SNP (Single Nucleotide Polymorphism) molecular marker related to laying number of pigeons as well as application and breeding method
By screening out the genotypes of specific SNP molecular markers in pigeons, early selection and precise breeding are achieved, which solves the problem of slow breeding speed of pigeons' egg laying and improves breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202510716234.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2025-07-29
AI Technical Summary
In the prior art, pigeon egg laying breeding technology has long generation cycles and slow genetic progress, making it difficult to achieve accurate breeding. The lack of effective molecular markers limits the breeding speed and accuracy.
A SNP molecular marker located at base 12137558 of chromosome 4 of colLiv2, pigeon reference genome was developed, and the pigeon's genotype was detected by PCR amplification and sequencing, and A/A or A/G genotype individuals were screened out, and G/G genotype individuals were eliminated to achieve early selection and improve breeding accuracy.
The pigeon breeding progress has been accelerated, the breeding effect has been improved, the breeding cost has been saved, the selection of seeds has been enhanced, and the breeding of pigeons and new breeds have been served.
Smart Images

Figure CN120384138A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of pigeon genetic breeding, and particularly relates to an SNP molecular marker related to pigeon egg production number, the application of this SNP molecular marker, and a breeding method for improving pigeon egg production number using this SNP molecular marker. Background Art
[0002] Pigeon egg production number is a key indicator for evaluating the breeding value of breeding pigeons or the egg production of commercial pigeons. It is also an important trait for pigeon breed improvement and new breed cultivation, and has an important impact on the breeding economic benefits of pigeons. Conventional breeding techniques for breeding pigeons have deficiencies such as long generation cycles, slow genetic progress, and difficulty in achieving precise breeding. The use of molecular marker-assisted breeding techniques can improve the selection accuracy of target traits and breeding speed. Currently, there are few genetic markers affecting pigeon egg production number, which limits the application of molecular techniques in breeding, and there is a need to further develop and apply effective molecular markers for breeding. The RPL34 gene encodes a ribosomal protein, which is a component of the 60S subunit. This protein is located in the cytoplasm and belongs to the L34E family of ribosomal proteins. The lymphoid enhancer-binding factor 1 (LEF1) gene encodes a transcription factor that belongs to the protein family homologous to the high-mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T cell receptor-α enhancer, thereby conferring maximum enhancer activity. This transcription factor participates in the Wnt signaling pathway and regulates autophagy of follicular granulosa cells. Therefore, this gene may be related to pigeon egg production number, but there is currently no research and application on the correlation between the RPL34 and LEF1 genes and pigeon egg production number. Summary of the Invention
[0003] One object of the present invention is to provide an SNP molecular marker related to pigeon egg production number, and the nucleotide sequence of this SNP molecular marker is as shown in SEQ ID NO:1 or SEQ ID NO:2.
[0004] The above two nucleotide sequences differ in the base at position 404, that is, the A / G polymorphism at position 12137558 on chromosome 4 of the pigeon reference genome colLiv2.
[0005] Preferably, the pigeon is a white Carneau female pigeon.
[0006] Another object of the present invention is to provide the application of the above SNP molecular marker for judging the high or low of pigeon egg production number.
[0007] Preferably, the detection includes the following steps:
[0008] Step S1: Perform PCR amplification on the DNA sample of the pigeon to be tested to obtain an amplification product;
[0009] Step S2: Sequence the amplification product;
[0010] Step S3: Determine the genotype of the SNP molecular marker according to the sequencing peak map, and determine whether the egg production number of pigeons is high or low. The determination criterion is that the egg production number of pigeons with the A / A or A / G genotype at the 404th base of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is significantly higher than that of individuals with the G / G genotype; or the egg production number of pigeons with the A / A or A / G genotype at the 12,137,558th base on chromosome 4 of the pigeon reference genome colLiv2 is significantly higher than that of individuals with the G / G genotype.
