On-site synchronous quantitative determination method for three pathogenic bacteria in marine sediment

Abstract

The invention relates to an on-site synchronous quantitative determination method for three pathogenic bacteria in marine sediments, and belongs to the technical field of pathogenic bacteria detection.The three pathogenic bacteria are vibrio parahaemolyticus, vibrio alginolyticus and escherichia coli O157, and the method comprises the steps that marine sediment samples are collected and put into a centrifugal tube filled with sterile seawater, and are evenly mixed and centrifuged; taking the supernate as a template for LAMP amplification, respectively adding the supernate into detection tubes of an LAMP reaction system preloaded with the three pathogenic bacteria, and sealing. Placing the detection tube into a detection channel of a portable electronic isothermal gene amplification instrument, and determining a delta C4-t curve, a dv / dt-t curve and Tp; and after the determination is finished, substituting the Tp value into a working curve formula to calculate the content / concentration of the three pathogenic bacteria of the corresponding marine sediment sample in the detection tube. According to the method disclosed by the invention, Bst DNA polymerase and betaine are not needed in the reaction, so that the cost of LAMP analysis is reduced by at least 50%, the operation is simple and convenient, and simultaneous quantitative determination of the three pathogenic bacteria can be completed on site within 1h.

Description

[0001] This patent claims the priority of the patent with the patent number 202510299821.8 and the patent title "On-site synchronous quantitative determination method for three pathogenic bacteria in marine sediments", which was applied for on March 14, 2025. Technical Field

[0002] The present invention belongs to the technical field of pathogenic bacteria detection, and particularly relates to an on-site synchronous quantitative determination method for three pathogenic bacteria in marine sediments. Background Art

[0003] Marine sediments refer to the solid particulate matter deposited on the seabed under the action of factors such as water bodies, climate, and geological activities in the marine environment. These sediments contain rich microbial communities, including bacteria, archaea, fungi, and protists, etc. Among them, Vibrio parahaemolyticus (V. parahaemolyticus), Vibrio alginolyticus (V. alginolyticus), and Escherichia coli O157 (E. coli O157) are common aquatic pathogenic bacteria in marine sediments.

[0004] V. parahaemolyticus mainly exists in the marine and coastal environments. Consuming seafood contaminated by it (such as oysters and sashimi) can cause food poisoning, manifested as symptoms of acute gastroenteritis, including diarrhea, abdominal pain, nausea, vomiting, and fever. In severe cases, it may lead to life-threatening complications. V. alginolyticus is a Gram-negative bacterium, mainly existing in seawater and seafood, and has high pathogenicity. It can infect the human body by consuming contaminated seafood or through skin wound contact with seawater, causing clinical symptoms such as severe skin infections, soft tissue infections, and septicemia, and may even lead to shock or death. Although E. coli is usually associated with the intestine, it can also be detected in the marine environment, possibly originating from sewage discharge, animal feces, or other pollution sources. Its presence in the marine environment has potential impacts on the hygiene and safety of seawater and seafood.

[0005] Methods for detecting bacteria in marine sediments, whether based on "cell separation - culture" or "gene extraction - analysis", rely on a large number of devices and professional laboratories. The most common plate counting method and PCR method both have limitations in terms of efficiency - they require the separation and purification of bacteria, followed by cultivation and identification, or obtaining DNA through complex nucleic acid extraction steps and then performing machine measurements. This often takes more than 24 hours and is difficult to achieve on - site detection goals in marine or field environments. Moreover, sediment particles have a great impact on bacterial separation and DNA extraction, resulting in poor accuracy and reproducibility of the results. Loop - mediated Isothermal Amplification (LAMP) technology has significant advantages compared to traditional gene analysis techniques (such as PCR and its various temperature - variable gene amplification derivatives, as well as gene sequencing, etc.) - not only is the instrument portable, with low energy consumption, high efficiency, and good specificity, but it also has a certain tolerance for the presence of biological macromolecules such as cell debris and humus in the system, thus providing the possibility for on - site qualitative and quantitative determination of microorganisms in the environment. However, currently, it is still difficult to achieve on - site qualitative and quantitative determination of pathogenic microorganisms in marine sediments using LAMP technology because the existing optical detection results that can quantify LAMP results are often interfered by particulate matter from sediments. Moreover, the common LAMP system requires Bst DNA polymerase, which is not only expensive but also unstable and easily inactivated under ship - board and field experimental conditions. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a method for on - site synchronous quantitative determination of V.parahaemolyticus, V.alginolyticus, and E.coli O157 in marine sediments. The method of the present invention can complete the synchronous detection of V.parahaemolyticus, V.alginolyticus, and E.coli O157 in marine sediments within 1 hour.

