Application of sunflower HaGRAS19 gene in improving abiotic stress tolerance of plants

By increasing the expression of the HaGRAS19 gene in sunflower and using VIGS and gene overexpression technology, the adaptability of saline-alkali and drought stress in sunflower is enhanced, and the problem of lack of genes for sunflower tolerance regulation is solved, and the water loss rate and reactive oxygen accumulation are significantly reduced, and stress resistance is enhanced.

CN120384096APending Publication Date: 2025-07-29HANGZHOU NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510521860.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-24
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

In the prior art, there is relatively little research on the resistance regulation gene of sunflowers to abiotic stress, and it is difficult to effectively improve their stress resistance in environments such as saline and alkaline and drought.

Method used

By increasing the expression of the HaGRAS19 gene in sunflower and using virus-induced gene silencing technology (VIGS) and gene overexpression technology, the HaGRAS19 gene was constructed and transferred to the HaGRAS19 gene, which significantly enhanced the saline and drought stress adaptability of sunflower.

Benefits of technology

It significantly reduces the water loss rate of sunflowers in a salt environment, reduces the accumulation of reactive oxygen species in the leaves, enhances its ability to resist saline-alkali stress and drought resistance, and does not affect the normal growth of the plant.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384096A_ABST
    Figure CN120384096A_ABST
Patent Text Reader

Abstract

The invention relates to the field of gene engineering, and discloses application of a sunflower HaGRAS19 gene in abiotic stress tolerance of plants. According to the invention, the expression quantity of the HaGRAS19 gene in the sunflower is increased, so that the water loss rate of the sunflower in a salt environment can be obviously reduced, and the active oxygen accumulation of leaves of the sunflower can be obviously reduced, thereby providing a new application of the HaGRAS19 gene of the sunflower in improving the abiotic stress tolerance of plants. By increasing the expression quantity of the HaGRAS19 gene, the salt and alkali stress resistance and drought resistance of the sunflower can be remarkably improved, and normal growth of plants is not affected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and particularly to the application of the sunflower HaGRAS19 gene in improving the abiotic stress tolerance of plants. Background Art

[0002] Abiotic stress refers to environmental stress caused by abiotic factors that have an adverse impact on plant growth, development, and survival. These abiotic factors include drought, flood, high temperature, low temperature, salinity, heavy metal pollution, ultraviolet radiation, mechanical damage, nutrient deficiency, etc. Under abiotic stress conditions, plants will undergo a series of changes at the morphological structure, physiological and biochemical, and molecular levels to adapt to or resist this adverse environment. For example, under drought stress, plants may close their stomata to reduce water loss; under low temperature stress, some antifreeze substances such as proline and soluble sugars will accumulate in plants. However, if the stress level exceeds the tolerance of plants, it will lead to inhibited plant growth, reduced yield, and even death.

[0003] Drought is a natural disaster with a wide distribution range, a long duration, and the most serious impact on the economy and the environment at present. It is one of the most serious environmental constraints and greatly restricts the growth, distribution, and crop production of plants. Saline-alkali land is a key environmental constraint factor affecting agricultural production, and the high soil salinity is the main obstacle to crop production. Utilizing arid land and saline-alkali land and expanding the available cultivated land area can improve the resource utilization rate. By planting stress-tolerant crops, the land that was originally not suitable for agricultural production can be converted into arable land, thus actively developing various types of non-traditional cultivated land resources, effectively combining "storing grain in the land" with "storing grain in technology" to enhance agricultural production capacity.

[0004] Sunflower (Helianthus annuus L.) is the fourth most important oil crop in the world. In-depth understanding of the response mechanism of sunflower to abiotic stress not only helps to enhance its stress resistance but also contributes to the improvement of actual production, having important practical application value. Combining "planting suitable crops for the land" with "planting suitable land for the crops" and accelerating the breeding of sunflower varieties with characteristics of salt tolerance and drought tolerance will help to expand the cultivated land area.

