Tomato leaf miner granulosis virus strain and application thereof

Abstract

The invention discloses a tomato leaf miner granulosis virus strain and application, the tomato leaf miner granulosis virus strain with tomato leaf miner larva killing activity is obtained by separating and screening, and the tomato leaf miner granulosis virus strain is produced by feeding potato tuber moth with artificial feed. The insecticidal preparation prepared from chlorogenic acid is added, so that the control effect is improved, and a new strategy is provided for controlling agricultural pests such as tomato leaf miner and potato tuber moth.

Description

Technical Field

[0001] The present invention relates to the technical field of pest control, and specifically relates to a Phthorimaea absoluta granulovirus strain and its application. Background Art

[0002] The tomato leafminer (Phthorimaea absoluta), belonging to the Gelechiidae family of Lepidoptera, is also known as the tomato gelechiid or tomato leafminer. It has become an important worldwide pest of tomatoes, posing a serious threat to the healthy development of the global tomato industry.

[0003] The potato tuber moth (Phthorimaea operculella Zeller), also known as the potato gelechiid, tobacco leafminer, etc.; belonging to the Gelechiidae family of Lepidoptera, mainly damages solanaceous plants, among which potatoes, tobacco, eggplants, etc. are the most severely damaged, followed by peppers and tomatoes. The larvae mine the leaf mesophyll, and when severe, the young stems and leaf buds are often damaged and withered, and even the young plants may die. In the field and during storage, the larvae bore into potato tubers, forming curved tunnels, and when severe, they eat up the entire tuber, causing the appearance to shrink and rot.

[0004] It is extremely urgent to further develop the green prevention and control technologies for the tomato leafminer and the potato tuber moth.

[0005] Insect baculoviruses have the characteristics of high insecticidal activity, pests are not easily resistant, and can cause population epidemics in pests, and are a type of biological pesticide with distinct characteristics.

[0006] Therefore, finding an insect baculovirus that can efficiently kill the tomato leafminer and the potato tuber moth has great application prospects in the biological control of the tomato leafminer and the potato tuber moth pests. Summary of the Invention

[0007] The present invention obtains a Phthorimaea absoluta granulovirus strain with the activity of killing Phthorimaea absoluta larvae through isolation and screening, produces Phthorimaea absoluta granulovirus by artificially feeding the potato tuber moth, and adds an insecticidal preparation containing chlorogenic acid to improve the control effect, providing a new strategy for controlling the agricultural pests Phthorimaea absoluta and the potato tuber moth.

[0008] In view of this, the solution of the present invention is as follows:

[0009] The first aspect of the present invention is to propose a Phthorimaea absoluta granulovirus strain (Phthorimaea absoluta granulovirus Ningxia), which is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: V202518, and the preservation date is February 21, 2025.

[0010] The second aspect of the present invention lies in providing the application of the tomato leafminer granulovirus strain described in the first aspect in killing tomato leafminers and / or potato tuber moths.

[0011] The third aspect of the present invention lies in providing a method for proliferating tomato leafminer granulovirus, which includes infecting potato tuber moths with the tomato leafminer granulovirus strain described in the first aspect and the step of extracting the virus, and the potato tuber moths are reared using potato tubers and / or artificial feed.

[0012] Furthermore, the artificial feed is made from the following raw materials in parts by weight: 50 parts of cellulose, 15 parts of casein lactate, 15 parts of wheat germ powder, 3 parts of Wesson salt, 5 parts of soybean powder, 14 parts of agar, 10 parts of sucrose, 2 parts of glucose, 0.5 part of cholesterol, 1 part of methyl p-hydroxybenzoate, 1 part of linoleic acid, 2 parts of soybean oil, 10 parts of compound vitamin B solution, 200 parts of potato homogenate, and 400 parts of distilled water.

[0013] The fourth aspect of the present invention lies in providing a virus insecticide, which includes the tomato leafminer granulovirus strain described in the first aspect or the virus obtained by the proliferation method described in the second aspect, and chlorogenic acid.

[0014] Furthermore, the addition amount of chlorogenic acid is 0.5 - 2 wt% of the virus insecticide, preferably 1 - 2 wt%, more preferably 1 wt%.

[0015] Furthermore, the concentration of the tomato leafminer granulovirus strain is 1×10 4 - 1×10 11 OB / mL.

[0016] Furthermore, the virus insecticide further includes at least one of an emulsifier, a spreading agent, a light protection agent, and a feeding attractant.