[0007] The working principle of the method of the present invention is as follows: At the target site (on the ship or on the shore), a 1 mL sediment sample is taken using a disposable tubular sterile sampler and squeezed into a sterile centrifuge tube pre-filled with 9 mL of sterile artificial seawater, manually shaken, and then centrifuged at room temperature to precipitate the particulate matter. The supernatant in the centrifuge tube is used as the template for LAMP amplification. After adding 3 μL of the template to a disposable test tube containing a special LAMP reaction system (using polysorbate monooleate (Tween 80) instead of betaine and Bst DNA polymerase), the test tube is placed in a portable electronic isothermal gene amplifier based on the principle of capacitive coupling non-contact conductivity, and an amplification reaction is carried out at 58 °C for 50 min. During the LAMP amplification process, when nucleotides polymerize to form double-stranded DNA, magnesium pyrophosphate and hydrogen ions are generated, and these products will cause a change in the capacitive coupling non-contact conductivity value (C 4 ) of the reaction system. This change value (ΔC 4 ) is recorded in real time by the electronic isothermal gene amplifier. By plotting the relationship curve between ΔC 4 and time t during the LAMP reaction process, a kinetic curve of the biochemical process (ΔC 4 -t curve) is established. The electronic isothermal gene amplifier automatically takes the first derivative of the ΔC 4 -t curve and reports the reaction rate curve (dv / dt-t curve). The peak value T p of the dv / dt-t curve is the time point of the maximum rate of the LAMP biochemical reaction. T p has a linear relationship with the log value of the bacterial content in the sediment sample. The relationship function between the bacteria in the template and the peak value T p is analyzed by linear regression method, and a quantitative analysis method for microbial marker genes is established to determine the target bacteria.

[0008] The present invention is realized by the following technical solutions:

[0009] A method for on-site synchronous quantitative determination of three pathogenic bacteria in marine sediments, the method is for non-disease diagnosis and prevention purposes, and the method is as follows:

[0010] Step 1: Collect marine sediment samples and put them into a centrifuge tube containing sterile seawater, mix well and centrifuge, and take the supernatant as the template for LAMP amplification;

[0011] Step 2: Take the supernatant and add it separately to the test tubes pre-loaded with the LAMP reaction systems of V. parahaemolyticus, V. alginolyticus, and E. coli O157, and seal them; after adding the template, the concentrations of primers VP-F3 and VP-B3 in the V. parahaemolyticus test tube are both 0.2 μmol / L, the concentrations of VP-FIP and VP-BIP are both 1.6 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / mL;

[0012] In the V. alginolyticus test tube, the concentrations of primers VA-F3 and VA-B3 are both 0.2 μmol / L, the concentrations of VA-FIP and VA-BIP are both 1.6 μmol / L, the concentration of VA-LB is 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / mL;

[0013] In the test tube of E. coli O157, the concentrations of primers EC-F3 and EC-B3 are both 0.2 μmol / L, the concentrations of EC-FIP and EC-BIP are both 1.6 μmol / L, the concentrations of EC-LF and EC-LB are 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / mL;

[0014] Step 3: Place the test tubes into the detection channels of the portable electronic isothermal gene amplification instrument to measure the ΔC 4 -t curve, dv / dt-t curve, and T p ; Instrument working parameters: temperature is 58 °C, excitation voltage is 19 V, excitation frequency is 4 MHz, ΔC 4 The acquisition period is 1 s, and the acquisition duration is 50 min;

[0015] Step 4: After the ΔC 4 -t curve, dv / dt-t curve, and T p are measured, substitute the T p value into the working curve formula to calculate the concentrations of V. parahaemolyticus, V. alginolyticus, and E. coli O157 in the corresponding marine sediment samples in the disposable test tubes: The working curve regression equations for the three bacteria are respectively:

[0016] V. parahaemolyticus: T p(s) = -197.51 log C (CFU / mL) + 1857.5 (R 2 = 0.9971);

[0017] V. alginolyticus: T p (s) = -267.05 log C (CFU / mL) + 2584.5 (R 2 = 0.9706);

[0018] E. coli O157: T p (s) = -199.11 log C (CFU / mL) + 1770.7 (R 2 = 0.9998).