[0011] Preferably, in the step S1, the reaction system for PCR amplification is calculated based on 20 μl:
[0012] 60 ng of DNA of the pigeon to be tested,
[0013] 10 μl of 2×Es Taq MasterMix,
[0014] 1 μl of 10 μM upstream primer F,
[0015] 1 μl of 10 μM downstream primer R,
[0016] Make up to 20 μl with sterile water;
[0017] The sequence of the upstream primer F is as shown in SEQ ID NO:3, and the downstream primer R is as shown in SEQ ID NO:4.
[0018] The reaction conditions for the PCR amplification are pre-denaturation at 95 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 56.5 °C for 30 s, extension at 72 °C for 30 s, for a total of 35 cycles; extension at 72 °C for 10 min; preservation at 4 °C.
[0019] The third object of the present invention is to provide a breeding method for increasing the egg production number of pigeons, which is carried out by detecting the genotype of the 12,137,558th base on chromosome 4 of the pigeon reference genome colLiv2, retaining individuals with the A / A or A / G genotype and eliminating individuals with the G / G genotype.
[0020] Furthermore, retain individuals with the A / A genotype at the 12,137,558th base on chromosome 4 of the pigeon reference genome colLiv2 and eliminate individuals with the G / G genotype.
[0021] The present invention uses whole-genome resequencing technology for SNP genotyping, identifies molecular markers related to the egg production number of pigeons, and based on the discovery of the genotypes of specific SNP molecular markers, it is found that the egg production number of pigeons with A / A or A / G genotypes is significantly higher than that of individuals with G / G genotypes. By using the genomic DNA of the pigeon to be tested as a template, PCR amplification is carried out with specific primer pairs, and then the PCR amplification products are subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotypes of these SNP molecular markers, the high or low egg production number of pigeons can be screened. In breeding, by eliminating individuals with A / G genotypes and G / G genotypes and retaining individuals with A / A genotypes, early selection of egg production number can be achieved, which can improve the accuracy of breeding selection, accelerate the breeding progress, save breeding costs, improve the breeding effect, and better serve the breeding and new variety cultivation of pigeons. Description of the Drawings
[0022] Figure 1 is the result of the genome-wide association analysis of the egg production number of pigeons;
[0023] Figure 2 is the Sanger sequencing result of the PCR amplification products of three genotypes. Detailed Embodiments
[0024] Example 1 Screening of SNP Loci Related to the Egg Production Number of Pigeons
[0025] Eighty pairs of female White Carneau pigeons with relatively consistent week-old ages were selected and raised under the same feeding conditions, with free access to food and water. Egg production data were collected, and the egg production number (only counting the number of eggs of qualified quality) was calculated as phenotypic data. The female pigeons were divided into two groups according to the high or low egg production number. The monthly egg production number of the high egg production group was 4.37 ± 0.43, and the monthly egg production number of the low egg production group was 2.71 ± 0.58.
[0026] DNA was extracted from the blood of the above female pigeons using the TIANamp Genomic Kit (TIANGEN, Beijing, China). The purity of the samples was detected using a NanoDrop TM One spectrophotometer; Qubit The Flurometer was used to detect the concentration of DNA samples, and 1% agarose gel electrophoresis was used to detect the integrity of DNA samples. After the samples passed the detection, the library was constructed according to the instructions of the MGIEasy Fast Enzyme Digestion Library Preparation Reagent Kit V2.0 (MGI, Shenzhen, China). First, the qualified DNA samples were digested and fragmented by enzymes, followed by end repair and adapter ligation. The target fragments were enriched and purified by PCR, and finally, the sequencing library was obtained. The qualified library was circularized, and then DNA nanoballs (DNBs) were prepared using the rolling circle amplification (RCA) technique. Then, the DNBs were loaded onto the sequencing chip through an automatic sample loading system. Finally, DNBSEQ-T7 (MGI, Shenzhen, China) was used for sequencing to obtain 150-bp paired-end sequencing reads.
