Application of COP1 in regulation and control of plant fruit size and fruit quality

Abstract

The invention belongs to the technical field of plant biology, and discloses application of COP1 in regulation and control of plant fruit size and fruit quality. According to the invention, after the COP1 is knocked out, the longitudinal diameter is reduced while the transverse diameter of the plant fruit is increased, and the fruit shape index is reduced; the plant fruit size is changed, the single fruit weight is increased, and the potential of increasing the yield is achieved; the content of soluble sugar, organic acid, coumarin, vitamin C and lignan substances in the plant fruits can be increased, and the quality of the strawberry plant fruits can be improved; in addition, the length of plant stolon internodes can be shortened, and the number of plant seedling propagation is increased.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and particularly relates to the use of COP1 in regulating plant fruit size and fruit quality. Background Art

[0002] Strawberry pulp is juicy, sweet and sour, fragrant, and rich in nutrition, and is known as the "queen of fruits". In recent years, with the increase in cultivation area and yield, the market competition has become increasingly fierce. How to improve the strawberry fruit quality and enhance the market competitiveness has become a hot issue of concern. The fruit color, fruit size, fruit shape, hardness, fragrance, and sour and sweet degree of strawberries are all important factors affecting strawberry fruit quality. Among them, the fruit size of strawberries is an important commercial factor affecting the market price of strawberries.

[0003] From a botanical perspective, the strawberry fruit is an aggregate fruit composed of achenes and an enlarged receptacle (pulp). The receptacle swells to become the fleshy part of the strawberry, which is the main edible part of the strawberry; the fruit in the biological sense is the seed located on the surface of the fruit, also known as the achene. Auxin and gibberellin are mainly produced in the achenes and transported to the receptacle to promote its swelling. Existing studies have shown that auxin and gibberellin have a significant effect on the size of the transverse and longitudinal diameters of the fruit during the development of strawberry fruits. Among them, auxin mainly promotes the increase in the transverse diameter of the fruit, and also promotes the growth of the longitudinal diameter of the fruit through two pathways, namely gibberellin-dependent and non-dependent pathways. Gibberellin mainly promotes the elongation of the longitudinal diameter of the fruit, while abscisic acid (ABA) inhibits the growth of both the transverse and longitudinal diameters at the same time.

[0004] Existing studies have found that the FvAGL62, FvRGA1, and FvAFR8 genes in strawberries can affect the content or signal transduction pathway of auxin or gibberellin in the fruit, which also implies the important role of these genes in affecting fruit development and size. In addition, the FvFDM1 gene that affects the gene methylation level has been confirmed to regulate fruit size. After this gene mutates, a phenotype of round and smaller fruits can be produced. The Lian Hongli team also found in previous studies that the strawberry fruit can become larger after the FvGR3 gene mutates. In summary, the number of genes currently discovered that control strawberry fruit size and fruit shape is very limited.

[0005] COP1 (Constitutively Photomorphogenic 1) is a protein encoding a 76kD E3 ubiquitin ligase, which contains an N-terminal ring zinc finger domain, a coiled-coil domain, and a C-terminal WD40 repeat domain. COP1 was initially identified by Deng Xingwang et al. using mutants with dark-grown morphological variations in Arabidopsis thaliana. It can aggregate in the nucleus or disperse into the cytoplasm, and regulate the process of plant photomorphogenesis by responding to the presence or absence of light. Mutant plants have developed chloroplasts, short hypocotyls, and expanded leaves.

[0006] The literature (Zhang Yunting et al. Cloning and Expression Specificity Analysis of FaCOP1 in Strawberry. Acta Horticulturae Sinica, 2017, 44(3): 547-556) used homologous cloning to isolate and identify the FaCOP1 gene from Fengxiang strawberries. It is expressed in the roots, stems, leaves, flowers, and mature fruits of strawberries, with the highest expression level in flowers, followed by leaves and roots, and the least in stems and mature fruits. In addition, as strawberry fruits develop (from the small green stage to the fully red stage), the transcriptional level of FaCOP1 generally shows a decreasing pattern, which is opposite to the pattern of fruit anthocyanin accumulation.

[0007] Currently, only the expression pattern of COP1 has been studied in strawberries, and there are few reports on the protein function of COP1, especially its role in plant fruits. Summary of the Invention

[0008] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide the use of COP1 in regulating plant fruit size and fruit quality, thereby solving the problems in the prior art.

[0009] To achieve the above and other related purposes, the present invention is obtained through the following technical solutions.

[0010] The first aspect of the present invention protects the use of COP1 as a target in screening products for regulating plant organ development, regulating pigment accumulation, or regulating fruit metabolite accumulation.

[0011] The second aspect of the present invention protects the use of COP1 or its inhibitor in regulating plant organ development, regulating pigment accumulation, regulating fruit metabolite accumulation, or cultivating plants.

[0012] The third aspect of the present invention protects the use of biomaterials related to COP1 in regulating plant organ development, regulating pigment accumulation, regulating fruit metabolite accumulation, or cultivating plants. The biomaterials related to COP1 include at least one of the following:

[0013] D1) Nucleic acid molecules that inhibit COP1 gene expression or reduce COP1 protein content;

[0014] D2) An expression cassette containing the nucleic acid molecule described in D1);

[0015] D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2);

[0016] D4) A recombinant strain containing the nucleic acid molecule described in D1), or a recombinant strain containing the expression cassette described in D2), or a recombinant strain containing the recombinant vector described in D3).

[0017] The fourth aspect of the present invention protects a method for promoting plant organ development or promoting pigment accumulation or promoting fruit metabolite accumulation, the method comprising: promoting plant organ development or promoting pigment accumulation or promoting fruit metabolite accumulation by inhibiting or reducing the expression level of the COP1 protein.

[0018] The fifth aspect of the present invention protects a method for cultivating transgenic plants, the method comprising: cultivating transgenic plants by inhibiting or reducing the expression level of the COP1 protein in recipient plants.

[0019] The present invention has the following beneficial effects:

[0020] 1) The present invention discovers that after knocking out COP1 in plants, the transverse diameter of plant fruits can be increased while the longitudinal diameter is decreased, and the fruit shape index becomes smaller; the single fruit weight of the fruits increases, which is beneficial to increasing the yield.

[0021] 2) The present application discovers that after knocking out COP1 in strawberries, the internode length of strawberry stolons can be shortened, and the number of daughter plantlets propagated per strawberry plant can be increased.

[0022] 3) The present application discovers that after knocking out COP1 in plants, the contents of soluble sugars, organic acids, coumarin substances and lignan substances in plant fruits can be promoted, and the quality of strawberry plant fruits can be improved.