[0019] Furthermore, the primer sequences of V. parahaemolyticus are respectively (5'-3'):

[0020] VP-F3: GACTGCCATTCATTTGATGT (SEQ ID NO.1);

[0021] VP-B3: ACTCGTATGAGAACGTGAC (SEQ ID NO.2);

[0022] VP-FIP: ATGTAGGCCAGGGTGCGGATATGGCGATGGTGGCATTG (SEQ ID NO.3);

[0023] VP-BIP: CCGCTCTGGGTAATGGTCGTTTCTAACGCTGCGCTTGCTC. (SEQ ID NO.4);

[0024] The primer sequences of E. coli O157 are respectively (5'-3'):

[0025] EC-F3: GGTGGAATGGTTGTCACGA; (SEQ ID NO.5);

[0026] EC-B3: TGGACTTGTACAAGACTGTTGA; (SEQ ID NO.6);

[0027] EC-FIP: AACGTCATGCCAATATTGCCTATGTATGACAAAACACTTTATGACCGT; (SEQ IDNO.7);

[0028] EC-BIP: GGATGACAAATATCTGCGCTGCTATTCAGCAATTTCACGTTTTCGTGATAT; (SEQ ID NO.8);

[0029] EC-LF: CAGCTAATCCTTGGCCTTTAAAATG(SEQ ID NO.9);

[0030] EC-LB: TAGCCCAGTTAGAACAAGCTGAT(SEQ ID NO.10);

[0031] The primer sequences of V. alginolyticus are respectively (5'-3'):

[0032] VA-F3: CAGCACGCGTACTTACCG; (SEQ ID NO.11);

[0033] VA-B3: TCAGCACCGATTGATGACG; (SEQ ID NO.12);

[0034] VA-FIP: TTGCGCATATACCAGTGCTGGGTTTTCAAGTGACCCAGTGGCTTAC; (SEQ ID NO.13);

[0035] VA-BIP: TGGGCAGTGGAACGAGCAATTTTTTTCCTCAGAGCAAAATCGCCTA; (SEQ ID NO.14);

[0036] VA-LB: AACCAAACAGACCTTGCCGA, (SEQ ID NO.15).

[0037] Furthermore, prepare the working curves for amplifying the three kinds of bacteria by the portable electronic isothermal gene amplifier in advance.

[0038] The beneficial effects of the present invention compared with the prior art:

[0039] (1) Simple operation: After the sediment sample is mixed and centrifuged, the obtained supernatant is directly loaded into a disposable test tube as the template for LAMP, without further purification and DNA extraction steps; the electronic isothermal gene amplifier automatically measures the LAMP reaction process and gives the T p data, without other auxiliary operations;

[0040] (2) On-site detection: Except for the portable electronic isothermal gene amplifier and the portable centrifuge, no other instrument equipment is required, nor is it necessary to carry bioenzymes that are easily inactivated, making it possible to conduct on-site measurements on the shore and on the ship;

[0041] (3) High efficiency: The total time from sampling to obtaining the contents of V. parahaemolyticus, V. alginolyticus, and E. coli O157 in the sediment does not exceed 1 h.

[0042] (4) Low cost: Since the reaction does not require Bst DNA polymerase and betaine, the cost of LAMP detection is reduced by at least 50%. Description of the Drawings

[0043] Figure 1 ΔC measured by the portable electronic isothermal gene amplification instrument 4 -t curve graph: a. Positive in the experimental group with enzyme; b. Positive in the enzyme-free experimental group, containing 0.3 mmol / L Tween 80; c. Positive in the enzyme-free experimental group, containing 0.35 mmol / L Tween 80; d. Positive in the enzyme-free experimental group, containing 0.4 mmol / L Tween 80; e. Positive in the enzyme-free experimental group, containing 0.25 mmol / L Tween 80; f. Positive in the enzyme-free experimental group, containing 0.2 mmol / L Tween 80; g. Positive in the enzyme-free experimental group, containing 0.15 mmol / L Tween 80; h. Positive in the enzyme-free experimental group, containing 0.1 mmol / L Tween 80; i. Negative in the enzyme-free experimental group; j. Negative in the experimental group with enzyme.