[0005] VIGS (Virus-Induced Gene Silencing) is a rapid and genetic transformation-free tool for studying gene functions. By introducing target gene fragments into plants through viral vectors, it triggers the endogenous RNA silencing mechanism and specifically inhibits the expression of target genes, which is commonly used in plant gene function research. Strengthening the research and development of stress-tolerant sunflower varieties and their molecular mechanisms of salt and drought tolerance is conducive to accelerating the breeding of sunflower varieties with salt and drought tolerance characteristics. Currently, there is still a lack of research on genes regulating natural variation in stress tolerance of sunflowers. Applying VIGS technology to the research of key molecular mechanisms in sunflowers can provide theoretical basis and technical support for the breeding of stress-resistant sunflower varieties. Summary of the Invention

[0006] In order to improve the abiotic stress tolerance of sunflowers, the present invention provides an application of a sunflower HaGRAS19 gene in improving the abiotic stress tolerance of plants.

[0007] The specific technical solution of the present invention is as follows: In the first aspect, the present invention provides an application of a sunflower HaGRAS19 gene in improving the abiotic stress tolerance of plants, and the nucleotide sequence of the sunflower HaGRAS19 gene is shown in SEQ ID NO.1.

[0008] In the present invention, through experiments, it is verified that increasing the expression level of the HaGRAS19 gene shown in SEQ ID NO.1 in sunflowers enables sunflowers to significantly reduce the water loss rate in a salt environment and significantly reduce the accumulation of reactive oxygen species in its leaves, indicating that the HaGRAS19 gene can significantly change the ability of sunflowers to resist salt-alkali stress and does not affect the normal growth of plants. Therefore, the HaGRAS19 gene shown in SEQ ID NO.1 can be applied to improve the abiotic stress tolerance of plants.

[0009] Preferably, the amino acid sequence of the encoded protein of the sunflower HaGRAS19 gene is shown in SEQ ID NO.2.

[0010] Preferably, the expression level of the sunflower HaGRAS19 gene is increased in plants.

[0011] In the second aspect, the present invention provides an application of a sunflower HaGRAS19 gene in improving the stress resistance of plants to abiotic stress, and the nucleotide sequence of the sunflower HaGRAS19 gene is shown in SEQ ID NO.1.

[0012] Preferably, the method of the application is: improving the stress resistance of plants to abiotic stress by increasing the expression of the sunflower HaGRAS19 gene in plants.

[0013] In a third aspect, the present invention provides an application of the sunflower HaGRAS19 gene in cultivating plant varieties with abiotic stress resistance. The nucleotide sequence of the sunflower HaGRAS19 gene is shown as SEQ ID NO.1.

[0014] Preferably, the method of the application is: improving the expression of the sunflower HaGRAS19 gene in plants to breed plant varieties resistant to abiotic stress.

[0015] In a fourth aspect, the present invention provides a method for cultivating transgenic plants resistant to abiotic stress environments, including the following steps: Transfer the sunflower HaGRAS19 gene shown as SEQ ID NO.1 into plants to obtain transgenic plants resistant to abiotic stress environments.

[0016] Compared with the prior art, the present invention has the following technical effects: The present invention increases the expression level of the HaGRAS19 gene in sunflowers, enabling sunflowers to significantly reduce the water loss rate in a salt environment and significantly reduce the accumulation of reactive oxygen species in their leaves, indicating that the HaGRAS19 gene can significantly change the ability of sunflowers to resist saline-alkali stress without affecting the normal growth of the plants.

[0017] Based on the application of the HaGRAS19 gene provided by the present invention, it can provide new gene resources for cultivating new plant varieties with high stress resistance. Therefore, the present invention provides a method for cultivating transgenic plants resistant to abiotic stress environments, transferring the sunflower HaGRAS19 gene shown as SEQ ID NO.1 into plants to obtain transgenic plants resistant to abiotic stress environments. The method of the present invention has important popularization and application value in the cultivation of plant germplasms resistant to abiotic stress and agricultural production. Description of the Drawings

[0018] Figure 1 It is a schematic diagram of the gene silencing vector pTRV2.

[0019] Figure 2 It is a statistical chart of the phenotypes and differences of the control group and the silenced group of sunflower plants without abiotic stress treatment in Example 2.

[0020] Figure 3 It is a gel diagram for VIGS identification of sunflower seedlings.

[0021] Figure 4 It is the expression level of the HaGRAS19 gene in the control group and the silenced group before abiotic stress treatment.