[0017] Preferably, the emulsifier is emulsifier 700#; the spreading agent is methyl soyate; the light protection agent is lignosulfonate; the feeding attractant is at least one of fructooligosaccharide and stevioside.

[0018] The fourth aspect of the present invention lies in providing a method for killing pests, which includes the step of spraying the virus insecticide described in the third aspect on the affected area; the affected area is infested with tomato leafminers and / or potato tuber moths.

[0019] Furthermore, the affected area is a storage area or a farmland. Preferably, the storage area or the farmland stores or grows agricultural products or crops such as tomatoes, potatoes, tobacco, eggplants, and peppers.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The tomato leafminer granulovirus strain (Phthorimaea absoluta granulovirus Ningxia) provided by the present invention has a deposit number of CCTCC NO: V202518. It has been verified that it has killing activity against potato tuber moth and tomato leafminer, and has great application prospects in related pest biological control.

[0022] The invention amplifies the tomato leafminer granulovirus strain by feeding potato tuber moths with artificial feed or potato tubers, and can be used for mass preparation of tomato leafminer granulovirus with high efficiency and high yield.

[0023] Some Solanaceae plants, such as potatoes and tomatoes, will produce oxygen free radicals (ROS) when subjected to various environmental stresses, such as high temperature, drought, UV-B radiation, and salt stress. ROS will inactivate the granulovirus applied to the plant surface, reducing the effectiveness of viral insecticides. Acidic substances such as chlorogenic acid have a good antioxidant effect. In the inclusion body composed of the protein lattice of the virion of the baculovirus, the inclusion body will only dissolve in an alkaline environment and release infectious virus particles, but it has a strong resistance to acid. After adding chlorogenic acid to the tomato leafminer granulovirus preparation of the present invention, its control effect is significantly improved compared to that without adding chlorogenic acid. The tomato leafminer granulovirus and chlorogenic acid synergistically improve the killing activity, providing a new strategy for the control of potato tuber moth and tomato leafminer. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of dead tomato leafminers found in Example 1 of the present invention.

[0025] Figure 2 These are scanning electron micrographs of suspected virus-killed tomato leafminer larvae and isolated granulovirus in Example 1 of the present invention.

[0026] Figure 3 This is the PCR product identification result of the dbp and me53 genes of the virus sample in Example 1 of the present invention.

[0027] Figure 4 Schematic diagram of the molecular evolutionary relationship between PhabGV-Ningxia and other potato tuber moth granuloviruses in Example 1 of the present invention.

[0028] Figure 5 These are the potato tuber moth larvae reared on potato tubers and artificial feed in Example 2 of the present invention.

[0029] Figure 6 Schematic diagram of healthy potato tuber moth larvae (left) and virus-infected larvae (right) in Example 2 of the present invention. DETAILED DESCRIPTION

[0030] The technical solutions of the present invention will be clearly and completely described below in conjunction with preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0031] Example 1 Isolation of the virus

[0032] Tomato leafminer larvae were collected from Wuzhong County, Ningxia Hui Autonomous Region, and some were suspected of dying from virus infection ( Figure 1 ). The virus was isolated from them and showed as a typical granulovirus under the electron microscope ( Figure 2 ). This virus was named Phthorimaea absoluta granulovirus Ningxia strain (PhabGV-Ningxia). The DNA of the virus sample was extracted, and specific primers of the lef-8 gene and lef-9 gene of Phthorimaea operculella granulovirus were used for PCR amplification. The results showed that the sizes were about 800 bp and 600 bp respectively ( Figure 3 ). The PCR products were sequenced, and the sequence identities of the lef-8 and lef-9 genes with the corresponding sequences of Phthorimaea operculella granulovirus isolate SA (KU666536.1) published in GenBank were 98.6% and 96.6% respectively.