[0023] 4) The present invention discovers that after knocking out COP1 in plants, the chlorophyll and carotenoids in plant leaves can be increased, indicating that it is beneficial to convert light energy into chemical energy and promote photosynthesis and growth and development in plants; and the anthocyanin content in plant fruits can be increased, indicating that it is beneficial to fruit ripening. Description of the Drawings

[0024] Figure 1 It is a schematic diagram of the construction principle of the recombinant expression vector JH19-FvCOP1 in Example 1 of the present invention.

[0025] Figure 2 It is an electrophoresis diagram of the PCR products of transgenic positive strawberry plants in Example 2 of the present invention.

[0026] Figure 3This is the overall plant phenotype diagram of the fvcop1 mutant strawberry and the wild-type strawberry in Example 2 of the present invention.

[0027] Figure 4 This is the result diagram of the leaves, leaf width, leaf length, and petiole length of the fvcop1 mutant strawberry and the wild-type strawberry in Example 2 of the present invention.

[0028] Figure 5 This is the result diagram of the fruits, transverse diameter, longitudinal diameter, fruit shape index, and single fruit weight of the fvcop1 mutant strawberry and the wild-type strawberry in Example 2 of the present invention.

[0029] Figure 6 This is the phenotype diagram of the stolon internode length of the fvcop1 mutant and the wild-type strawberry in Example 2 of the present invention.

[0030] Figure 7 This is the measurement result diagram of the chlorophyll content, carotenoid in the leaves of the fvcop1 mutant strawberry and the wild-type strawberry, and the anthocyanin content in the fruits in Example 2 of the present invention.

[0031] Figure 8 This is the result diagram of the sugar-acid ratio of RG of the fvcop1 mutant and the wild-type strawberry in Example 3 of the present invention. Detailed implementation mode

[0032] COP1 (Constitutively Photomorphogenic 1) itself is an E3 ubiquitin ligase and has conserved biochemical characteristics. COP1 regulates biological processes by forming various complexes with other regulatory factors. In different plant groups, COP1 plays different roles: in Arabidopsis thaliana, COP1 acts as a "brake" device for light signal regulation and finely regulates seedling development together with photoreceptors; in addition, COP1 is also involved in regulating the emergence process of Arabidopsis thaliana seedlings; in Physcomitrella patens, COP1 is involved in the gravity response; in Chlamydomonas reinhardtii, COP1 is involved in high-light protection and ultraviolet light signal regulation. However, there are very few literatures on COP1 in terms of organ development, fruit development, and fruit metabolic synthesis and accumulation of horticultural plants. Strawberry leaves mainly contain chlorophyll and carotenoids, and the fruits mainly contain chlorophyll and proanthocyanidins in the early stage of ripening, while mainly contain anthocyanins, sugar acids, and phenols and other substances beneficial to human health in the late stage of ripening.

[0033] The first aspect of the present invention protects the use of COP1 as a target in screening products for regulating plant organ development or regulating pigment accumulation or regulating fruit metabolite accumulation.

[0034] In the present invention, the use of COP1 as a target for screening products that regulate plant organ development, or regulate pigment accumulation, or regulate fruit metabolite accumulation means: using the COP1 gene or COP1 protein as the object of action, screening the products to find products that can inhibit the expression level of the COP1 gene, or inhibit the expression or activity of the COP1 protein as alternative products for regulating plant organ development, or regulating pigment accumulation, or regulating fruit metabolite accumulation.

[0035] In the present invention, the products that regulate plant organ development, or regulate pigment accumulation, or regulate fruit metabolite accumulation include molecules that can specifically inhibit the transcription or translation of the COP1 gene, or can specifically inhibit the expression or activity of the COP1 protein, thereby reducing the expression level of the COP1 gene in plants, so as to achieve the purpose of promoting plant organ development, or promoting pigment accumulation, or promoting fruit metabolite accumulation.

[0036] In the present invention, the products include but are not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins or interfering lentiviruses. The form of the products has no special limitation and can be various substance forms such as solids, liquids, gels, semi-liquids, aerosols, etc.

[0037] In the present invention, the nucleotide sequence of COP1 contains the sequence shown in SEQ ID NO.1.

[0038] Another aspect of the present invention protects the use of COP1 or its inhibitor in regulating plant organ development, or regulating pigment accumulation, or regulating fruit metabolite accumulation, or cultivating plants.

[0039] In certain embodiments, by inhibiting the transcription or translation of the COP1 gene, or being able to inhibit the expression or activity of the COP1 protein, to regulate plant organ development, or regulate pigment accumulation, or regulate fruit metabolite accumulation, or cultivate high-yield strawberries. For example, COP1 can be partially inhibited, that is, reduce the expression and / or function of COP1; or it can be completely inhibited, that is, basically completely eliminate the expression and / or its function of COP1.

[0040] In some specific embodiments, the inhibition or reduction of COP1 expression can be achieved by gene knockout or by gene silencing. Gene silencing refers to the phenomenon in which a gene is not expressed or is expressed at a low level without damaging the original DNA. Gene silencing is premised on not changing the DNA sequence, causing the gene not to be expressed or to be expressed at a low level. Gene silencing can occur at two levels. One is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects, etc. The other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, RNA interference (RNAi), and microRNA (miRNA)-mediated translational inhibition, etc.

[0041] In some more specific embodiments, the COP1 inhibitor can be one or more of nucleic acid molecules, small molecule chemical drugs, antibody drugs, polypeptides, proteins, nucleic acid constructs, interfering lentiviruses, interfering related adenoviruses, and editing systems. Nucleic acid molecules targeting the COP1 gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA. The nucleic acid construct contains a nucleic acid molecule targeting the COP1 gene, such as JH19-FvCOP1 prepared in the following examples. The gene editing system is selected from one or more of the Cre-Loxp system, Flp-FRT system, Dre-ROX system, vCre-vloxp system, sCre-sloxp system, CRISPR / Cas9 system, CRISPR / Cas12 system, and CRISPR / Cas-derived single-base editing systems.

[0042] The present invention discovers that knocking out or reducing COP1 expression can increase the transverse diameter of plant fruits while decreasing the longitudinal diameter; it can also increase the single fruit weight of plant fruits (that is, the plant fruits become larger), which is beneficial to increasing the yield; in addition, it can promote the contents of soluble sugars, organic acids, coumarins, vitamin C, and lignans in plant fruits, and can improve the quality of plant fruits.

[0043] In some embodiments, the plant organs include fruits, stolons, leaves, and petioles. The regulation of organ development includes regulating the development of fruits, stolons, leaves, and petioles.

[0044] In some specific embodiments, the development of the strawberry organs of the plant includes at least one of the following A1)-A4):

[0045] A1) The transverse diameter of the plant fruit becomes larger and / or the ratio of the transverse diameter to the longitudinal diameter becomes larger;

[0046] A2) The plant fruit becomes larger;

[0047] A3) The internode length of the plant stolon becomes shorter;

[0048] A4) The plant leaves become smaller.

