MdNUDT17 gene for regulating and controlling size of apple fruit and application of MdNUDT17 gene

Abstract

The invention provides an MdNUDT17 gene for regulating and controlling the size of an apple fruit, the nucleotide sequence of the MdNUDT17 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of an encoded protein is as shown in SEQ ID NO. 2. By constructing an overexpression vector MdNUDT17-OE and a silence vector MdNUDT17-AN of the MdNUDT17, it is proved that overexpression of the MdNUDT17 gene significantly reduces the size of the fruit, and silence of the MdNUDT17 gene significantly increases the size of the fruit, and the MdNUDT17 gene can be used for apple or tomato fruit size regulation and control and fruit size character related molecular breeding. The invention further provides an MdNUDT17 gene promoter, the size of the apple fruit can be detected by utilizing SNP differential sites of the promoter, the breeding process can be accelerated, and the promoter has important application value for apple breeding development.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological breeding, and particularly relates to an MdNUDT17 gene for regulating apple fruit size and its application. Background Art

[0002] Apples belong to the genus Malus of the Rosaceae family. They are a kind of fruit rich in nutrition, containing a variety of vitamins, pectin, sugars, dietary fiber, etc., and are fruits beneficial to human health. China ranks first in the world in terms of apple production and planting area. Fruit size, as an important economic trait, has an important impact on the price of apples. Generally, the larger the apple fruit, the higher the price. Cold-region apples are cultivated in northern regions with an average annual temperature below 7.8°C. Due to the cold climate characteristics of this region, in the breeding process, one of the parents in the selection of hybridization combinations should have cold tolerance. Since cold-region apples have cold-tolerance genes of small apples such as Chinese flowering crabapple and Siberian crabapple, and coupled with the genetic tendency of fruit size towards small-fruited varieties, it is relatively difficult to obtain excellent lines with large fruit size in cold-region fruit tree breeding. In addition, apples are perennial crops, and it generally takes 5 - 8 years from breeding to fruiting. Therefore, usually, it takes 15 - 20 years to breed an apple variety. Genetic engineering, as an important technical means, is a convenient and effective way that can accurately improve crop traits and accelerate the breeding process. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide an MdNUDT17 gene for regulating apple fruit size and its application in view of the deficiencies of the above-mentioned prior art. Overexpression of the MdNUDT17 gene in the horticultural crop model plant tomato significantly reduces tomato fruit size, and overexpression and silencing of the MdNUDT17 gene in apples significantly reduce and increase apple fruit size, respectively.

[0004] To solve the above technical problem, the technical solution adopted by the present invention is: an MdNUDT17 gene for regulating apple fruit size, the nucleotide sequence of the MdNUDT17 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2.

[0005] The present invention also provides an application of the MdNUDT17 gene for regulating plant fruit size. Preferably, the plant is an apple or a tomato.

[0006] Preferably, overexpression of the MdNUDT gene significantly reduces the transverse diameter, longitudinal diameter and single fruit weight of apple fruits, while silencing of the MdNUDT17 gene significantly increases the transverse diameter, longitudinal diameter and single fruit weight of apple fruits.

[0007] Preferably, overexpression of the MdNUDT17 gene significantly reduces tomato fruit size.

[0008] The present invention also provides another application of the MdNUDT17 gene, which is used for molecular breeding related to plant fruit size traits. Preferably, the plant is apple or tomato.

[0009] The present invention also provides the promoter of the MdNUDT17 gene. The MdNUDT17 gene promoter sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, and there is one SNP difference between them.

[0010] The present invention also provides a method for detecting the size of apple fruits. The method is as follows: detecting the size of apple fruits by using the SNP difference site of the promoter of the reporter gene MdNUDT17. The nucleotide of the 114th SNP mutation site in the small fruit variety is C, and the nucleotide of the 114th SNP mutation site in the large fruit variety is T.