[0033] PhopGV-Ningxia lef-8 gene sequence (SEQ ID NO: 1): (98.6% identity with the South African strain)

[0034] GTTTTCGGTTGGATATCCGTGACCAGAGTCCACAAATCAAACATGCGGTCGTTACAGTAGATTGATTCATCGACGAGCACACTGTTTCCCACCGGTAGCAAATTACCGCTTTCTCCGGTGTGACGTACAACCATGCCGTTTTTTAGATTGGTCAGACTGACAATCAATTTGGCCACAGGAATCGTGTTGAAAATGTGCAAATGGTTGCGATAATATTCCAGAATCATGGTCGACATGAGTTGACAGGTGGTGTTGTTTTCTTCAAAAATCAACGCAGGATCCGTGTTCACCAAACTGTTTTCGTTGTGATATTCGAACGGTGTTTGCAACGTGTTTATTCGCACATTATTGTCGATACACTCGTTGTGATATTCGAACGGTGTTTGCAACGTGTTTATTCGCACATTATTGTCGATACACACAACTCGTTTCAGCATGATCATGCCTTCGTGATGATTGACAAAAAGGATGCCGTTGCTAACTTTGATTTCGATCGGTGATTGGCGCCGTTTTAAAGTGTAATATACCGTGTACAAATTGTCTCGATTACAATAAAACTTGGTGGGACGATTGTTGAAAGCTACCATCAAATCATCACAATTTGTGTGAAAAACACCATTATCAATAAGCTGAGTAAACAATTGAGCAGACAGTTTGTAATCGACATTAGGCAACAGCGTGTTGTGACACAAAGGTTATTCCTTACTCGCCGTGGTCATTTC

[0035] PhopGV-Ningxia lef-9基因序列(SEQ ID NO:2):(与南非株一致性96.6%)

[0036] GGTCCAGTATTTGTATACGACCTTTTTG-ATACCAGTAGTTTTTACGCAAACGTGCTTTGTTTGAACGGTGCGAACGAAATTGTGCCACCTCAAATGAGCATAGACAGATATTACGGTAGACGTGTAGATAATGTGCGCGTATGGAA

[0037] The complete genome sequence of PhabGV-Ningxia was sequenced and subjected to molecular evolutionary analysis with baculovirus genomes in the NCBI gene bank. It was found to be related to Phthorimaea operculella granulovirus but in an independent branch ( Figure 4 ). The Phthorimaea absoluta granulovirus Ningxia strain (PhabGV-Ningxia) was deposited at the China Center for Type Culture Collection on February 21, 2025, with the deposit number CCTCC NO: V202518.

[0038] Example 2 Proliferation of PhabGV-Ningxia

[0039] 1. An indoor rearing population of Phthorimaea operculella was introduced from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences. The complete generation of Phthorimaea operculella was artificially reared indoors based on potato tubers and artificial diet, and at the same time, Phthorimaea operculella was reared with fresh potato tubers as a control ( Figure 5 ). The artificial diet (refer to patent document CN117223804A) was made from the following raw materials in parts by weight: 50 parts of cellulose, 15 parts of casein lactate, 15 parts of wheat germ powder, 3 parts of Wesson salt, 5 parts of soybean powder, 14 parts of agar, 10 parts of sucrose, 2 parts of glucose, 0.5 part of cholesterol, 1 part of methyl p-hydroxybenzoate, 1 part of linoleic acid, 2 parts of soybean oil, 10 parts of compound vitamin B solution, 200 parts of potato homogenate, and 400 parts of distilled water.

[0040] 2. Amplify PhabGV using Phthorimaea operculella: Immerse the gauze with Phthorimaea operculella eggs in a 1×10 7 OB / mL PhabGV suspension containing 0.1% Tween 80. After 10 minutes, take it out and dry it in the shade, then place it in a biochemical incubator at 28 ± 2 °C. After the larvae hatch, transfer them to potato tubers cut into about 1 cm thick or artificial diet with a brush. After 5 days, check the potato tubers or artificial diet every day. Healthy Phthorimaea operculella larvae are softer and pink; infected larvae are stiff and milky white ( Figure 6 ). Infect 50 larvae per batch, with a total of 3 batches. Homogenize the virus from each batch, filter out the residue with a 300-mesh nylon net, and count the number of virus granulocytes in the filtrate after diluting it to an appropriate concentration using a bacterial counting plate. Divide the total number of virus granulocytes obtained from the infected larvae in each batch by the number of dead larvae to obtain the virus yield per single larva.

[0041] 3. Virus Extraction: The virus-killed larvae were homogenized and subjected to three cycles of differential centrifugation: 800 rpm for 5 min and 6000 rpm for 30 min to obtain an off-white precipitate. The virus yield was counted using a bacterial counter.