[0027] After quality control of the sequencing data, SNP extraction and analysis were performed by aligning to the reference genome. Genome-wide association studies (GWAS) detect common genetic variations (single nucleotide polymorphisms, copy number variations, structural variations, etc.) across the entire genome, and then the obtained genotypes are associated with the observed trait phenotypes. Individual kinship and population structure are the main factors causing false-positive associations during the GWAS analysis. To reduce false-positive association results, a mixed linear model (MLM) was used for trait association analysis, with population genetic structure as a fixed effect and individual kinship as a random effect to correct the influence of population structure and individual kinship on the results. The mixed linear model (MLM) used in GWAS analysis:
[0028] y = Xα + Zβ + Wμ + e, where y is the phenotypic trait, X is the indicator matrix of the fixed effect, a is the estimated parameter of the fixed effect; Z is the indicator matrix of SNPs, β is the effect of SNPs; W is the indicator matrix of the random effect, μ is the predicted random individual, and e is the random residual, which follows
[0029] The Kinship matrix was calculated using GEMMA, and the first 3 PCA components were selected as covariates for association analysis. Potential candidate SNP loci were screened through the significance level (P-value) of the association, and the results are shown as Figure 1 shown. By Figure 1It can be seen that the candidate SNP loci with P values less than the threshold are located on chromosomes 3 and 4 respectively. By calculating the SNP gene frequencies of the high and low egg production groups, the target SNP loci are determined according to the difference in gene frequencies. Finally, the present invention selects the SNP locus with the largest difference in gene frequencies of 0.35 between the two groups for verification and annotation, and determines that this locus is located in the intergenic region of RPL34 and LEF1 genes, at the 12,137,558th base of chromosome 4 of the pigeon reference genome colLiv2, with A / G polymorphism.
[0030] Example 2 Correlation analysis between SNP molecular markers and egg production
[0031] Select 300 White Carneau female pigeons with relatively consistent week-old, raise them under the same feeding conditions, with free diet and water. After caging and pairing at 5-6 months of age, collect the egg production data of each cage of pigeons for 12 months (only calculate the number of eggs with qualified quality) as phenotypic data.
[0032] Collect blood from the wing vein of the female pigeons, place it in EDTA anticoagulant, extract genomic DNA using a blood extraction kit, and store it at -20°C after measuring the concentration.
[0033] After diluting the above-extracted DNA, perform PCR reaction. The primer combination is the upstream primer F as shown in SEQ ID NO:3 and the downstream primer R as shown in SEQ ID NO:4. The reaction system is as follows:
[0034] 60 ng of DNA of the pigeon to be tested,
[0035] 10 μl of 2×Es Taq MasterMix (Dye),
[0036] 1 μl of 10 μM upstream primer F,
[0037] 1 μl of 10 μM downstream primer R,
[0038] Make up to 20 μl with sterile water;
[0039] The PCR amplification reaction conditions are pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 56.5°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 10 min; store at 4°C.
[0040] Perform Sanger sequencing on the PCR products of each sample respectively, and the obtained product sequences are as shown in SEQ ID NO:1 or SEQ ID NO:2, and the sequencing peak map is as Figure 2 shown, and thus obtain the genotyping data of the SNP molecular marker at the 12,137,558th base of chromosome 4 of the pigeon reference genome colLiv2.
[0041] The SPSS software was used to perform an AVOVA analysis on the egg production numbers of individuals with different genotypes. The Duncan's multiple comparison method was selected to conduct a statistical analysis on the experimental pigeon population. A P-value less than 0.05 indicates a significant difference, and a P-value less than 0.01 indicates a highly significant difference. The results are shown in Table 1. As can be seen from Table 1, the egg production numbers of the SNP molecular marker A / A and A / G genotype female pigeons were significantly higher than those of the G / G genotype female pigeons (P<0.05).
[0042] Table 1 Average egg production numbers of individuals with different genotypes
[0043] Genotype Number of individuals (pcs) Average egg production AA 120 <![CDATA[4.33±0.42 a > AG 110 <![CDATA[4.14±0.37 a <!-- 3 -->]]> GG 70 <![CDATA[2.92±0.72 b >
[0044] Note: 1. Data in the same column with the same superscript letter indicate no significant difference, and data with different superscript letters indicate a significant difference (P<0.05); 2. In pigeon egg production, a double-female pairing method is adopted, and each pigeon wears a leg ring. For both the high and low egg production groups, 4 eggs are selected per clutch to ensure that each cage contains double-female pigeons. The egg production numbers of each female pigeon are recorded. The egg production numbers in the table are the monthly average egg production numbers of each female pigeon (qualified egg numbers, excluding unqualified eggs such as soft eggs).