[0011] Due to the adoption of the above technical solutions, the present invention has remarkable technical effects:

[0012] 1. The present invention provides an MdNUDT17 gene for regulating the size of apple fruits. By constructing an overexpression vector MdNUDT17-OE and a silencing vector MdNUDT17-AN of MdNUDT17, it is proved that overexpression of the MdNUDT17 gene significantly reduces the size of apple fruits, while silencing of the MdNUDT17 gene significantly increases the size of apple fruits. It can be used for regulating the size of apple fruits and molecular breeding related to apple fruit size traits, which is beneficial to accelerating the breeding process and has important application value for the development of apple breeding.

[0013] 2. The present invention also provides the promoter of the MdNUDT17 gene, and the SNP difference of the promoter can be used to detect the size of apple fruits.

[0014] 3. Genetic transformation of the overexpression vector MdNUDT17-OE of MdNUDT17 in tomatoes proves that overexpression of the MdNUDT17 gene in tomatoes significantly reduces the size of tomato fruits.

[0015] The present invention will be further described in detail below with reference to the drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the acquisition and expression analysis of the MdNUDT17 gene in Example 1 of the present invention. Among them, A: Phenotypes of Longfeng (LF) and Longshuo (GLF) apples during the development process, B: Relative expression levels of the MdNUDT17 gene during the fruit development process of Longfeng and Longshuo apples;

[0017] Figure 2It is the verification of the function of the MdNUDT17 gene in apples in Example 3 of the present invention. Among them, A: The relative expression levels of MdNUDT17 in fruits overexpressing the MdNUDT17 gene (MdNUDT17-OE) in Longshuo (GLF) apples and silencing the MdNUDT17 gene (MdNUDT17-AN) in Longfeng (LF) apples; B: Analysis of the transverse diameter, longitudinal diameter and single fruit weight of fruits overexpressing the MdNUDT17 gene (MdNUDT17-OE) in Longshuo (GLF) apples and silencing the MdNUDT17 gene (MdNUDT17-AN) in Longfeng (LF) apples.

[0018] Figure 3 It is the verification of the function of the MdNUDT17 gene in tomatoes in Example 5 of the present invention. Among them, A: Analysis of the fruit phenotypes and MdNUDT17 gene expression levels of tomatoes overexpressing the MdNUDT17 gene (MdNUDT17-OE) and wild-type (WT) fruits; B: Analysis of the single fruit weight of tomatoes overexpressing the MdNUDT17 gene and WT fruits; C: Analysis of the transverse diameter of tomatoes overexpressing the MdNUDT17 gene and WT fruits; D: Analysis of the longitudinal diameter of tomatoes overexpressing the MdNUDT17 gene and WT fruits. Detailed implementation manners

[0019] Example 1

[0020] This example is about the acquisition and identification of the MdNUDT17 gene

[0021] Through genome resequencing and transcriptome analysis of Longfeng (LF) and its large-fruit bud sport Longshuo (GLF), the differentially expressed MdNUDT17 gene was found.

[0022] By fluorescence quantitative PCR (qRT-PCR), the relative expression levels of the MdNUDT17 gene during the fruit development of Longfeng (LF) and Longshuo (GLF) apples were analyzed. The detection method is as follows: Using MdNUDT17 as the reporter gene, fluorescence quantitative PCR was used to analyze the expression level of the MdNUDT17 gene in apple fruits, and MdAction was selected as the internal reference gene to calculate the relative gene expression levels. The specific steps are as follows:

[0023] (1) RNA extraction and reverse transcription

[0024] RNA was extracted from apple fruits using the CTAB method. 0.2 g of the fruit sample ground in liquid nitrogen was placed in a 2 mL centrifuge tube. 600 μL of 4% CTAB (10 mL of 1 M Tris-HCl buffer, 8.182 g of NaCl, 2 g of CTAB, 4 mL of EDTA) was added to the centrifuge tube, and then 20 μL of β-mercaptoethanol was added. The centrifuge tube was placed in a water bath at 65 °C and heated for 20 min. 600 μL of isoamyl alcohol and chloroform (1:24) was added to the centrifuge tube, and the centrifuge was centrifuged at 12000 rpm and 4 °C for 10 min; after the supernatant was aspirated, an equal volume of isoamyl alcohol and chloroform (1:24) was added, and the centrifuge was centrifuged at 12000 rpm and 4 °C for 10 min; the supernatant was aspirated and 1 / 4 volume of LiCl was added, and it was left standing at -20 °C for 12 h; after taking it out, the centrifuge was centrifuged at 12000 rpm and 4 °C for 15 min; the liquid was removed, 600 μL of 75% ethanol was placed in the centrifuge tube, and after thorough mixing, the centrifuge was centrifuged at 12000 rpm and 4 °C for 10 min; the supernatant was removed, 600 μL of absolute ethanol was placed in the centrifuge tube, and after thorough mixing, the centrifuge was centrifuged at 12000 rpm and 4 °C for 10 min; the supernatant was removed, and the centrifuge tube was placed on ice for 2 min to allow the alcohol to volatilize. 10 μL of DEPC water with a concentration of 1 g / L was added to the centrifuge tube to dissolve the RNA, and the RNA concentration was measured using NanoDrop2000. 1 μg of RNA was reverse transcribed into cDNA using the M-MLV RTase cDNA Synthesis kit (D6130; TaKaRa, Shiga, Japan), and the operation was carried out according to the instructions.

[0025] (2) Fluorescent quantitative PCR reaction

[0026] Primers for gene expression were designed online using NCBI's Primer-BLAST. The primers for fluorescent quantitative PCR analysis were as follows:

[0027] Table 1 Names and sequences of primers for fluorescent quantitative PCR

[0028] Primer Name Primer (5'-3') MdNUDT17-F CGGCAAGTCGTAGGGTGAA MdNUDT17-R GAAGTCAATCGTCGGAGCAATA MdActin-F GGCTGGATTTGCTGGTGATG MdActin-R TGCTCACTATGCCGTGCTCA

[0029] The reaction system for fluorescent quantitative PCR was 10 μL. The SYBR Green qPCR Master Mix enzyme used was purchased from Beijing TransGen Biotech Co., Ltd:

[0030] Table 2 Reaction system for fluorescent quantitative PCR

[0031] Reaction System Volume (μL) SYBRgreen master mix 5 Forward Primer 0.5 Reverse Primer 0.5 cDNA 0.5 <![CDATA[ddH2O]]> 3.5 Total 10

[0032] The reaction procedure for fluorescent quantitative PCR was as follows:

[0033] Table 3 Fluorescent quantitative PCR reaction program

[0034]

[0035] Figure 1 A is the phenotypic characteristics of Longfeng (LF) and Longshuojinguan (GLF) apples during the development process Figure 1 B is the relative expression level of the MdNUDT17 gene during the fruit development of Longfeng (LF) and Longshuojinguan (GLF) apples. ** indicates extremely significant differences (p < 0.01), and the error bars represent the standard deviation (SD) of three biological replicates. It was found that the expression level of the MdNUDT17 gene during the development of Longshuojinguan and Longfeng apples was significantly lower in Longshuojinguan than in Longfeng apples, and the trend was opposite to the fruit difference, indicating that the MdNUDT17 gene may negatively regulate apple fruit size.

[0036] Example 2

[0037] This example is about the cloning of the MdNUDT17 gene

[0038] 1. Primer design for the MdNUDT17 gene

[0039] Total RNA was extracted from apple fruits and reverse transcribed into cDNA using a reverse transcription kit. According to the apple reference genome, the full-length primers for amplifying MdNUDT17 were designed using Primer Premier 6 software as follows

[0040] Table 4 Nucleotide primer names and sequences of MdNUDT17

[0041] Primer Name Primer (5'-3') MdNUDT17-w-F ATGATGACTTGTTTAGTTTCTCGGA MdNUDT17-w-R TTAATTGAAAGAACAAGCCAGTACA

[0042] 2. PCR reaction

[0043] The PCR reaction system was 50 μL, as shown in Table 5

[0044] Table 5 PCR reaction system

[0045]

[0046] The PCR reaction program was as follows

[0047] Table 6 PCR reaction program

[0048]