[0042] 4. Biological activity assay:

[0043] Potato tuber moth: Dispense the prepared feed into a 24-well cell culture plate or other suitable feeding container using a plastic ketchup bottle, about 1 mL per well. After the feed is completely cooled, add a drop of 1×10 7 ,2×10 6 ,4×10 5 , 8×10 4 ,1.6×10 4 Two cell culture plates were used for each concentration of 0.8 μL / mL of virus infection solution (containing 0.1% Tween 80 by weight) or 10 μL of control solution (containing 0.1% Tween 80 by weight). The plates were gently rotated to evenly distribute the virus infection solution on the surface of the feed. The plates were then left uncovered in a cool, dry place until no visible water appeared on the surface of the feed and a drug film formed. Newly hatched potato tuber moth larvae were gently transferred with a brush into the wells of the cell culture plates containing the infected feed, one larva per well, for a total of 48 larvae per concentration. After 5 days, their growth and mortality were observed daily, and the number of larvae killed by the virus was counted. The experiment was terminated when the larvae in the control group began to pupate.

[0044] Tomato leafminer: Wrap the base of the tomato petiole with cotton balls soaked in sterile water, wrap it tightly with tin foil, and place it in a disposable plastic lunch box. After the larvae hatch, take fresh tomato leaves and immerse them in about 10 mL of 1×10 7 ,2×10 6 ,4×10 5 , 8×10 4 ,1.6×10 4 Incubate the tomato leaves with 0.8 μL of virus infection solution (containing 0.1% Tween 80 and 0.5%, 1%, or 2% chlorogenic acid) or 10 μL of two control solutions (containing 0.1% Tween 80 with or without 2% chlorogenic acid) for 10 minutes. After drying in a cool, dry place, wrap the base of the tomato petiole with a cotton ball soaked in sterile water, wrap tightly with tin foil, and place in a disposable plastic lunch box. Use a brush to gently transfer the hatched larvae onto the prepared fresh leaves and cover the lunch box. Once the tomato leaves have lost water and curled up, add the treated fresh leaves and allow the larvae to migrate. After 5 days, observe their growth and mortality daily, and count the number of larvae killed by the virus. The experiment ends when the larvae in the control group begin to pupate.

[0045] 5. Results

[0046] 1) Single-insect virus yield: PhabGV was amplified by rearing Phthorimaea operculella on artificial diet. The average yield of single-insect virus in three batches was 2×10 10 OBs per larva; PhabGV was amplified by rearing Phthorimaea operculella on potato tubers. The average yield of single-insect virus in three batches was 1.9×10 10 OBs per larva. There was no significant difference between the two (t = 0.426, p = 0.692).

[0047] 2) Bioassays were conducted on newly hatched larvae of Phthorimaea operculella using PhabGV amplified by rearing Phthorimaea operculella on potato tubers and artificial diet. The median lethal concentration (LC 50 ) values were 5.0×10 5 OBs / mL and 4.1×10 5 OBs / mL respectively, and their ratio was 1.221 (95% confidence limit: 0.523, 2.850). There was no significant difference between the two (Table 1).

[0048] Table 1:

[0049]

[0050] * The 95% confidence limit of the potency ratio contains the value 1, indicating no significant difference between the two LC 50 values.

[0051] Bioassays were conducted on newly hatched larvae of Tuta absoluta using PhabGV amplified by rearing Phthorimaea operculella on potato tubers and artificial diet. The results are shown in Table 2. Without adding chlorogenic acid, the LC 50 values were 2.1×10 5 OBs / mL and 3.9×10 5 OBs / mL respectively, and their ratio was 0.54 (95% confidence limit: 0.249, 1.173). There was no significant difference between the two.

[0052] Table 2:

[0053]

[0054] * The 95% confidence limit of the potency ratio contains the value 1, indicating no significant difference between the two LC 50 values.

[0055] Adding 0.5% chlorogenic acid to the solution had little effect on the LC 50 of PhabGV. However, when 1% and 1.5% chlorogenic acid were added to the solution, the LC 50 of PhabGV was significantly lower than the treatment without adding chlorogenic acid in the virus suspension (Table 3). Additionally, feeding 2% chlorogenic acid alone did not cause the death of Tuta absoluta.

[0056] Table 3:

[0057]

[0058] * The 95% confidence limit of the cost-effectiveness ratio includes the value 1, indicating that there is no significant difference between the two LC50 values; otherwise, there is a significant difference.

[0059] # For the suspension without virus with a chlorogenic acid concentration of 2%, the mortality rate of Tuta absoluta is 0.