[0022] Figure 5 It is the phenotypes of the control group and the silenced group of sunflower plants after abiotic stress treatment.

[0023] Figure 6 The figure shows the relative water content of the leaves of the control group and the silenced group after abiotic stress treatment compared with before treatment.

[0024] Figure 7 The figure shows the content and distribution map of ROS in the leaves of the control group and the silenced group after abiotic stress treatment.

[0025] Figure 8 The figure is a schematic diagram of the gene overexpression vector 688-GFP vector.

[0026] Figure 9 The figure shows the phenotypes of the control group and the silenced group of sunflower plants after salt stress treatment in Example 4.

[0027] Figure 10 The figure shows the phenotypes of the control group and the silenced group of sunflower plants after polyethylene glycol stress treatment in Example 4. Detailed implementation mode

[0028] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are usually only a part of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative work shall fall within the scope of protection of the present invention.

[0029] An application of the sunflower HaGRAS19 gene in improving the abiotic stress tolerance of plants, wherein the nucleotide sequence of the sunflower HaGRAS19 gene is as shown in SEQ ID NO.1.

[0030] In one embodiment, through the experiment of increasing the expression level of the HaGRAS19 gene as shown in SEQ ID NO.1 in sunflower, it is found that after increasing the expression level of the HaGRAS19 gene in sunflower, the sunflower can significantly reduce the water loss rate in a salt environment, and significantly reduce the accumulation of reactive oxygen species in its leaves, and does not affect the normal growth of the plant. The above embodiment shows that the HaGRAS19 gene can significantly change the ability of sunflower to resist salt-alkali stress. Therefore, the HaGRAS19 gene as shown in SEQ ID NO.1 can be applied to improve the abiotic stress tolerance of plants.

[0031] Preferably, the amino acid sequence of the encoded protein of the sunflower HaGRAS19 gene is as shown in SEQ ID NO.2.

[0032] Preferably, the expression level of the sunflower HaGRAS19 gene is increased in plants.

[0033] In one embodiment, there is provided an application of the sunflower HaGRAS19 gene in improving the stress resistance of plants to abiotic stresses, and the nucleotide sequence of the sunflower HaGRAS19 gene is as shown in SEQ ID NO.1.

[0034] Stress resistance refers to the ability of an organism to survive and grow in an adverse environment (stress), and is also known as stress tolerance. Stresses include drought, flood, high temperature, low temperature, salinity, pests and diseases, etc. In one embodiment, through an experiment of increasing the expression level of the HaGRAS19 gene as shown in SEQ ID NO.1 in sunflowers, it was found that after increasing the expression level of the HaGRAS19 gene in sunflowers, the sunflowers could significantly reduce the water loss rate in a saline environment, and significantly reduce the accumulation of reactive oxygen species in their leaves, and did not affect the normal growth of the plants. The above embodiment shows that expressing the HaGRAS19 gene in plants can improve the ability of plants such as sunflowers to resist saline-alkali stress and drought stress, enabling them to adapt to stress, maintain life activities, and even maintain good growth and reproduction abilities through the regulation of their own physiology, biochemistry, and morphology.

[0035] Preferably, the method of the application is: improving the stress resistance of plants to abiotic stresses by increasing the expression of the sunflower HaGRAS19 gene in the plants.

[0036] In a third aspect, the present invention provides an application of the sunflower HaGRAS19 gene in cultivating plant varieties with abiotic stresses, and the nucleotide sequence of the sunflower HaGRAS19 gene is as shown in SEQ ID NO.1.

[0037] Preferably, the method of the application is: selecting plant varieties tolerant to abiotic stresses by increasing the expression of the sunflower HaGRAS19 gene in the plants.

[0038] In a fourth aspect, the present invention provides a method for cultivating transgenic plants tolerant to abiotic stress environments, comprising the following steps: Transferring the sunflower HaGRAS19 gene as shown in SEQ ID NO.1 into plants to obtain transgenic plants tolerant to abiotic stress environments.