[0049] After the reaction, 0.5 μL of r Tap and 3 μL of dNTP Mixture were added to the product, and it was placed in a 72 °C metal bath for 20 min. Agarose gel electrophoresis was used to analyze the amplified fragments

[0050] (3) Purification and transformation of PCR products

[0051] Using a PCR product purification kit (EG101-01, TransGen Biotech, Beijing), the full-length fragment product of the above-mentioned MdNUDT17 gene was purified and ligated into the pEASY-T1 vector (Transgen Biotech, Beijing). After transformation into Escherichia coli, colony PCR was performed. After culturing the positive colonies in liquid medium, sequencing was carried out by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), and the full-length sequence of the MdNUDT17 gene was obtained as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein was as shown in SEQ ID NO.2.

[0052] Example 3

[0053] This example was to construct overexpression and silencing vectors of the MdNUDT17 gene and study the application of the MdNUDT17 gene in regulating apple fruit size.

[0054] 1. Construction of overexpression vector

[0055] The full-length fragment of the cloned MdNUDT17 gene was ligated into the pRI101 (driven by the 35S promoter) vector containing NdeI and SacI restriction endonuclease sites using a seamless cloning kit (cat.no.D7010M, Beyotime, Shanghai) according to the instructions, and the overexpression vector MdNUDT17-OE of the MdNUDT17 gene was obtained.

[0056] 2. Construction of silencing vector

[0057] The silencing vector was obtained by reverse ligation. The full-length fragment of the cloned MdNUDT17 gene was ligated into the pRI101 (driven by the 35S promoter) vector containing SacI and NdeI restriction endonuclease sites using a seamless cloning kit (cat.no.D7010M, Beyotime, Shanghai) according to the instructions, and the silencing vector MdNUDT17-AN of the MdNUDT17 gene was obtained.

[0058] The primers used for the construction of the overexpression and silencing vectors are shown in Table 7.

[0059] Table 7 Primer names and sequences

[0060]

[0061]

[0062] 3. Regulation of apple fruit size by the MdNUDT17 gene

[0063] The overexpression vector MdNUDT17-OE and the silencing vector MdNUDT17-AN of the MdNUDT17 gene were respectively transformed into Agrobacterium, with the empty vector as a control, and spread on YEP solid medium (containing Rif 50 μg / mL -1 and Kana 50 μg / mL -1 ), and cultured in an incubator at 28 °C for 2-3 days. After the strains grew, the positive monoclonal colonies were dissolved in 5 mL of YEP liquid medium (containing 50 μg / mL -1 Kana and 50 μg / mL -1 Rif), cultured overnight at 28 °C with 200 rpm for 12 h. 100 μL of the bacteria was taken and transferred into 50 mL of YEP liquid medium (Rif concentration 50 μg / mL -1 ), cultured at 28 °C. When the OD 600 of the bacterial liquid reached 0.8, it was centrifuged at 7000 rpm for 5 min at 4 °C, and the supernatant was removed. The bacteria were resuspended with 5 mL of H2O, then the centrifuge tube was placed in a centrifuge at 7000 rpm for 5 min at 4 °C, and the supernatant was removed. Injection suspension for injection was added [1 mL of 1 M MgCl2, 1 mL of 1 M MES, and 100 μL of 100 mM acetosyringone were added to every 100 mL] until the OD 600 reached 0.8. The apple fruits were injected 30 days after full bloom. The MdNUDT17 gene (MdNUDT17-OE) was overexpressed in Longshuo (GLF) apples, and the MdNUDT17 gene (MdNUDT17-AN) was silenced in Longfeng (LF) apples. After 25 days, quantitative real-time PCR (qRT-PCR) was used to detect the relative expression levels of MdNUDT17 in the fruits with silenced and overexpressed MdNUDT17 genes, and indexes such as fruit transverse diameter, longitudinal diameter, and single fruit weight were investigated.