[0049] The quantitative traits of plants include fruit weight, fruit length, fruit width, fruit shape index, pulp thickness, 1000-seed weight, seed length, seed width, and seed shape index. The fruit of strawberry is its main commercial organ, and the fruit size and shape seriously affect the yield and appearance quality of strawberry. Consumers generally prefer oblate fruits, while round or oval fruits are favored by the processing industry because they are convenient for large-scale harvesting and transportation. It is found in this application that knocking out COP1 can control the increase in the transverse diameter of the plant fruit, the decrease in the longitudinal diameter, the increase in the ratio of transverse diameter to longitudinal diameter, and the increase in the single fruit weight, indicating that it is a key gene affecting the appearance quality of the fruit.

[0050] In certain embodiments, the pigment comprises one or more of chlorophyll, anthocyanin, and carotenoid;

[0051] In certain specific embodiments, the regulation of pigment accumulation includes at least one of B1)-B3):

[0052] B1) The content of anthocyanin increases;

[0053] B2) The content of carotenoid increases;

[0054] B3) The content of chlorophyll increases.

[0055] In certain embodiments, the metabolite comprises one or more of soluble sugar, organic acid, lignan, coumarin, and vitamin C.

[0056] In certain specific embodiments, the regulation of fruit metabolite accumulation includes any one or more of C1)-C4):

[0057] C1) The content of soluble sugar increases;

[0058] C2) The content of organic acid increases;

[0059] C3) The content of lignan increases;

[0060] C4) The content of coumarin increases;

[0061] C5) The content of vitamin C increases.

[0062] The fruit metabolite described in the present invention refers to the extract of the fruit, and the extract is obtained by methanol extraction of the fruit. Specifically, the dried fruit is ground into powder, and mixed in a ratio of 50 mg: 1.2 mL of methanol aqueous solution, and separated, wherein the concentration of the methanol aqueous solution is 70%.

[0063] The coumarin compounds include 3,4-dihydro-4-(4'-hydroxyphenyl)-5,7-dihydroxycoumarin, 4-hydroxy-7-O-methylrhamnocoumarin, 3,4-dihydro-4-(4'-hydroxyphenyl)-5,7-dihydroxycoumarin glucoside, 6-hydroxy-4-methylcoumarin, hydroxymethylcoumarin glucoside, 5,6-dimethoxy-8-(3'-methyl-2'-oxobutyl)coumarin, and 7-methoxycoumarin. The total relative content of coumarins in the methanol extract of mutant fvcop1 fruits is 2.92 times that of wild-type strawberries. Coumarin compounds belong to lactones and have effects similar to those of ester essential oils. They can positively affect serotonin secretion, relieve anxiety, and boost the spirit. Coumarin compounds have fluorescent properties and are often used as multicolor fluorescent targets and experimental blue light dyes. Currently, most of the anticoagulant drugs used clinically are also coumarin compounds. Therefore, substances containing coumarin compounds have broad applications.

[0064] The lignan compounds include dehydrodiconiferyl alcohol-9'-O-glucoside, syringaresinol-4'-O-glucoside, 5'-methoxypodocarpus glycoside, 7R-dihydrodehydrodiconiferyl alcohol 4-O-β-D-glucopyranoside, isolariciresinol-9-O-β-D-glucopyranoside, 7S,8S-threo-3',4,7,9-tetrahydroxy-3-methoxy-8-O-4'-neolignan-9'-O-rhamnoside. The total relative content of lignans in the methanol extract of mutant fvcop1 fruits is 3.82 times that of wild-type strawberries. Lignans are secondary metabolites of plants. Generally, the lignan content in natural plants is very low.

[0065] The organic acids include citric acid, succinic acid, 3-methylmalic acid, isocitric acid, 2-methylmalic acid, and L-malic acid. The total relative content of organic acids in the methanol extract of mutant fvcop1 fruits is 1.08 times that of wild-type strawberries.

[0066] The soluble sugars include sorbose, mannose, D-glucose-6-phosphate, D-glucose, D-fructose, D-fructose-6-phosphate, 1,6-anhydro-β-D-glucose, D-arabinose, D-erythrose-4-phosphate, D-glucuronic acid-6,3-lactone, D-gluconic acid-1,5-lactone, D-sorbitol, sorbitol-6-phosphate, D-fucose. The total relative content of soluble sugars in the methanol extract of mutant fvcop1 fruits is 2.25 times that of wild-type strawberries.

[0067] The total relative content of vitamin C in the methanol extract of mutant fvcop1 fruits is 2.35 times that of wild-type strawberries.

[0068] Another aspect of the present invention protects the use of COP1-related biomaterials in regulating plant organ development, or regulating pigment accumulation, or regulating fruit metabolite accumulation, or cultivating plants. The COP1-related biomaterials include at least one of the following:

[0069] D1) A nucleic acid molecule that inhibits the expression of the COP1 gene or reduces the content of the COP1 protein;

[0070] D2) An expression cassette containing the nucleic acid molecule described in D1);

[0071] D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2);

[0072] D4) A recombinant strain containing the nucleic acid molecule described in D1), or a recombinant strain containing the expression cassette described in D2), or a recombinant strain containing the recombinant vector described in D3).

[0073] In certain specific embodiments, the nucleic acid molecule is a specific sgRNA or a DNA molecule expressing the specific sgRNA, and its target sequence is shown as at least one of those in SEQ ID No. 2.

[0074] In certain specific embodiments, the construction method of the CRISPR / Cas9 system is as follows: Determine the target site according to the COP1 gene, design two single-stranded DNAs according to the target site sequence, which respectively include the sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, hybridize the two single-stranded DNAs, and ligate the obtained double-stranded DNA fragment with the JH4 vector digested by Bsa I to obtain the intermediate vector JH4-FvCOP1; then use the Gateway reaction to make JH4-FvCOP1 undergo homologous recombination with JH19 containing Cas9 to obtain the recombinant expression vector JH19-FvCOP1, that is, the CRISPR / Cas9 system. Then transfer the CRISPR / Cas9 system into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 system vector. Then use the Agrobacterium containing the CRISPR / Cas9 system vector to infect ordinary wild-type strawberry seedlings, and re-obtain seedlings through tissue culture, and screen to obtain genetically stable fvcop1 mutants. It is also possible to use methods such as gene gun transformation, such as the leaf disc method, young embryo transformation method, etc. to obtain genetically stable fvcop1 mutants.

[0075] Another aspect of the present invention protects a method for promoting plant organ development, or promoting pigment accumulation, or promoting fruit metabolite accumulation. The method includes: By inhibiting or reducing the expression level of the COP1 protein to promote plant organ development, or promote pigment accumulation, or promote fruit metabolite accumulation.