[0044] Figure 2 dv / dt-t curve and T measured by the portable electronic isothermal gene amplification instrument p Graph: a. Positive in the experimental group with enzyme; b. Positive in the enzyme-free experimental group, containing 0.3 mmol / L Tween 80; c. Positive in the enzyme-free experimental group, containing 0.35 mmol / L Tween 80; d. Positive in the enzyme-free experimental group, containing 0.4 mmol / L Tween 80; e. Positive in the enzyme-free experimental group, containing 0.25 mmol / L Tween 80; f. Positive in the enzyme-free experimental group, containing 0.2 mmol / L Tween 80; g. Positive in the enzyme-free experimental group, containing 0.15 mmol / L Tween 80; h. Positive in the enzyme-free experimental group, containing 0.1 mmol / L Tween 80; i. Negative in the enzyme-free experimental group; j. Negative in the experimental group with enzyme.

[0045] Figure 3Gel electrophoresis diagram of the LAMP reaction solution. Among them, M is the marker, lane 1 - negative for the experimental group with enzyme; lane 2 - positive for the experimental group with enzyme; lane 3 - positive for the experimental group without enzyme, containing 0.15 mmol / L Tween 80; lane 4 - positive for the experimental group without enzyme, containing 0.2 mmol / L Tween 80; lane 5 - positive for the experimental group without enzyme, containing 0.25 mmol / L Tween 80; lane 6 - positive for the experimental group without enzyme, containing 0.3 mmol / L Tween 80; lane 7 - positive for the experimental group without enzyme, containing 0.35 mmol / L Tween 80; lane 8 - positive for the experimental group without enzyme, containing 0.4 mmol / L Tween 80;

[0046] Figure 4 dv / dt-t curve diagram of V. parahaemolyticus with gradient concentrations measured by a portable electronic isothermal gene amplifier: a, 5.0×10 6 CFU / mL; b, 5.0×10 5 CFU / mL; c, 5.0×10 4 CFU / mL; d, 5.0×10 3 CFU / mL; e, 5.0×10 2 CFU / mL; f, 5.0×10 1 CFU / mL; g, negative control;

[0047] Figure 5 dv / dt-t curve diagram of V. alginolyticus with gradient concentrations measured by a portable electronic isothermal gene amplifier: a, 5.0×10 6 CFU / mL; b, 5.0×10 5 CFU / mL; c, 5.0×10 4 CFU / mL; d, 5.0×10 3 CFU / mL; e, 5.0×10 2 CFU / mL; f, 5.0×10 1 CFU / mL; g, negative control;

[0048] Figure 6 dv / dt-t curve diagram of E. coli O157 with gradient concentrations measured by a portable electronic isothermal gene amplifier: a, 5.0×10 6 CFU / mL; b, 5.0×10 5 CFU / mL; c, 5.0×10 4 CFU / mL; d, 5.0×10 3 CFU / mL; e, 5.0×10 2 CFU / mL; f, 5.0×10 1 CFU / mL; g, negative control;

[0049] Figure 7 is the linear regression curve graph of the logarithm of the initial inoculation concentration of V. parahaemolyticus in the sediment sample and T p ;

[0050] Figure 8 is the linear regression curve graph of the logarithm of the initial inoculation concentration of V. alginolyticus in the sediment sample and T p ;

[0051] Figure 9 is the linear regression curve graph of the logarithm of the initial inoculation concentration of E. coli O157 in the sediment sample and T p ;

[0052] Figure 10 is the ΔC 4 -t curve graph of V. parahaemolyticus, V. alginolyticus and E. coli O157 in the marine sediment sample measured by the portable electronic isothermal gene amplification instrument;

[0053] Figure 11 is the dv / dt-t curve and T p graph of V. parahaemolyticus, V. alginolyticus and E. coli O157 in the marine sediment sample measured by the portable electronic isothermal gene amplification instrument. Detailed implementation manners

[0054] The content of the present invention will be further explained below through embodiments, but the protection scope of the present invention is not limited by any form of the embodiments.

[0055] Embodiment 1: Performance verification and optimization of the enzyme-free LAMP reaction system

[0056] Tween 80 is used to replace betaine and Bst DNA polymerase in the traditional LAMP system, and combined with the portable electronic isothermal gene amplification instrument, an enzyme-free LAMP reaction system is established.