[0064] Figure 2This is the functional verification of the MdNUDT17 gene in apple. Figure A shows the relative expression level of MdNUDT17 in fruits of Longshuo (GLF) apple overexpressing the MdNUDT17 gene (MdNUDT17-OE) and Longfeng (LF) apple silencing the MdNUDT17 gene (MdNUDT17-AN). Figure B shows the transverse diameter, longitudinal diameter, and single fruit weight of fruits of Longshuo (GLF) apple overexpressing the MdNUDT17 gene (MdNUDT17-OE) and Longfeng (LF) apple silencing the MdNUDT17 gene (MdNUDT17-AN) 25 days after injection, measured using a digital vernier caliper and an electronic balance. Bar = 10 mm, Empty Vector: pRI101 empty control, ** indicates extremely significant difference (p<0.01), error bars are standard deviations (SD) of 10 biological replicates. The results showed that overexpression of the MdNUDT17 gene significantly reduced apple fruit size, while silencing of the MdNUDT17 gene significantly increased apple fruit size.

[0065] Example 4

[0066] This example is an expression analysis of the MdNUDT17 gene in different apples.

[0067] The apple varieties with different fruit sizes used in the present invention were collected from the Liaoning Fruit Science Research Institute and Shenyang Agricultural University in Xiongyue Town, Yingkou City, Liaoning Province, as shown in the following table:

[0068] Table 8 Apple germplasm resources

[0069] Number Name of Small Fruit Variety Number Name of Big Fruit Variety 1 Jinhong 1 Wangshanhong 2 Otome 2 Yuehua 3 Red Bell 3 Golden Delicious 4 Saiwaihong 4 Yueguan 5 Longguan 5 Yueshuai 6 Jinping 6 Orin

[0070] To clarify the presence of the MdNUDT17 gene promoter in natural populations, the MdNUDT17 gene promoters of six large-fruited apple varieties (Wangshanhong, Yuehua, Jinguan, Yueguan, Yueshuai, and Wanglin) and six small-fruited apple varieties (Jinhong, Yinu, Honglingdang, Saiwaihong, Longguan, and Jinping) were cloned using the following methods:

[0071] (1) MdNUDT17 promoter primer design

[0072] The MdNUDT17 promoter sequence was found from the apple genome (https: / / iris.angers.inra.fr / gddh13 / ) and promoter primers were designed using Primer Premier 6 as follows:

[0073] Table 9: Names and sequences of primers encoding the MdNUDT17 promoter

[0074] Primer Name Primer (5'-3') MdMdNUDT17-pro-F TTCTCTACGGCTCAACCTACTC MdMdNUDT17-pro-R GCCCATGTTGTACCTCTGCA

[0075] (2) PCR reaction

[0076] The PCR reaction system was the same as that in Table 5, and the reaction program was the same as that in Table 6. After the reaction, 0.5 μL of r Tap and 3 μL of dNTP Mixture were added to the product, and it was placed in a 72 °C metal bath for 20 min. Agarose gel electrophoresis was used to analyze the amplified fragments.

[0077] (3) Purification and transformation of PCR products

[0078] The MdNUDT17 promoter product was purified using a PCR product purification kit (EG101 - 01, TransGen Biotech, Beijing) and ligated to the pEASY - T1 vector (Transgen Biotech, Beijing). After transformation into Escherichia coli, colony PCR was performed. After culturing the positive colonies in liquid medium, they were sequenced by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), and two MdNUDT17 promoter sequences were obtained, shown as SEQ ID NO.3 and SEQ ID NO.4 respectively, with 1870 bp. The DNAMAN software was used for sequence alignment to verify the sequence differences. The results showed that the nucleotide at the 114th SNP mutation site of the 6 small - fruit varieties was C (SEQ ID NO.3), and the nucleotide at the 114th SNP mutation site of the 6 large - fruit varieties was T (SEQ ID NO.4). There was one SNP difference between them, indicating that the SNP difference sites of the MdNUDT17 promoter can be used to distinguish the apple fruit size and achieve the identification of different fruit size resources, which has important application value for the development of apple breeding.

[0079] Example 5

[0080] This example was about the application of the MdNUDT17 gene in regulating tomato fruit size.