[0076] In some embodiments, by suppressing or reducing the expression level of COP1 protein, the development of plant organs is promoted. Specifically, the transverse diameter of plant fruits becomes larger and / or the ratio of the transverse diameter to the longitudinal diameter becomes larger, the plant fruits become larger, the internode length of plant stolons becomes shorter, and the plant leaves become smaller.

[0077] In some embodiments, by suppressing or reducing the expression level of COP1 protein, pigment accumulation is promoted. Specifically, the contents of chlorophyll and carotenoid in plant leaves increase, and the content of anthocyanin in plant fruits increases.

[0078] In some embodiments, by suppressing or reducing the expression level of COP1 protein, the accumulation of fruit metabolites is promoted. Specifically, the contents of sugar, organic acid, lignin, coumarin, and vitamin C in fruits increase. In the mutants obtained by suppressing or reducing the expression level of COP1 protein in the present invention, compared with wild-type strawberries, the contents of soluble sugar, organic acid, lignin, and coumarin in mutant strawberries increase by at least more than 1-fold.

[0079] Another aspect of the present invention protects a method for cultivating transgenic plants, which includes: cultivating transgenic plants by suppressing or reducing the expression level of COP1 protein in recipient plants.

[0080] In some embodiments, by introducing the above-mentioned biological materials related to COP1, the expression level of COP1 protein in recipient plants is suppressed or reduced, so as to cultivate transgenic plants.

[0081] In some specific embodiments, the introduction can be carried out by any known transformation method such as chemical transformation method, genetic transformation method, or electrotransformation method to transform the biological materials into recipient plants. The introduction can be integrating foreign genes into recipient plants.

[0082] In a specific embodiment of the present invention, strawberry leaves at the seedling age of 30 days are infected with an Agrobacterium liquid containing the recombinant expression vector JH19-FvCOP1, and fvcop1 mutants are obtained by genetic transformation method. It is found that the plant height of fvcop1 mutant strawberries becomes shorter, the petiole becomes shorter, the leaves become smaller, and the internode length of stolons becomes shorter; the transverse diameter of fruits becomes larger while the longitudinal diameter becomes smaller, and the weight of a single fruit increases extremely significantly; the content of anthocyanin in fruits increases extremely significantly, and the content of leaf green increases extremely significantly.

[0083] In the present invention, the plant is a dicotyledonous plant or a monocotyledonous plant. Preferably, it is strawberry.

[0084] The present invention discovers that after knocking out COP1 in plants, the transverse diameter of plant fruits can be increased while the longitudinal diameter is decreased, and the fruit shape index becomes smaller; the single fruit weight of the fruits increases, which is beneficial to increasing the yield; it can increase the chlorophyll and carotenoids in plant leaves, indicating that it is beneficial to convert light energy into chemical energy and promote photosynthesis, growth and development in plants; it can increase the anthocyanin content in plant fruits, indicating that it is also beneficial to fruit ripening; it can promote the contents of soluble sugars, organic acids, coumarins, vitamin C and lignans in plant fruits, and can improve the quality of strawberry plant fruits; it can shorten the internode length of strawberry stolons and increase the number of daughter seedlings propagated per strawberry plant.

[0085] The following specific examples illustrate the implementation modes of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation modes. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0086] Before further describing the specific implementation modes of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific implementation modes described below; it should also be understood that the terms used in the embodiments of the present invention are for the purpose of describing specific implementation modes, rather than limiting the protection scope of the present invention; in the specification and claims of the present invention, unless otherwise clearly indicated in the text, the singular forms "a", "an" and "the" include the plural forms.

[0087] When the embodiments give numerical ranges, it should be understood that unless otherwise specified in the present invention, both endpoints of each numerical range and any value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices and materials used in the embodiments, according to the knowledge of those skilled in the art of this technology and the description of the present invention, any methods, devices and materials similar or equivalent to the methods, devices and materials described in the embodiments of the present invention can also be used to implement the present invention.

[0088] The Arabidopsis thaliana COP1 (gene ID: AT2G32950; Arabidopsis thaliana database website: https: / / www.arabidopsis.org / ) protein was subjected to Blast alignment analysis with the protein database of diploid woodland strawberry ((Fragaria vesca “Hawaii-4”) (strawberry database website: https: / / www.rosaceae.org / organism / 24344)), and a homologous protein of COP1 in strawberry was obtained, named FvCOP1 (gene ID: FvH4_5g22570), and the nucleotide sequence is shown in SEQ ID NO.1.

[0089] Example 1 Construction of recombinant expression vector JH19-FvCOP1

[0090] In this Example 1, the construction of the recombinant expression vector JH19-FvCOP1 includes the following steps:

[0091] 1.1 Screening of target sites for knocking out FvCOP1 and primer design

[0092] Through the CRISPR / Cas9 target site screening website https: / / crispr.dbcls.jp / , the sequence of the target site used for knocking out the COP1 gene, TCCAGTGCTCTCAGAGTACG AGG (SEQ ID NO.2; the last three underlined bases, i.e., AGG, are the PAM sites required for Cas9 to function).

[0093] After the target sequence was selected, a forward primer was designed, and its reverse complementary primer was used as the reverse primer. Then, BsaⅠ restriction enzyme digestion adapters were added to the 5’ ends of the forward primer and the reverse primer respectively. Particularly, due to the JH19 vector used in this example, the first base T of the target sequence needs to be changed to G when synthesizing the primers, so that the forward primer and the reverse primer with the added restriction enzyme sites are as follows:

[0094] FvCOP1-F1: 5’-gctcGCCAGTGCTCTCAGAGTACG-3’ (SEQ ID NO.3)

[0095] FvCOP1-R1: 5’-aaacCGTACTCTGAGAGCACTGGC-3’ (SEQ ID NO.4)

[0096] Note: The first 4 bases in the primers, i.e., gctc and aaac, are the base sequences of the BsaⅠ restriction enzyme sites artificially introduced for vector construction and do not belong to the target site sequence of COP1.

[0097] 1.2. Obtaining the target double-stranded DNA fragment

[0098] The forward and reverse primers synthesized in step 1.1 form a DNA double-stranded fragment through an annealing reaction.

[0099] The annealing reaction system is as follows: 1 μL of 10×T4 ligase buffer (NEB) containing ATP; 2 μL each of FvCOP1-F1 and FvCOP1-R1; 1 μL of 10×T4 Polynucleotide Kinase; and finally, the volume is made up to 10 μL with sterile water.

[0100] The annealing reaction program is: 30 min at 37°C, 1 min at 95°C, and then start cooling at a rate of 1°C / min to 25°C. The resulting product is the target double-stranded DNA fragment.