[0060] Example 3 Field Efficacy Test

[0061] Add the PhabGV-Ningxia concentrate to 4.5 wt% emulsifier 700#, 0.5 wt% methyl soyate, 2 wt% sodium lignosulfonate, and 1 wt% fructooligosaccharide to process into a conventional virus suspension (PhabGV preparation) with 10 billion OB / mL, and add 1% chlorogenic acid to prepare a new virus suspension (PhabGV + 1% chlorogenic acid). Conduct efficacy tests on the newly hatched larvae of Tuta absoluta and Phthorimaea operculella respectively.

[0062] The test plot area is 20 m 2 , set up a protection area around the test field, with a ridge interval between treatments. Set 4 treatments (each preparation has 3 doses of 50 mL, 75 mL, 100 mL and a water control), with 4 replicates, a total of 16 plots, and the plots are completely randomly arranged. Use a knapsack manual sprayer to spray with 45 kg of water per mu. When applying the medicine, the working pressure of the sprayer is 0.2 - 0.3 Mpa, and the aperture of the spray nozzle is 1 mm. Before applying the medicine, take five-point sampling, select 5 plants at each point, a total of 25 plants are selected in each plot, number and label the plants, and record the number of live insects on the leaves of the plants at different sampling points respectively. After applying the medicine, carefully check the live larvae on both sides of the leaves and count the remaining number of live insects. The control effect is calculated according to the following formula:

[0063]

[0064] Where: PT - the reduction rate of the insect population in the medicament treatment area;

[0065] CK - the reduction rate of the insect population in the blank control area.

[0066] Results of the field efficacy test:

[0067] The field efficacy of PhabGV and PhabGV combined with 1% chlorogenic acid for the control of tomato leafminer and potato tuber moth is shown in Tables 4 and 5, respectively. Field spraying of PhabGV achieved significant results against both tomato leafminer and potato tuber moth, with efficacy increasing at application rates of 50 mL, 75 mL, and 100 mL per mu. The addition of 1% chlorogenic acid significantly improved the control efficacy of all doses compared to the absence of chlorogenic acid.

[0068] Table 4: Field test results of PhabGV preparation and PhabGV+1% chlorogenic acid against tomato leafminer

[0069]

[0070] *Note: The corrected control efficacy was subjected to arcsin square root transformation and variance analysis, followed by Duncan pairwise comparison. Different letters after the mean value of the corrected control efficacy represent significant differences between the two.

[0071] Table 5: Field test results of PhabGV preparation and PhabGV+1% chlorogenic acid for controlling potato tuber moth

[0072]

[0073] *Note: The corrected control efficacy was subjected to arcsin square root transformation and variance analysis, followed by Duncan pairwise comparison. Different letters after the mean value of the corrected control efficacy represent significant differences between the two.

[0074] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and alterations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A strain of Phthorimaea absoluta granulovirus (Phthorimaea absoluta granulovirus Ningxia), which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: V202518.

2. Use of the Phthorimaea absoluta granulovirus strain according to claim 1 in killing Phthorimaea absoluta and / or Phthorimaea operculella.

3. Method for proliferating tomato leaf miner granulovirus, characterized in that, It includes the steps of infecting Phthorimaea operculella with the Phthorimaea absoluta granulovirus strain according to claim 1 and extracting the virus, and the Phthorimaea operculella is reared using potato tubers and / or artificial feed.

4. A virus insecticide, characterized in that, It includes the Phthorimaea absoluta granulovirus strain according to claim 1 or the virus obtained by the propagation method according to claim 2, and chlorogenic acid.

5. The virus insecticide according to claim 3, wherein The addition amount of the chlorogenic acid is 0.5 - 2 wt% of the virus insecticide.

6. The viral insecticide according to claim 3, wherein The concentration of the tomato leaf miner granulovirus strain is 1×10 4 -1×10 11 OB / mL.

7. The virus insecticide according to claim 3, wherein The virus insecticide further includes at least one of an emulsifier, a spreading agent, a light protectant, and a feeding attractant.

8. The viral insecticide according to claim 7, wherein The emulsifier is emulsifier 700#; and / or, the spreading agent is methyl soyate; and / or, the light protectant is lignosulfonate; and / or, the feeding attractant is at least one of fructooligosaccharide and stevioside.

9. A method for killing pests, characterized in that, It includes the step of spraying the virus insecticide according to any one of claims 4 - 8 on the affected area; the affected area is infested with Phthorimaea absoluta and / or Phthorimaea operculella.

10. The method for killing pests according to claim 9, characterized in that, The affected area is a storage area or a farmland.

Images