[0039] Based on the above application of the HaGRAS19 gene, it can provide new gene resources for cultivating new plant varieties with high stress resistance, and further realize the method for cultivating transgenic plants resistant to abiotic stress environments as described above, that is, transferring the sunflower HaGRAS19 gene shown in SEQ ID NO.1 into plants to obtain transgenic plants resistant to abiotic stress environments. The above method for cultivating transgenic plants resistant to abiotic stress environments has important popularization and application value in the cultivation of plant germplasms resistant to abiotic stress and agricultural production.

[0040] Specifically, the nucleotide sequence of the sunflower HaGRAS19 gene is shown in SEQ ID NO.1.

[0041] Specifically, the amino acid sequence of the protein encoded by the sunflower HaGRAS19 gene is shown in SEQ ID NO.2.

[0042] Example 1 In this example, a silencing vector of the HaGRAS19 gene was constructed and genetically transformed to clarify the function of this gene in sunflowers by silencing the HaGRAS19 gene in sunflowers. The specific steps are as follows: (1) Design a pair of specific primers using the cDNA sequence specific to the coding region of the HaGRAS19 gene with the nucleotide sequence shown in SEQ ID NO.1, and amplify the target gene by PCR technology. Among them, the PCR reaction system is shown in Table 1; the PCR amplification program is shown in Table 2; the specific primers are: HaGRAS19-F: ATGATTAGATCATACGGAAATCCAG; HaGRAS19-R: TTACCTCCAAGCCGAAGCGACGACC.

[0043] Table 1 PCR reaction system Table 2 PCR amplification program (2) The pTRV2 vector can be obtained through existing technologies. It is a commonly used vector in the plant virus-induced gene silencing (VIGS) technology. pTRV2 is part of the tobacco rattle virus (TRV) binary vector system, which consists of two vectors, pTRV1 and pTRV2. The pTRV2 vector carries a partial target gene. When it is co-introduced into plant cells with pTRV1, it will trigger the RNA silencing mechanism in the plant, resulting in the inhibition of the expression of the target gene. Thus, the function of the target gene can be studied by observing the phenotypic changes of the plant. In this step, the amplified partial target gene is cloned into the pTRV2 vector to construct the gene silencing vector pTRV2-HaGRAS19. Specifically: The pTRV2 plant silencing vector is digested with two restriction endonucleases, EcoR I and BamH I, to linearize it and the linearized vector fragment is recovered. Using the ligation enzyme OK Clon DNA Ligation Kit, the linearized vector fragment is ligated with a partial fragment in the target fragment to obtain the target recombinant plasmid pTRV2-HaGRAS19, which is the HaGRAS19 gene silencing vector. Among them, the nucleotide sequence of the ligated partial fragment is shown as SEQ ID NO.2, with a length of 297bp. Among them, the schematic diagram of the pTRV2 vector is as Figure 1 , and the PCR system for the ligation process is shown in Table 3. The reaction conditions for the ligation process are: 50°C for 10 min.

[0044] Table 3 Ligation system PCR Reaction System: Sample Loading Volume 5X OK Clon Master Mix 2.0μL Linearized Vector 1.0μL Insert DNA fragment 1.0μL RNase free water 6.0μL Total 10.0μL (3) The recombinant plasmid pTRV2-HaGRAS19 is transferred into Escherichia coli, and the positive clone Escherichia coli carrying pTRV2-HaGRAS19 is screened out. Specifically: Take 100 μL of competent Escherichia coli cells melted on ice in a centrifuge tube, add the target recombinant plasmid, mix gently, and let it stand on ice for 30 min; after heat shock in a 42°C water bath for 45 s, quickly transfer it to an ice bath and let it stand for 2 min; add 700 μL of sterile liquid medium (LB medium) without antibiotics to the centrifuge tube, mix well, and resuscitate at 37°C and 200 rpm for 60 min; aspirate 100 μL of the liquid medium in the resuscitated centrifuge tube and spread it evenly on the LB solid medium containing kanamycin resistance. Invert the plate and place it in a 37°C incubator for overnight (12 hours) culture; screen out the positive clone carrying pTRV2-HaGRAS19, and the strain with kanamycin resistance is the positive clone.