[0057] The ERG832 type portable electronic isothermal gene amplification instrument (product of eDAQ Company, Australia) is a temperature-controlled gene amplification instrument based on the principle of capacitive coupling non-contact conductivity detection. The temperature control range is 25 - 60 °C, the heating rate ≥ 1 °C / min, the temperature control accuracy is ±0.2 °C, the conductivity working window is 0.1 - 20.0 mS / cm, the response sensitivity ≥ 250 mV / mS / cm, the detection excitation voltage is 19 V, the excitation frequency is 4 MHz, ΔC 4 The acquisition period is 1 s, and ΔC is automatically output 4-t curve, dv / dt-t curve and T p 。

[0058] Step 1. Preparation of the template for the LAMP reaction system: Inoculate V. parahaemolyticus (ATCC 17802) into TCBS liquid medium (product of Qingdao Haibo Biotechnology Co., Ltd.), place it in a Herocell C1S incubator (product of Shanghai Rundu Biotechnology Co., Ltd.), and culture it with shaking (120 r / min) at 37 °C for 18 h. Then take it out, place it in an Optima XL-90 centrifuge (product of Beckman Coulter), centrifuge at 4 °C for 7 min (5,000×g), resuspend and wash the precipitated bacteria 3 times with physiological saline, and then resuspend the obtained bacteria in physiological saline to form a bacterial suspension with a concentration of about 10 8 CFU / mL. Use a DEN-1B turbidimeter (product of Dongfang Huabo Technology Co., Ltd.) to measure the exact concentration of the bacterial suspension (OD 600 = 0.1 corresponds to 10 8 CFU / mL).

[0059] Step 2. Preparation of the test sample. Place about 200 mL of marine sediment in an SN-PF2 non-contact cell crusher (product of Shenzhen Keli Yixiang Instrument and Equipment Co., Ltd.), and process it for 20 min under the conditions of 50 kHz and 1800 W to lyse the microbial cells therein and completely destroy the DNA, so that the DNA in the sediment sample cannot be recognized and amplified by the primers, and prepare a sediment sample of inactivated microorganisms and amplifiable DNA. Press the open end of a disposable tubular sterile sampler (product of Qingdao Gufeng Experimental Instruments Co., Ltd.) into the above-mentioned processed sediment sample, pull it out and level the port with a sterile scalpel (No. 20, product of Huaiyin Medical Devices Co., Ltd.), take 1 mL of sediment sample, and then squeeze the push rod and squeeze it into a 10 mL sterile centrifuge tube (product of Millipore) pre-filled with 8.9 mL of sterile artificial seawater. Then use a single-channel pipette (range 0 - 1.0 mL, product of Eppendorf) to aspirate 0.1 mL of the bacterial suspension prepared in Step 1 and add it to this centrifuge tube, and manually oscillate for 1 min to prepare a simulated marine sediment with a bacterial concentration of 10 6 CFU / mL. Centrifuge the simulated sample at room temperature for 4 min (3,000×g) to precipitate the particulate matter, take the supernatant in the centrifuge tube as the template for LAMP amplification, and set it aside.

[0060] Step 3. Preparation for the LAMP experiment:

[0061] In the enzyme-containing experimental group, the LAMP reaction system mixture (total volume: 75 μL): the concentrations of primers VP-F3 and VP-B3 were both 0.2 μmol / L, the concentrations of VP-FIP and VP-BIP were both 1.6 μmol / L, the concentration of dNTPs was 1.4 mmol / L, the concentration of MgSO4 was 2.0 mmol / L, the concentration of Bst 2.0 DNA polymerase was 0.32 U / μL, the concentration of betaine was 5 mmol / L, and 3 μL of the LAMP amplification template prepared in Step 1 was added. Ultra-pure water was used to replace the LAMP amplification template as the negative control.

[0062] In the enzyme-free experimental group, the LAMP reaction system mixture (total volume: 75 μL): the concentrations of primers VP-F3 and VP-B3 were both 0.2 μmol / L, the concentrations of VP-FIP and VP-BIP were both 1.6 μmol / L, the concentration of dNTPs was 1.4 mmol / L, the concentration of MgSO4 was 2.0 mmol / L, and 3 μL of the LAMP amplification template prepared in Step 1 was added. In this group, different amounts of Tween 80 were added to 8 experimental test tubes, and their final concentrations were 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, and 0.4 mmol / L respectively. Ultra-pure water was used to replace the LAMP amplification template as the negative control.