[0081] The over - expression vector MdNUDT17 - OE of the MdNUDT17 gene was transformed into the Agrobacterium tumefaciens strain LBA4404 for genetic transformation in tomatoes, with the wild - type as the control (WT). The AC tomato leaves were immersed in MS liquid medium for 5 min, taken out and the liquid on the leaf surface was blotted dry with sterile filter paper. The leaves were placed in the co - culture medium and cultured at 25 °C for 2 d. Then the leaves were transferred from the co - culture medium to the screening and differentiation medium and cultured at 25 °C until new buds grew from the leaf callus. When the plants grew to 2 - 3 cm, the newly grown stems were transferred to the rooting medium and cultured at 25 °C until roots grew. After the plant roots were well - developed, they were transferred to pots until the fruits matured. The RNA of tomato fruits was extracted, reverse - transcribed into cDNA, and the expression level of MdNUDT17 in tomato fruits was analyzed by qRT - PCR, and the fruit transverse diameter, longitudinal diameter, single - fruit weight and other indexes were investigated.

[0082] Figure 3 For the functional verification of the MdNUDT17 gene in tomatoes, where A is the analysis of the phenotypic and MdNUDT17 gene expression levels of tomato fruits overexpressing the MdNUDT17 gene (MdNUDT17-OE) and control WT fruits, B is the analysis of the single fruit weight of tomato fruits overexpressing the MdNUDT17 gene and control WT fruits, C is the analysis of the transverse diameter of tomato fruits overexpressing the MdNUDT17 gene and control WT fruits, D is the analysis of the longitudinal diameter of tomato fruits overexpressing the MdNUDT17 gene and control WT fruits. The error bars represent the standard deviation (SD) of 3 biological replicates, and ** indicates extremely significant differences (p < 0.01). The results showed that the transverse diameter, longitudinal diameter, and single fruit weight of tomato fruits overexpressing the MdNUDT17 gene were all smaller than those of the wild type, indicating that MdNUDT17 negatively regulates tomato fruit size.

[0083] The present invention provides an MdNUDT17 gene for regulating apple fruit size, which can be used for regulating apple or tomato fruit size and molecular breeding related to fruit size traits, facilitating the acceleration of the breeding process. The present invention also provides the promoter of the MdNUDT17 gene. The SNP differential sites of the promoter can be used to distinguish fruit size and achieve the identification of plant fruit size resources, which has important application value for the development of plant breeding.

[0084] The above are only the preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent variations made to the above embodiments based on the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. An MdNUDT17 gene for regulating apple fruit size, characterized in that, The nucleotide sequence of the MdNUDT17 gene is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.

2.

2. Use of the MdNUDT17 gene according to claim 1, characterized in that, The MdNUDT17 gene is used to regulate the size of plant fruits.

3. The application according to claim 2, characterized in that, The plants are apples and tomatoes.

4. The application according to claim 3, characterized in that, Overexpression of the MdNUDT17 gene significantly reduced the transverse diameter, longitudinal diameter and single fruit weight of apple fruits, while silencing the MdNUDT17 gene significantly increased the transverse diameter, longitudinal diameter and single fruit weight of apple fruits.

5. The application according to claim 3, characterized in that, Overexpression of the MdNUDT17 gene significantly reduced the size of tomato fruits.

6. Use of the MdNUDT17 gene according to claim 1, characterized in that The MdNUDT17 gene is used for molecular breeding related to the trait of plant fruit size.

7. The application according to claim 6, characterized in that, The plants are apples and tomatoes.

8. The promoter of the MdNUDT17 gene, characterized in that, The promoter sequences of the MdNUDT17 gene are shown as SEQ ID NO.3 and SEQ ID NO.4, and there is one SNP difference between them.

9. A method for detecting the size of apple fruits, characterized in that, The SNP difference site of the promoter of the reporter gene MdNUDT17 was used to detect the size of apple fruits. The nucleotide at the 114th SNP mutation site of the small fruit variety was C, and the nucleotide at the 114th SNP mutation site of the large fruit variety was T.

Images