[0045] (4) Introduce the positive bacterial solution with the recombinant plasmid pTRV2-HaGRAS19 obtained in step (3) into Agrobacterium tumefaciens GV3101 for subsequent infection to obtain silenced plants. Specifically: Mix 1 μL of the positive bacterial solution with 100 μL of Agrobacterium tumefaciens GV3101 competent cells. After thorough mixing, let it stand on ice for 5 min, then treat it with liquid nitrogen for 5 min, immediately treat it in a 37 °C water bath for 5 min, and place it on ice again for 5 min to cool. Then add 700 μL of LB liquid medium without antibiotics to the mixture, and then recover and culture it on a shaker at 28 °C for 2 h. Finally, spread the culture on a solid medium containing kanamycin and rifampicin for screening, and screen out the strains with dual resistance to kanamycin and rifampicin, which are the Agrobacterium tumefaciens GV3101 successfully transformed with the recombinant plasmid pTRV2-HaGRAS19.

[0046] (5) Expand the culture of Agrobacterium tumefaciens GV3101 successfully transformed with the recombinant plasmid pTRV2-HaGRAS19 obtained in step (4) to prepare the bacterial solution of Agrobacterium tumefaciens GV3101 transformed with the recombinant plasmid TRV2-HaGRAS19. Specifically: Pick a monoclonal on the screening plate and put it into 3 mL of liquid medium with kanamycin and rifampicin antibiotics, and culture it on a shaker at 28 °C for 12 h to obtain the bacterial solution of Agrobacterium tumefaciens GV3101 containing the recombinant plasmid TRV2-HaGRAS19.

[0047] (6) Refer to the preparation method of the bacterial solution of Agrobacterium tumefaciens GV3101 transformed with the recombinant plasmid pTRV2-HaGRAS19 to prepare the bacterial solutions of Agrobacterium tumefaciens GV3101 transformed with TRV1 and the bacterial solution of Agrobacterium tumefaciens GV3101 transformed with TRV2 respectively. The preparation methods of the bacterial solution of Agrobacterium tumefaciens GV3101 transformed with TRV1 and the bacterial solution of Agrobacterium tumefaciens GV3101 transformed with TRV2 are the same as the preparation method of the bacterial solution of Agrobacterium tumefaciens GV3101 transformed with the recombinant plasmid pTRV2-HaGRAS19.

[0048] Example 2 In this example, the creation and identification of sunflower plants with silenced HaGRAS19 gene were carried out, and the performance of the sunflower plants was detected and verified. The specific steps are as follows: (1) Select plump sunflower seeds, remove their outer shells, and soak them in ultrapure water for 3 days, changing the water several times during this period until the sunflower seeds absorb water and swell. Scratch slender wounds on both sides of the swollen sunflower seeds. Randomly divide the sunflower seeds into 2 groups. One group is soaked in the mixed bacterial solution of Agrobacterium tumefaciens transformed with TRV1 and Agrobacterium tumefaciens transformed with TRV2 as the control group, named the EV group. Among them, the bacterial solution of Agrobacterium tumefaciens transformed with TRV1 and the bacterial solution of Agrobacterium tumefaciens transformed with TRV2 are mixed according to a volume ratio of 1:1, and the bacterial solution concentration is OD600 = 0.7; Another group was soaked in a mixed bacterial solution of Agrobacterium tumefaciens transformed with TRV1 and Agrobacterium tumefaciens transformed with TRV2-HaGRAS19, serving as the silencing group, named the VI::HaGRAS19 group. Among them, the Agrobacterium tumefaciens solution transformed with TRV1 and the Agrobacterium tumefaciens solution transformed with TRV2-HaGRAS19 were mixed at a volume ratio of 1:1, and the concentration of the bacterial solution was OD 600 = 0.7. The two groups of sunflower seeds were soaked in the bacterial solution for 6 hours. Among them, three vacuum treatments were performed at 5 hours of soaking, each lasting 10 minutes. Then, the paper bed was moistened with 30 mL of ultrapure water, and the soaked sunflower seeds were evenly spread on the moistened paper bed and grown for 3 days. After growing for 3 days, the sunflower seeds grew roots and leaves, and then they were transferred to Hoagland nutrient solution diluted to 1 / 5 of the original concentration and cultured for 12 days. After culturing for 12 days, the phenotypes of the sunflower plants in the EV group and the VI::HaGRAS19 group were as Figure 2 shown. Figure 2 Among them, the left figure is a comparison diagram of the phenotypes of sunflowers before and after silencing. It can be seen from the figure that the root length of the EV group as the control group is longer, and the fullness of the leaves of the control group and the silencing group is basically the same; through statistics, as Figure 2 shown in the right figure in, there are no significant differences in the fresh weight, stem length, and leaf length between the control group and the silencing group, and the root length of the EV group is significantly longer than that of the VI::HaGRAS19 group.