[0045] SEQ ID NO:1
[0046] ACCACTGTGACCTGTATATCTTTGTTTTATTGGTATCCATACTTTGGGGGTACTTTCTGAAAGGTCAATATATATTCCGTGTAAGTCAAGAATATACAAAACCTGTAGCATGATACGGAGATGGCAGGAAGACGGGGAACATAGAGGGGCCTCAAGGTTTTGAGCTTTAATCTGTGAAGCAGCAAAGGGCAAAATCCAGAACTTGAAGTTAGAAATGACATTGGTTTATCAAGACAGCCAAAAGACAAGAAACCACTGAGATGAAGAGAATGGCTGAGCTGAGAGCCTGCAGTGTTGTGGAAAGTTCTCCAAAAGTTCGAATGGCAACATCAGGAAGATATCACACATATTCCAACCCACAGCAGTAGAAAGCATGGAGGGATGCCCTGGATTCACCCACAAT ATAGGGTAACAAGACCCACAGACTGAAAATGTCGACATTCACACTCCCTGCTTAATACTAAATCCTCCTGAGTTACTGTTGGAGTGAAAAGTGATTCAACCACAGCTGGTGACATCATCTGGATCTTCCCAAGACCAAAGCAAAACATTGACTGGATACTCCCAAGAAGAAAGTGAAATAGTATCTAAACATTATCATATTTTACGTGCTATGCTAAATGCTTTTAATATATTCACATTAATTTGATTCCAAAGACACAAAATCGTTCCTGAGTTATCCCTACCAGACATATTTATACTAGGAAGATTCTCTTTTCCCCCTTTATTTCCTAAATTTCTAGCTTCTAAGTTACACAGATTGCTATGAACTTTCTTGGGGCTTTCGTACCCATCTCTCATATCCTCTTTTGTCTGTGTGGATTTTTGTTTTTGTTTGTATAATAATTGTTTTTACTTGCAGGTATTTTCTTTAAAAATAATACAATCCTCTTTTCCAAATGTCAGTTCTAGCTTTCTGCTGCCTCAGAAATTGTTTCTACCCAGCTTTCAATTCCGTTTAAAATCCTTTCCTCCAGCTGATTTGTCCCATAACCATTCATGAGGGGCACCCTCCATCCTCTGTCAGTGCTGCTGCTGGGGCTGGGAATACCCATGGGGAGCTTTGATTTGTCATGCCCCACTAAAATAAGTGTTGGTGTCCAGACCACCAAGGACTAGATGATCTTTTGAGGTCCCTTCCAATCCCTAACATTCTGTGATTCTGTGACAGCTGGGCCTCCAACATGTGTTTGAAGAGTGATGGAGACA
[0047] SEQ ID NO:2
[0048] ACCACTGTGACCTGTATATCTTTGTTTTATTGGTATCCATACTTTGGGGGTACTTTCTGAAAGGTCAATATATATTCCGTGTAAGTCAAGAATATACAAAACCTGTAGCATGATACGGAGATGGCAGGAAGACGGGGAACATAGAGGGGCCTCAAGGTTTTGAGCTTTAATCTGTGAAGCAGCAAAGGGCAAAATCCAGAACTTGAAGTTAGAAATGACATTGGTTTATCAAGACAGCCAAAAGACAAGAAACCACTGAGATGAAGAGAATGGCTGAGCTGAGAGCCTGCAGTGTTGTGGAAAGTTCTCCAAAAGTTCGAATGGCAACATCAGGAAGATATCACACATATTCCAACCCACAGCAGTAGAAAGCATGGAGGGATGCCCTGGATTCACCCACAAT GCAGGGTAACAAGACCCACAGACTGAAAATGTCGACATTCACACTCCCTGCTTAATACTAAATCCTCCTGAGTTACTGTTGGAGTGAAAAGTGATTCAACCACAGCTGGTGACATCATCTGGATCTTCCCAAGACCAAAGCAAAACATTGACTGGATACTCCCAAGAAGAAAGTGAAATAGTATCTAAACATTATCATATTTTACGTGCTATGCTAAATGCTTTTAATATATTCACATTAATTTGATTCCAAAGACACAAAATCGTTCCTGAGTTATCCCTACCAGACATATTTATACTAGGAAGATTCTCTTTTCCCCCTTTATTTCCTAAATTTCTAGCTTCTAAGTTACACAGATTGCTATGAACTTTCTTGGGGCTTTCGTACCCATCTCTCATATCCTCTTTTGTCTGTGTGGATTTTTGTTTTTGTTTGTATAATAATTGTTTTTACTTGCAGGTATTTTCTTTAAAAATAATACAATCCTCTTTTCCAAATGTCAGTTCTAGCTTTCTGCTGCCTCAGAAATTGTTTCTACCCAGCTTTCAATTCCGTTTAAAATCCTTTCCTCCAGCTGATTTGTCCCATAACCATTCATGAGGGGCACCCTCCATCCTCTGTCAGTGCTGCTGCTGGGGCTGGGAATACCCATGGGGAGCTTTGATTTGTCATGCCCCACTAAAATAAGTGTTGGTGTCCAGACCACCAAGGACTAGATGATCTTTTGAGGTCCCTTCCAATCCCTAACATTCTGTGATTCTGTGACAGCTGGGCCTCCAACATGTGTTTGAAGAGTGATGGAGACA
[0049] SEQ ID NO:3
[0050] ACCACTGTGACCTGTATATCTTTGT
[0051] SEQ ID NO:4
[0052] TGTCTCCATCACTCTTCAAACACA
Claims
1. SNP molecular markers related to the number of pigeon eggs laid, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1 or SEQ ID NO:
2.
2. Use of the SNP molecular marker related to the number of pigeon eggs laid according to claim 1, characterized in that: It is used to judge the high or low number of eggs laid by pigeons.
3. Application of the SNP molecular marker in detecting the number of eggs laid by pigeons, wherein the SNP molecular marker is the A / G polymorphism at the 12,137,558th base on chromosome 4 of the pigeon reference genome colLiv2.
4. The SNP molecular marker according to claim 1 or the application according to claim 2 or 3, characterized in that The pigeon is a white Carneau female pigeon.
5. The application according to claim 2 or 3, characterized in that The detection includes the following steps: Step S1: Perform PCR amplification on the DNA sample of the pigeon to be tested to obtain an amplification product; Step S2: Sequence the amplification product; Step S3: Judge the genotype of the SNP molecular marker according to the sequencing peak map and judge the high or low number of eggs laid by pigeons. The judgment criterion is that the number of eggs laid by pigeons with the A / A or A / G genotype at the 404th base of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 is significantly higher than that of individuals with the G / G genotype, or the number of eggs laid by pigeons with the A / A or A / G genotype at the 12,137,558th base on chromosome 4 of the pigeon reference genome colLiv2 is significantly higher than that of individuals with the G / G genotype.
6. The application according to claim 5, wherein: In step S1, the reaction system of the PCR amplification is 20 μl: 60 ng of DNA of the pigeon to be tested, 10 μl of 2×Es Taq MasterMix, 1 μl of 10 μM upstream primer F, 1 μl of 10 μM downstream primer R, Make up to 20 μl with sterile water; The sequence of the upstream primer F is shown in SEQ ID NO: 3, and the downstream primer R is shown in SEQ ID NO: 4; The reaction conditions for the PCR amplification are pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 56.5°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 10 min; storage at 4°C.
7. A breeding method for increasing the egg production of pigeons, characterized in that Selective breeding is carried out by detecting the genotype of the 12,137,558th base on chromosome 4 of the pigeon reference genome colLiv2, and individuals with the A / A or A / G genotype are retained while individuals with the G / G genotype are eliminated.
8. The breeding method according to claim 7, characterized in that Retain individuals with the A / A genotype at the 12,137,558th base on chromosome 4 of the pigeon reference genome colLiv2 and eliminate individuals with the G / G genotype and A / G genotype.