[0101] 1.3. Digestion and purification of plasmid JH4

[0102] The JH4 plasmid (for specific information on the JH4 plasmid, see the literature Zhou et al., Plant Biotechnology Journal. (2018) 16, 1868–1877.) is digested with the Bsa I restriction endonuclease, and the digested product is purified to obtain the linearized JH4 plasmid.

[0103] The digestion reaction system is: 5 μL of 10×Cutsmart buffer; 3 μL of JH4 plasmid (500 ng - 1 μg); 2 μL of Bsa I restriction endonuclease; and finally, the volume is made up to 50 μL with sterile water.

[0104] The digestion reaction is carried out in a 37°C water bath for 2 h.

[0105] The digested product is purified using the DNA product recovery kit from Tiangen Biochemical. The specific steps can be carried out according to the kit instructions.

[0106] 1.4. Ligation reaction

[0107] The target double-stranded DNA fragment obtained in step 1.2 and the linearized JH4 plasmid obtained in step 1.3 are subjected to a ligation reaction according to the following reaction system.

[0108] The ligation reaction system is: take 7 μL of the target double-stranded DNA fragment, 1 μL of T4 DNA ligase, 1 μL of 10×T4 DNA ligase Buffer, and 1 μL of the linearized JH4 plasmid.

[0109] The ligation reaction is carried out at 16°C for 1 h to obtain the ligation product.

[0110] 1.5、Transformation of the ligation product

[0111] Transform the ligation product obtained in step 1.4 into Escherichia coli competent TOP10 (purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number: DL1010). Pick monoclonal colonies for PCR detection, then culture the positive clones in liquid medium, extract plasmids, and finally verify by sequencing to obtain the correct JH4-FvCOP1 plasmid.

[0112] 1.6、Construction of the gene editing vector JH19-FvCOP1

[0113] Digest the JH4-FvCOP1 plasmid obtained in step 1.5 with Ase I restriction endonuclease.

[0114] The digestion reaction system is as follows: 5 μL of 10×Cutsmart buffer; 3 μL of JH4-FvCOP1 plasmid (500 ng - 1 μg); 2 μL of Ase I restriction endonuclease; finally, make up the volume to 50 μL with sterile water.

[0115] The digestion reaction can be carried out in a 37°C water bath for 2 h.

[0116] Purify the digested product using the enzyme digestion product recovery kit from Tiangen Biochemical Technology Co., Ltd. to obtain the linearized JH4-FvCOP1 plasmid. The specific steps can be carried out according to the kit instructions.

[0117] Perform homologous recombination between the linearized JH4-FvCOP1 and the JH19 plasmid (for specific information about the JH19 plasmid, see the literature Zhou et al., Plant Biotechnology Journal. (2018) 16, 1868–1877.) through the Gateway reaction to obtain the JH19-FvCOP1 plasmid for CRISPR / Cas9 knockout.

[0118] The Gateway reaction system is as follows: 3 μL of linearized JH4-FvCOP1 plasmid (100 ng - 1 μg); 1 μL of JH19 plasmid (150 - 300 ng); 2 μL of 5×LR Clonase Reaction Buffer; finally, make up the volume to 10 μL with sterile water.

[0119] The Gateway reaction system can be carried out at 25°C for 12 h.

[0120] Transform the reaction product obtained from the Gateway reaction into Escherichia coli competent TOP10. Pick monoclonal colonies for PCR detection, then culture the positive clones and extract plasmids. Finally, verify by sequencing to obtain the correct JH19-FvCOP1 plasmid.

[0121] Figure 1 This is a schematic diagram of the construction principle of the recombinant expression vector JH19-FvCOP1 in this example.

[0122] Example 2 Genetic transformation of strawberry and phenotypic identification of fvcop1 mutant strawberry

[0123] In this Example 2, the recombinant expression vector JH19-FvCOP1 obtained in Example 1 was transformed into strawberry by Agrobacterium-mediated method, and the phenotypes of the obtained fvcop1 mutant strawberry were identified, including the following:

[0124] 2.1 Preparation of Agrobacterium infection solution

[0125] Take 2 μL of the recombinant expression vector JH19-FvCOP1 obtained in Example 1 and add it to 50 μL of GV3101 Agrobacterium competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd., product number: AC1001), mix gently, freeze in liquid nitrogen for 1 min after ice bath for 30 min, water bath at 37 °C for 3 min, then add 1 mL of YEP (pH = 7.0) liquid medium, culture with shaking at 28 °C and 200 rpm / min for 3 h, then centrifuge at 13000 rpm / min at room temperature for 1 min and remove 900 μL of the supernatant, resuspend the cell pellet with the remaining approximately 100 μL of supernatant, and finally spread the bacterial solution on a YEP (pH = 7.0) solid medium plate containing 50 mg / L Rif and 50 mg / L Kan, and incubate it upside down at 28 °C for 3 days.

[0126] Pick a single colony of GV3101 Agrobacterium containing the recombinant expression vector JH19-FvCOP1 on the plate obtained in the previous step, inoculate it into 5 mL of YEP liquid medium containing 50 mg / L Kan and 50 mg / L Rif, and culture with shaking at 28 °C and 200 rpm / min overnight. The next day, take 1 mL of the overnight culture and inoculate it into 100 mL of YEP liquid medium containing 50 mg / L Kan and 50 mg / L Rif at a ratio of 1:100, and culture with shaking at 28 °C and 200 rpm / min until the OD600 value reaches 0.2. Then, centrifuge at 4000 rpm / min for 20 min at 25 °C to collect the cells, resuspend the cell pellet with an equal volume of MS liquid medium and add acetosyringone to a final concentration of 200 μmol / L. Place the resuspended bacterial solution in the dark, activate it at 100 rpm / min and room temperature for 2 h, and then it can be used to obtain the Agrobacterium infection solution containing JH19-FvCOP1.

[0127] 2.2 Obtaining strawberry genetically transformed plants

[0128] The leaves of sterile strawberry plants (Ruegen, abbreviated as RG, used as the wild type of diploid woodland strawberry, without stolons, and with red fruits) grown in tissue culture flasks for 30 days were cut into strip-shaped leaves with a width of 0.5 cm. The leaves were placed in the Agrobacterium infection solution obtained in step 2.1 and shaken at 100 rpm / min for 12 min. After pouring out the infection solution, the leaves were taken out and excess Agrobacterium liquid on the leaves was blotted dry with sterile filter paper. Then, the leaves were placed with the back side up on the co-culture medium (MS + 2% sucrose + 3.4 mg / L 6-BA + 0.3 mg / L IBA). After culturing in the dark for 3 days, the leaves were transferred to an induction medium (MS + 2% sucrose + 3.4 mg / L 6-BA + 0.3 mg / L IBA) containing 250 mg / L cefotaxime and 4 mg / L hygromycin for resistant bud induction and screening. After the resistant buds regenerated, the resistant buds were transferred to a new proliferation medium (MS + 2% sucrose + 0.3 mg / L IBA) supplemented with 250 mg / L cefotaxime and 4 mg / L hygromycin for proliferation culture until T0 generation transgenic strawberries were obtained.