[0049] (2) PCR amplification was performed using TRV1-specific primers to identify the silenced lines. The gel diagram of sunflower silencing identification was as Figure 3 shown. It can be seen from this that the TRV1 and TRV2 plasmids have been successfully transferred into the control group and the silencing group respectively. Before the treatment, the expression levels of the HaGRAS19 gene in the two groups of sunflower lines were also detected, and the results are shown in Figure 4 . It can be seen from Figure 4 that the expression level of the control group is higher than that of the silencing group.

[0050] The sunflower lines of the control group and the silencing group were treated with polyethylene glycol or salt. The composition of the treatment solution for salt treatment was 0.252 g of Hoagland nutrient solution, 0.189 g of calcium salt, and 11.7 g of NaCl added to 1 L of ddH2O, and the treatment time was 24 h. The composition of the treatment solution for polyethylene glycol treatment was 0.252 g of Hoagland nutrient solution, 0.189 g of calcium salt, and 200 g of PEG added to 1 L of ddH2O, and the treatment time was 12 h.

[0051] After the polyethylene glycol and salt treatments, the phenotypes of the sunflower lines of the control group and the silencing group were observed respectively, and the results were as Figure 5 shown. It can be seen from Figure 5It can be seen that the leaves of the sunflower lines in the silencing group showed a wilted state, while the leaves of the sunflower lines in the control group were more plump and had sufficient water. This indicates that the sunflower lines in the silencing group are more salt-intolerant, and also that the silencing group is more drought-intolerant.

[0052] After polyethylene glycol and salt treatments, the water loss rates of the leaves of the two groups of sunflower lines were also detected respectively. The results are shown in Figure 6 , where the upper figure shows the water content rates of the leaves of the two groups of sunflower lines relative to the untreated ones at different times under polyethylene glycol treatment, and the lower figure shows the water content rates of the leaves of the two groups of sunflower lines relative to the untreated ones at different times under salt treatment. From Figure 6 it can be seen that the water loss rate of the sunflower lines in the silencing group increased significantly. After 24 hours of salt treatment, the relative water content rate of the control group was 59%, while that of the silencing group was 50%. After 12 hours of polyethylene glycol treatment, the relative water content rate of the control group was 66%, while that of the silencing group was 55%.

[0053] After polyethylene glycol and salt treatments, DAB and NBT staining of the leaves of the two groups of sunflower lines were also carried out to detect the content and distribution of ROS. The results are shown in Figure 7 . From Figure 7 it can be seen that there were obvious differences in the reactive oxygen species content between the silencing group and the control group, and the ROS staining color of the lines in the silencing group was deeper. This indicates that the lines in the silencing group were more severely affected by salt stress.

[0054] Example 3 In this example, the construction of an overexpression vector of the HaGRAS19 gene and genetic transformation were carried out to further verify the function of this gene in sunflowers by overexpressing the HaGRAS19 gene in sunflowers. The specific steps are as follows: The target gene of the HaGRAS19 gene with the nucleotide sequence shown in SEQ ID NO.1 was amplified by PCR technology, and the operation was the same as that in step (1) of Example 1.

[0055] (2) The 688-GFP vector can be obtained by existing technologies. It is a commonly used vector in plant gene overexpression technology. The 688-GFP vector carries the target gene. When it is introduced into plant cells, it will trigger the gene overexpression mechanism in plants, resulting in an increase in the expression level of the target gene. Thus, the function of the target gene can be studied by observing the phenotypic differences of plants. In this step, the amplified target gene was cloned into the 688-GFP vector to construct the gene overexpression vector 688-GFP-HaGRAS19. Specifically: The 688-GFP plant overexpression vector was linearized by BamH I restriction endonuclease and the linearized vector fragment was recovered. The linearized vector fragment was ligated with the target fragment using the OK Clon DNA Ligation Kit to obtain the target recombinant plasmid 688-GFP-HaGRAS19, which is the HaGRAS19 gene overexpression vector. The schematic diagram of the 688-GFP vector is shown in the figure below. Figure 8 The PCR system of the ligation process is the same as that in Table 3, and the reaction conditions of the ligation process are: 50°C, 10 min.

