sanying Biotechnology Co., Ltd.; biochemical kits were purchased from Mindray Medical International Limited.

[0014] Example 1 Protective effect of tea polyphenols on AFB1-induced liver tissue injury 1. Establishment of animal model ① Nine male Kunming mice were selected and randomly divided into 3 groups, with 3 mice in each group. One group was the normal feeding group (Control group), and the remaining two groups were the model group (H2O + AFB1) and the experimental group (TP + AFB1); ② The experimental group was intragastrically administered with an aqueous solution of tea polyphenols at a dose of 200 mg / kg body weight every day. At the same time, the model group was intragastrically administered with an equal volume of double-distilled water for 1 week continuously; ③ Starting from the second week, in addition to intragastrically administering tea polyphenols and double-distilled water every day, the experimental group and the model group were intragastrically administered with 0.35 mg / kg body weight of AFB1 every day, with an interval of more than 2 hours between the two intragastric administrations; ④ When the experiment lasted for 3 weeks, all mice were weighed and then blood was collected from the eyeballs. The mouse serum was separated. After euthanasia, the mouse livers were taken out, weighed, and photographed morphologically. Subsequently, liver samples were collected and fixed in 4% paraformaldehyde. 2. Sample detection ① A fully automatic serum biochemical analyzer was used to measure liver function indexes such as alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) in the sera of mice in each group; ② The fixed liver samples of mice in each group were paraffin-embedded and sectioned, and then stained with H.E. to observe the liver tissue structure of mice; ③ GraphPad Prism 10 was used to analyze the data. The results were expressed as Mean ± SD. One-way ANOVA was used for comparison between groups. P <0.05 was regarded as a significant difference between groups 3. According to the above specific implementation process, the result analysis is as follows: ① The body weights and liver indexes of all mice were statistically analyzed. As Figure 1 shown, there were no significant differences in the body weights and liver indexes of mice among groups; ② As Figure 2As shown, macroscopically, the livers of mice in each group were smooth on the surface, without abnormal nodules, with a relatively soft texture, and no obvious enlargement in volume or bleeding points were observed; compared with the Control group, the livers of mice in the H2O+AFB1 group were yellowish in color. H.E. staining showed that the hepatocytes of mice in the Control group were arranged radially and neatly around the central portal vein, and no obvious pathological changes were seen; in the H2O+AFB1 group, the arrangement of hepatocytes was disordered, the cells were swollen and necrotic, glycogen was absent, and fat accumulation occurred; compared with the H2O+AFB1 group, the arrangement of hepatocytes in the TP+AFB1 group was neat, no inflammatory cells were seen, and the liver injury was significantly improved; ③ As Figure 3 shown, compared with the Control group, the AST level of mice in the H2O+AFB1 group was significantly increased; the ALT and AST levels in the TP+AFB1 group were both lower than those in the H2O+AFB1 group. In addition, the ALP level in the TP+AFB1 group was significantly lower than that in the H2O+AFB1 group. It is indicated that AFB1 can induce severe liver injury in mice, and tea polyphenols have an obvious protective effect on AFB1-induced hepatobiliary injury.

[0015] Example 2 Effect of tea polyphenols on AFB1-induced liver inflammation An AFB1-induced mouse liver injury model was constructed in the same way as in Example 1 to establish the animal model. The difference was that after the mice were euthanized in step ④, the liver tissues were collected and quickly frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80 °C. Subsequently, the IL-6 level in the mouse serum was detected by ELISA, and the mRNA expression level of IL-6 in the livers of mice in each group was detected by extracting liver RNA. Data analysis was carried out according to the method described in Example 1 1. Determination of inflammation-related indicators in the liver The primer sequences used were: m-IL-6-F: TACCACTTCACAAGTCGGAGGC m-IL-6-R: CTGCAAGTGCATCATCGTTGTTC As Figure 4 shown, the mRNA expression level of IL-6 in the livers of mice in the AFB1 group was significantly up-regulated, suggesting that AFB1 induces liver inflammation in mice, which in turn leads to liver injury; after TP intervention, the mRNA expression level of IL-6 was significantly down-regulated, indicating that tea polyphenols can relieve AFB1-induced liver inflammation; 2. Determination of inflammatory factor levels in mouse serum The mouse IL-6 double antibody sandwich ELISA detection kit was used to detect the IL-6 level in mouse serum. The results are as Figure 5As shown, the serum IL-6 level in the AFB1 group of mice was significantly higher than that in the Control group, indicating that AFB1 induced a systemic inflammatory response in mice; the serum IL-6 level in the TP+AFB1 group of mice was significantly lower than that in the H2O+AFB1 group, indicating that tea polyphenols significantly inhibited the systemic inflammation induced by AFB1; The above embodiments only express several optimal implementation modes of the present invention, and their descriptions are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent for the present invention. It should be noted that for those skilled in the art, without departing from the concept of the present invention, several deformations and improvements made all fall within the protection scope of the present invention. Therefore, the protection scope of the patent for the present invention shall be subject to the appended claims.

Claims

1. Use of tea polyphenols in alleviating AFB1-induced liver injury, with the intake dose of the tea polyphenol preparation ≤ 200 mg / kg body weight / day.

2. The tea polyphenol preparation according to claim 1, characterized in that, The tea polyphenols are dissolved in double-distilled water.

3. The tea polyphenol preparation according to claim 1 or 2, wherein, The optimal concentration of the tea polyphenol preparation is 50 mg / mL.

4. The tea polyphenol preparation according to claim 1 or 2 or 3, the dosage form thereof includes but is not limited to water-soluble preparations.

5. The AFB1-induced liver injury according to claim 1, wherein, Liver injury includes hepatitis, fatty liver, and liver cirrhosis.

6. The application according to claim 1 or 5, the liver injury model is induced by AFB1.

7. The liver injury according to claim 1 or 5 or 6, wherein, The inducer is prepared from AFB1 and DMSO.

8. The AFB1-induced liver injury according to claim 1 or 5 or 6 or 7, wherein, The optimal concentration of the AFB1 inducer concentration is 0.35 mg / mL.

9. The AFB1-induced liver injury according to claim 1 or 8, characterized in that, The dosage form of the inducer includes but is not limited to oral preparations.

10. The liver injury inducer according to claim 1 or 8, characterized in that, The daily intake dose of the inducer is 0.35 mg to 0.5 mg per kg body weight.

Images