[0129] 2.3 Identification of transgenic strawberry positive plants

[0130] Continue to culture the T0 generation transgenic strawberry plants obtained in step 2.2 until they grow to 8 - 9 leaves. Then, take young leaves to extract DNA. First, identify whether the Cas9 gene exists in the transgenic plants by PCR. Plants with the Cas9 gene are transgenic positive plants. Take the DNA of 8 strawberry plants, numbered 3, 4, 5, 6, 7, 8, 9, and 10 respectively.

[0131] At the same time, use the wild type Ruegen as a control, with 2 replicates in the control group, numbered 1 and 2.

[0132] The primers for PCR identification are as follows:

[0133] The forward primer is Cas9-F1: 5'-TCTCGTCTCATAGAGCCCTG-3' (SEQ ID NO.5);

[0134] The reverse primer is Cas9-R1: 5'-GAAGAAAGATTGGGACCCTAAG-3' (SEQ ID NO.6).

[0135] The reaction system of PCR is: 2 μL of the DNA sample of the plant to be detected; 0.25 μL of Taq DNA polymerase, 2.5 μL of 10×PCR Buffer, 0.5 μL of dNTPs, 0.5 μL of each of the forward and reverse primers, and finally add sterile water to make up the volume to 25 μL.

[0136] The PCR reaction procedure was as follows: 94°C for 5 min; 94°C for 10 s, 55°C for 20 s, 72°C for 30 s, for 30 cycles; then extension at 72°C for 5 min, and storage at 12°C.

[0137] The PCR products were subjected to agarose gel electrophoresis to confirm the presence of the target band. Plants with the Cas9 target band were transgenic positive plants.

[0138] Figure 2 This is the agarose gel electrophoresis pattern of the PCR products of transgenic strawberry DNA in this example. Among them: M in the figure is the DNA molecular weight Marker, and the band sizes from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp in turn; 1 and 2 are wild-type strawberry DNA samples; 3 - 12 are strawberry plant DNA samples obtained by genetic transformation.

[0139] From Figure 2 it can be seen that the plants corresponding to numbers 5 - 12 are transgenic positive plants.

[0140] 2.4, Identification of fvcop1 mutant lines

[0141] Using the DNA of the transgenic positive plants obtained in step 2.3 as a template, a short fragment containing the target sequence of the FvCOP1 gene was amplified by PCR, and the site of the target sequence was confirmed by sequencing, that is, whether the nucleotide sequence of the target sequence was changed. Plants in which the target sequence was changed and caused premature termination of the protein encoded by the FvCOP1 gene were fvcop1 mutant plants.

[0142] The primers used for PCR detection were:

[0143] FvCOP1 - F2: 5'-CAAGGTAGCCTATCAGTTTCACAC-3' (SEQ ID NO.7)

[0144] FvCOP1 - R2: 5'-CCTAAGTTCAGCAATGACCCTC-3' (SEQ ID NO.8)

[0145] The reaction system and reaction procedure of PCR were the same as those in step 2.3.

[0146] Figure 3 In A, it is the comparison result diagram of the target sites of the FvCOP1 gene in mutant strawberries and wild-type strawberries in this example.

[0147] Among them, the underlined AGG is the PAM site (protospacer adjacent motif) recognized when the Cas9 protein functions.

[0148] 2.5 Identification of fvcop1 mutant phenotypes

[0149] Seeds of the wild type and the fvcop1 mutant obtained in step 2.4 were sown simultaneously. When the seedlings emerged from the soil and grew to the 4-leaf stage, they were transplanted into an artificial climate chamber with the temperature set at 24°C, humidity at 50%, and a photoperiod of 16 h light / 8 h dark. Under these conditions, the newly unfolded leaves were selected for observation and measurement of leaf phenotype, and the carotenoid and chlorophyll contents in the leaves were determined.

[0150] When the fruit is ripe, the horizontal and vertical diameters of the fruit are measured with a vernier caliper, and the fruit shape index of the fruit is calculated (the fruit shape index is the ratio of the vertical diameter to the horizontal diameter of the fruit), and the single weight of the fruit and the anthocyanin content are determined.

[0151] 2.5.1 Organ Development

[0152] 1) Strawberry leaf and plant phenotype

[0153] Figure 3 Figure B is a photo of the phenotypes of wild-type strawberry and fvcop1 mutant strawberry plants in this example. RG stands for wild-type strawberry Ruegen, and fvcop1 stands for mutant strawberry.

[0154] from Figure 3 As shown in Figure B, the fvcop1 mutant strawberry plants became shorter in height, their petioles became shorter, and their overall shape became more compact.

[0155] Figure 4 Figures A, B, C, and D are photos of leaves, statistical graphs of leaf width, leaf length, and petiole length of the fvcop1 mutant and wild-type strawberries, respectively. The scale in Figure A is 2 cm; ** indicates a highly significant difference between the fvcop1 mutant and wild-type strawberries.

[0156] from Figure 4 The results showed that the petiole length, leaf length, and leaf width of the fvcop1 mutant strawberry were significantly shorter than those of the wild-type strawberry. The leaves of the fvcop1 mutant strawberry were greener than those of the wild-type strawberry.

[0157] 2) Strawberry fruit phenotype

[0158] Figure 5 Figures A, B, C, D, and E show the fruit phenotypes of the fvcop1 mutant and wild-type strawberries, respectively. The scale in Figure A represents 1 cm. ** indicates a highly significant difference between the mutant and wild-type strawberry fruits.

[0159] As can be seen from Figure 5 A, compared with the fruits of wild - type strawberries, the fruits of fvcop1 mutant strawberries are significantly larger, and the red color of the fruits is significantly redder.

[0160] As can be seen from Figure 5 B and C, compared with the transverse diameter of the fruits of wild - type strawberries, the transverse diameter of the fruits of fvcop1 mutant strawberries is significantly larger, about 12 mm; at the same time, the longitudinal diameter of the fruits of fvcop1 mutant strawberries is significantly smaller.

[0161] As can be seen from Figure 5 D, compared with the transverse diameter of the fruits of wild - type strawberries, the fruit shape index of fvcop1 mutant strawberries is significantly smaller, about 1.2, showing a conical shape. The fruit shape index is the longitudinal diameter of the fruit divided by the transverse diameter of the fruit, and the fruit shape index is one of the quality indexes of the fruit.