[0056] (3) The recombinant plasmid 688-GFP-HaGRAS19 was transformed into Escherichia coli, and positive clones of Escherichia coli carrying 688GFP--HaGRAS19 were screened out, specifically: Take 100 μL of competent Escherichia coli cells melted on ice into a centrifuge tube, add the target recombinant plasmid, mix gently, and let it stand on ice for 30 minutes; after heat shock in a 42°C water bath for 45 seconds, quickly transfer to an ice bath and let it stand for 2 minutes; add 700 μL of sterile liquid culture medium (LB medium) without antibiotics to the centrifuge tube, mix well, and resuscitate at 37°C and 200 rpm for 60 minutes; draw 100 μL of the liquid culture medium in the resuscitated centrifuge tube and evenly spread it on the LB solid culture medium containing kanamycin resistance, and place the plate upside down in a 37°C incubator overnight (12 hours) for culture; screen out positive clones with 688-GFP-HaGRAS19, and the strain with kanamycin resistance is the positive clone.

[0057] (4) The positive bacterial solution containing the recombinant plasmid 688-GFP-HaGRAS19 obtained in step (3) was introduced into Agrobacterium tumefaciens GV3101 for subsequent infection to obtain silent plants. Specifically, 1 μL of the positive bacterial solution was mixed with 100 μL of Agrobacterium GV3101 competent cells. After thorough mixing, the mixture was allowed to stand on ice for 5 minutes, followed by liquid nitrogen treatment for 5 minutes, followed by treatment in a 37°C water bath for 5 minutes, and then placed on ice again for 5 minutes to cool; then 700 μL of antibiotic-free LB liquid culture medium was added to the mixture, and then the culture was resumed on a shaker at 28°C for 2 hours; finally, the culture was spread on a solid culture medium containing kanamycin and rifampicin for screening, and a strain with dual resistance to kanamycin and rifampicin was screened out, which was the Agrobacterium tumefaciens GV3101 successfully introduced with the recombinant plasmid 688-GFP-HaGRAS19.

[0058] (5) The Agrobacterium tumefaciens GV3101 that has successfully transferred the recombinant plasmid 688-GFP-HaGRAS19 obtained in step (4) is cultured on a large scale to prepare a bacterial solution of Agrobacterium tumefaciens GV3101 into which the recombinant plasmid 688-GFP-HaGRAS19 has been transferred. Specifically: Pick a monoclonal on the screening plate and place it in 3 mL of liquid medium containing kanamycin and rifampicin antibiotics, and culture it overnight for 12 hours in a shaker at 28°C.

[0059] Example 4 In this example, the creation and identification of sunflower plants with overexpression of the HaGRAS19 gene are carried out, and the performance of the sunflower plants is detected and verified. The specific steps are as follows: (1) Select plump sunflower seeds, remove their outer shells, soak them in ultrapure water for 3 days, changing the water several times during this period until the sunflower seeds absorb water and swell. Transfer the swollen sunflower seeds to a paper bed for 3 days until roots grow, and then transfer them to 1 / 5×Hoagland nutrient solution for hydroponic cultivation until the sunflowers grow two true leaves. Divide the sunflowers into two groups. One group is soaked in the Agrobacterium bacterial solution of 688-GFP, with the OD of the bacterial solution 600 = 0.7, as the control group, named the EV group; the other group is soaked in the Agrobacterium tumefaciens GV3101 bacterial solution into which the recombinant plasmid 688-GFP-HaGRAS19 has been transferred, with the OD of the bacterial solution 600 = 0.7, as the overexpression group, named the GFP-HaGRAS19 group. The two groups of sunflower seeds are soaked in 100 mL of the infection solution, and after 3 vacuum treatments, they are put back for hydroponic cultivation. After 2 days of hydroponic cultivation, take the two groups of sunflower lines for polyethylene glycol or salt treatment. The composition of the treatment solution for salt treatment is 0.252 g of Hoagland nutrient solution, 0.189 g of calcium salt, and 11.7 g of NaCl added to 1 L of ddH2O, and the treatment time is 24 h. The composition of the treatment solution for polyethylene glycol treatment is 0.252 g of Hoagland nutrient solution, 0.189 g of calcium salt, and 200 g of PEG added to 1 L of ddH2O, and the treatment time is 15 h.