[0162] As can be seen from Figure 5 E, compared with the single - fruit weight of the fruits of wild - type strawberries, the single - fruit weight of fvcop1 mutant strawberries increases extremely significantly, nearly doubling.

[0163] Overall, after knocking out COP1, the leaf width, leaf length and petiole length of strawberries are significantly reduced, resulting in an overall smaller leaf, a shorter plant height, a more compact overall plant shape, and an increase in the number of plants planted per unit area; and after knocking out COP1, the transverse diameter of the fruits of strawberries is significantly larger, the longitudinal diameter is significantly smaller, the fruit shape index is smaller, and the single - fruit weight is significantly increased, indicating an increase in strawberry yield.

[0164] 3) Internode length of strawberry stolons

[0165] The genetic background of the fvcop1 mutant plants obtained in step 2.4 is Ruegen. Since Ruegen itself cannot produce stolons, it is impossible to observe whether the FvCOP1 gene has a function in stolons.

[0166] Therefore, fvcop1 mutant strawberries are crossed with H4 strawberries (Hawaii 4, abbreviated as H4, which is a germplasm of diploid woodland strawberry different from Ruegen, can produce stolons, and the fruits are white), and mutants fvcop1 / H4 with H4 genetic background are obtained by screening the hybrid offspring. Observe the stolon phenotype of fvcop1 / H4 mutant strawberries.

[0167] Figure 6 This is the phenotypic map of the internode length of the stolons of wild - type strawberries and fvcop1 / H4 mutant strawberries in this example. The arrow indicates the position of the first daughter plant of the stolon.

[0168] As can be seen from Figure 6As can be seen, the internode length of stolons in the fvcop1 / H4 mutant is shortened, indicating that fvcop1 has the effect of shortening the internode length of strawberry stolons. Strawberries are asexually propagated by daughter plants produced from stolons. A short internode length of stolons is beneficial for stolons to produce more daughter plants, thereby increasing the daughter plant propagation rate of strawberry mother plants.

[0169] 2.5.2, Pigment Accumulation

[0170] 1) Anthocyanin

[0171] Figure 7 In A, it is a statistical chart of the anthocyanin content in the fruits of fvcop1 mutant strawberries and wild-type strawberries. ** indicates that there is a highly significant difference in the anthocyanin content between mutant strawberries and wild-type strawberries.

[0172] From Figure 7 As can be seen from A, compared with the anthocyanin content in the fruits of wild-type strawberries, the anthocyanin content in the fruits of fvcop1 mutant strawberries is significantly increased.

[0173] 2) Chlorophyll

[0174] Chlorophyll is the green pigment in plants and plays a role in absorbing light energy during photosynthesis, converting light energy into chemical energy, and promoting photosynthesis and growth and development in plants. For the detection of chlorophyll, see Porra, R.J. The chequered history of the development and use of simultaneous equations for the accurate determination of chlorophylls a and b. Photosynthesis Research 73, 149–156 (2002).

[0175] Figure 7 In B and C, they are statistical charts of the contents of chlorophyll a and chlorophyll b in the leaves of fvcop1 mutant strawberries and wild-type strawberries respectively. ** indicates that there is a highly significant difference between the leaves of mutant and wild-type strawberries.

[0176] From Figure 7 As can be seen from B and C, compared with wild-type strawberries, the content of chlorophyll a in the leaves of fvcop1 mutant strawberries is significantly increased; and the content of chlorophyll b is also significantly increased.

[0177] The increase in chlorophyll in the leaves indicates that the photosynthesis of fvcop1 mutant strawberries is enhanced, which is beneficial for the photosynthesis and development of strawberries.

[0178] 3) Carotenoid

[0179] Carotenoids are not only part of the plant photosynthetic pigments but also members of the non-enzymatic series in the reactive oxygen species scavenging system. They can directly capture free radicals to block the chain reaction of free radicals, prevent the oxidative damage of free radicals to proteins, lipids, and DNA, and thus effectively delay the senescence of plants. In addition, it is reported that a high content of carotenoids in leaves is beneficial to improving the stress resistance of plants.

[0180] The detection literature of carotenoids González-Casado, S., López-Gámez, G., Martín-Belloso, O., Elez-Martínez, P., & Soliva-Fortuny, R. (2022). Pulsed light of near-infrared and visible light wavelengths induces the accumulation of carotenoids in tomato fruits during post-treatment time. Journal of Food Science, 87, 3913–3924.

[0181] Figure 7 In D is the statistical chart of the determination results of carotenoid content in the leaves of fvcop1 mutant strawberries and wild-type strawberries. ** indicates that there is a highly significant difference in the carotenoid content between mutant strawberries and wild-type strawberry leaves.

[0182] From Figure 7 As can be seen from D in, the carotenoid content in the leaves of fvcop1 mutant strawberries is significantly increased compared with that of wild-type strawberries.

[0183] Example 3 Analysis of metabolites in the fruits of fvcop1 mutant strawberries

[0184] In this Example 3, the fruits of fvcop1 mutant strawberries obtained in Example 2 were extracted to analyze the metabolites in the fruits. It includes the following:

[0185] 3.1. Obtaining the methanol extract of strawberry fruits

[0186] 1) Fruits of wild-type RG and fvcop1 mutants at the mature stage were collected respectively, and the fruit samples were dried by vacuum freeze-drying.

[0187] 2) Grind the dried fruit into a powder. Weigh 50 mg of the powder and add 1.2 mL of -20°C pre-cooled 70% methanol in water. Mix thoroughly with a vortexer for 30 seconds every 30 minutes. Repeat this cycle six times. Centrifuge at 12,000 rpm for 3 minutes. Aspirate the supernatant, filter it through a microporous filter (pore size 0.22 μm), and store it in an injection vial to obtain the methanol extract for UPLC-MS / MS analysis.

[0188] 3.2 Analysis of the relative content of each substance in the methanol extract using UPLC-ESI-MS / MS

[0189] The methanol extract was analyzed by UPLC-ESI-MS / MS system (UPLC, ExionLC TM AD, https: / / sciex.com.cn / ) and tandem mass spectrometry system (https: / / sciex.com.cn / ) were used for analysis.

[0190] The analysis conditions were as follows: UPLC: the chromatographic column was Agilent SB-C18 (1.8 μm, 2.1 mm*100 mm); the mobile phases were solvent A (0.1% formic acid in water) and solvent B (0.1% formic acid in acetonitrile).

[0191] Samples were analyzed using a gradient elution program starting with 95% A, 5% B. Over 9 minutes, the gradient was linearly increased to 5% A, 95% B, and the elution conditions were maintained at 5% A, 95% B for 1 minute. Subsequently, the composition was adjusted to 95% A, 5.0% B over 1.1 minutes and maintained for 2.9 minutes. The flow rate was set at 0.35 mL / min; the column temperature was set at 40°C; and the injection volume was 2 μL. The UPLC effluent was connected to an ESI-triple quadrupole linear ion trap (QTRAP) for mass spectrometry analysis.

[0192] ESI source operating parameters were as follows: source temperature, 500°C; ion spray voltage (IS), 5500 V (positive ion mode) / -4500 V (negative ion mode); and ion source gas I (GSI), gas II (GSII), and curtain gas (CUR) settings of 50, 60, and 25 psi, respectively. The relative contents of coumarins, lignans, sugars, and organic acids in the fruits of wild-type RG and the fvcop1 mutant were compared by calculating the peak areas of the characteristic ions formed by each compound in the detector.

[0193] Table 1

[0194]

[0195] As can be seen from Table 1, the contents of soluble sugars, organic acids, lignans, and coumarins in the fruits of the fvcop1 mutant strawberry changed significantly. Compared with the wild-type RG, the total content of coumarins in the methanol extract of the fvcop1 mutant strawberry increased significantly by 2.92 times (p < 0.05); compared with the wild-type RG, the total content of lignans in the methanol extract of the fvcop1 mutant strawberry increased significantly by 3.82 times (p < 0.05); compared with the wild-type RG, the total content of soluble sugars in the methanol extract of the fvcop1 mutant strawberry increased significantly by 2.25 times (p < 0.05); compared with the wild-type RG, the total content of organic acids in the methanol extract of the fvcop1 mutant strawberry increased by 1.08 times; compared with the wild-type RG, the total relative content of vitamin C in the methanol extract of the fruits of the fvcop1 mutant was 2.35 times that of the wild-type strawberry (p < 0.05).

[0196] The sugar-acid ratios in the fruits of the wild-type and fvcop1 mutant were calculated, and the results are shown in Figure 8 , and it was found that the sugar-acid ratio of the fvcop1 mutant was significantly higher than that of the wild-type, indicating that the quality of the mutant fruits was better than that of the wild-type, and it was increased by about 47.2% compared with the wild-type RG.

[0197] Lignans have strong antioxidant activity, can scavenge free radicals in the body, and prevent them from damaging cells. Therefore, lignans are considered a potential antioxidant and can prevent diseases caused by oxidative stress. Lignans can reduce the level of low-density lipoprotein cholesterol in the serum by inhibiting the activity of cholesterol synthase, thereby reducing the risk of cardiovascular and cerebrovascular diseases. Lignans have a certain anti-inflammatory effect, can reduce the inflammatory response in the body, and promote wound healing. Lignans can inhibit the growth and spread of tumor cells and prevent the malignant transformation of tumor cells. Coumarins have functions such as antioxidant, anti-microbial, liver protection, and prevention of tumor necrosis.

[0198] In addition, the content of vitamin C in the mutant fruits also increased significantly. Vitamin C, also known as ascorbic acid, has antioxidant effects and can scavenge free radicals; vitamin C participates in steroid hydroxylation reactions, promotes steroid metabolism, can reduce serum cholesterol, and prevent atherosclerosis; improves the utilization of iron, calcium, and folic acid, promotes the absorption of iron in the intestine, and helps improve iron-deficiency anemia; promotes the synthesis of collagen, thereby maintaining the health of human skin, mucous membranes, teeth, and bones. In addition, it also participates in the synthesis of neurotransmitters and improves the body's immunity, etc.

[0199] The above embodiments are intended to illustrate the embodiments disclosed in the present invention and should not be construed as limiting the present invention. In addition, various modifications listed herein and changes in the methods and compositions of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in connection with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all modifications that are obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of COP1 as a target in screening products for regulating plant organ development or regulating pigment accumulation or regulating fruit metabolite accumulation.

2. Use of COP1 or its inhibitor in regulating plant organ development or regulating pigment accumulation or regulating fruit metabolite accumulation or cultivating plants.

3. The use according to claim 1, characterized in that, The organ includes one or more of fruit, stolon, leaf and petiole; and / or, the pigment includes one or more of chlorophyll, anthocyanin and carotenoid; and / or, the metabolite includes one or more of soluble sugar, organic acid, lignin, coumarin and vitamin C; and / or, the nucleotide sequence of the COP1 includes the sequence shown in SEQ ID NO.

1.

4. The use according to claim 2, characterized in that, Includes at least one of the following 1)-3): 1) The regulation of plant organ development includes any one or more of A1)-A4): A1) The transverse diameter of the plant fruit becomes larger and / or the ratio of the transverse diameter to the longitudinal diameter becomes larger; A2) The plant fruit becomes larger; A3) The internode length of the plant stolon becomes shorter; A4) The plant leaves become smaller; 2) The regulation of pigment accumulation includes any one or more of B1)-B3): B1) The anthocyanin content increases; B2) The carotenoid content increases; B3) The chlorophyll content increases; 3) The regulation of fruit metabolite accumulation includes any one or more of C1)-C4): C1) The soluble sugar content increases; C2) The organic acid content increases; C3) The lignin content increases; C4) The coumarin content increases; C5) The vitamin C content increases.

5. Use of a biomaterial related to COP1 in regulating plant organ development or regulating pigment accumulation or regulating fruit metabolite accumulation or cultivating plants, characterized in that, The biological material related to COP1 includes at least one of the following: D1) A nucleic acid molecule that inhibits the expression of the COP1 gene or reduces the COP1 protein content; D2) An expression cassette containing the nucleic acid molecule described in D1); D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) A recombinant strain containing the nucleic acid molecule described in D1), or a recombinant strain containing the expression cassette described in D2), or containing The recombinant strain of the recombinant vector described in D3).

6. The use according to claim 4, characterized in that, The nucleic acid molecule is a specific sgRNA or a DNA molecule expressing the specific sgRNA, and its target sequence includes the sequence shown in SEQ ID No.

2.

7. The use according to claim 4, characterized in that, The organ includes one or more of fruit, stolon, leaf and petiole; and / or, the pigment includes one or more of chlorophyll, anthocyanin and carotenoid; and / or, the metabolite includes one or more of soluble sugar, organic acid, lignin, coumarin and vitamin C.

8. A method for promoting plant organ development or promoting pigment accumulation or promoting fruit metabolite accumulation, characterized in that, The method includes: by inhibiting or reducing the expression level of the COP1 protein to promote plant organ development or promote pigment accumulation or promote fruit metabolite accumulation.

9. A method for cultivating transgenic plants, characterized in that, The method includes: by inhibiting or reducing the expression level of the COP1 protein in the recipient plant to cultivate transgenic plants.

10. The use according to any one of claims 1 to 7 or the method according to claim 8 or 9, characterized in that, The plant is a dicotyledonous plant or a monocotyledonous plant, preferably strawberry.

Images