[0060] (2) After salt treatment, take the two groups of sunflower lines for phenotypic observation, and the results are as Figure 9 shown. It can be seen from Figure 9 that the leaves of the sunflower lines in the control group show partial wilting, while the leaves of the sunflower lines in the overexpression group are plump and have sufficient moisture. This shows that the sunflower lines in the overexpression group are more salt-tolerant.

[0061] (3) After polyethylene glycol treatment, take the two groups of sunflower lines for phenotypic observation, and the results are as Figure 10 shown. It can be seen from Figure 10It can be seen that the leaves of the sunflower lines in the control group mostly showed a wilted state, while the leaves of the sunflower lines in the overexpression group were plump and had sufficient moisture. This indicates that the sunflower lines in the overexpression group are more drought-tolerant.

[0062] (4) After treatment with polyethylene glycol or salt, the relative water content (compared with before treatment) of the leaves of the two groups of sunflower lines at different times was also detected. The results showed that after 24 hours of salt treatment, the relative water content of the leaves of the sunflower lines in the overexpression group was 79%, and that of the control group was 59%. The relative water content of the leaves in the overexpression group increased significantly compared with the control group, being 134% of the control group. The relative water content of the sunflower lines in the overexpression group increased significantly compared with the control group, being 134% of the control group; after 15 hours of polyethylene glycol treatment, the relative water content of the sunflower lines in the overexpression group was 175% of the control group. This shows that the ability of the sunflower lines in the overexpression group to resist saline-alkali stress and drought stress has been significantly enhanced.

[0063] In the present invention, the composition of the LB liquid medium is: 10 g of peptone, 5 g of yeast extract, and 10 g of NaCl.

[0064] In the present invention, the composition of the LB solid medium is: 10 g of peptone, 5 g of yeast extract, 10 g of NaCl, and 15 g of agar.

[0065] The Hoagland nutrient solution used in the examples of the present invention was purchased commercially from Shanghai Lianmai Biotech Co., Ltd.

[0066] In the present invention, the raw materials and equipment used, unless otherwise specified, are common raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are conventional methods in the art.

[0067] The above are only the preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent transformations made to the above embodiments based on the technical essence of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. Application of sunflower HaGRAS19 gene in improving abiotic stress tolerance of plants, characterized in that: The nucleotide sequence of the sunflower HaGRAS19 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that: The amino acid sequence of the encoded protein of the sunflower HaGRAS19 gene is shown in SEQ ID NO.

2.

3. The application according to claim 1, wherein: The method of the application is: increasing the expression level of the sunflower HaGRAS19 gene in plants.

4. Use of the sunflower HaGRAS19 gene in enhancing the stress resistance of plants to abiotic stresses, characterized in that: The nucleotide sequence of the sunflower HaGRAS19 gene is shown in SEQ ID NO.

1.

5. The application according to claim 4, characterized in that: The method of the application is: increasing the stress resistance of plants to abiotic stress by increasing the expression of the sunflower HaGRAS19 gene in plants.

6. Use of the sunflower HaGRAS19 gene in cultivating plant varieties with abiotic stress resistance, characterized in that: The nucleotide sequence of the sunflower HaGRAS19 gene is shown in SEQ ID NO.

1.

7. The application according to claim 6, characterized in that: The method of the application is: breeding plant varieties resistant to abiotic stress by increasing the expression of the sunflower HaGRAS19 gene in plants.

8. A method for cultivating transgenic plants resistant to abiotic stress environments, characterized in that: Comprising the following steps: Transferring the sunflower HaGRAS19 gene shown in SEQ ID NO.1 into plants to obtain transgenic plants resistant to abiotic stress environments.