[0063] Step 4. Determination of the LAMP kinetic curve and T p The reaction solutions of the enzyme-containing experimental group, the enzyme-free experimental group, and the negative control were respectively filled into a disposable U-shaped glass test tube (outer diameter 1.0 mm, 0.8 mm, length 180.0 mm, product of Qingdao Elf Instruments Co., Ltd.), and sealed with a rubber stopper (product of Qingdao Elf Instruments Co., Ltd.). The test tubes were respectively placed into a detection channel of an ERG832 type portable electronic isothermal gene amplification instrument. Set the instrument working parameters as excitation voltage 19 V, excitation frequency 4 MHz, ΔC 4 The acquisition period was 1 s, the acquisition duration was 50 min, and the temperature was 58 °C. Click "Start" to measure the ΔC 4 -t curve, dv / dt-t curve and T p . The results are as Figure 1 and Figure 2 shown.

[0064] Step 5. Result analysis: In the enzyme-containing experimental group, the LAMP reaction positive system showed an "S-shaped" ΔC 4-t curve and "bell-shaped" dv / dt-t curve, while the corresponding negative shows a horizontal line, indicating that 1) using the supernatant prepared in Step 1 as the LAMP amplification template, combining the LAMP biochemical system specified by industry standards with a portable electronic isothermal gene amplification instrument, and driving the DNA amplification biochemical reaction with Bst2.0 DNA polymerase, V. parahaemolyticus can be analyzed by identifying and amplifying the marker gene of V. parahaemolyticus; 2) this experimental system is not contaminated and the results are credible.

[0065] In the enzyme-free experimental group, the positive LAMP reaction system showed an "S-shaped" ΔC 4 -t curve and "bell-shaped" dv / dt-t curve, while the corresponding negative shows a horizontal line. Moreover, ΔC 4 -t curve and dv / dt-t curve are related to the concentration of Tween 80. The results show that 1) using the supernatant prepared in Step 1 as the LAMP amplification template, combining the enzyme-free LAMP biochemical system with a portable electronic isothermal gene amplification instrument, V. parahaemolyticus can also be analyzed by identifying and amplifying the marker gene of V. parahaemolyticus; 2) when the concentration of Tween 80 in the LAMP biochemical system is 0.3 mmol / L, the analysis efficiency is the highest; 3) this experimental system is not contaminated and the results are credible.

[0066] The amplification products were analyzed by 1.2% agarose gel electrophoresis (the electrophoresis instrument is model DYY-11, produced by Liuyi Instrument Factory, Beijing), and photographed using a DNR gel imaging system (MF-ChemiBis 3.2, Israel). The results are as Figure 3 shown, indicating that the DNA fragment lengths of the amplification products of the LAMP reaction in the enzyme-containing experimental group and the enzyme-free experimental group are the same.

[0067] Step 6: Determine the optimized enzyme-free LAMP reaction system as follows: the concentrations of primers VP-F3 and VP-B3 are both 0.2 μmol / L, the concentrations of VP-FIP and VP-BIP are both 1.6 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the Tween concentration is 0.3 mmol / L.

[0068] Example 2: Establishment of the standard working curve

[0069] Step 1. Standard strain culture: Inoculate V. parahaemolyticus (ATCC 17802) and V. alginolyticus (ATCC 27562) into TCBS liquid medium (product of Qingdao Haibo Biotechnology Co., Ltd.) respectively, place them in a Herocell C1S type incubator (product of Shanghai Rundu Biotechnology Co., Ltd.), and culture them with shaking (120 r / min) at 37 °C for 18 h. Inoculate E. coli O157 (ATCC 35150) into LB liquid medium (product of Qingdao Haibo Biotechnology Co., Ltd.), place it in an incubator, and culture it at 37 °C for 18 h. Then take it out, place it in an Optima XL-90 type centrifuge (product of Beckman Coulter), centrifuge at 4 °C for 7 min (5,000×g), resuspend and wash the precipitated bacteria 3 times with physiological saline, and then resuspend the obtained bacteria in physiological saline to form a bacterial suspension with a concentration of about 10 8 CFU / mL. Use a DEN-1B turbidimeter (product of Dongfang Huabo Technology Co., Ltd.) to measure the exact concentration of the bacterial suspension (OD 600 = 0.1 corresponds to 10 8 CFU / mL), and then dilute it 10-fold in 6 concentration gradients to form a series of bacterial suspensions with the contents of V. parahaemolyticus, V. alginolyticus and E. coli O157 all being 5.0×10 8 、5.0×10 7 、5.0×10 6 、5.0×10 5 、5.0×10 4 and 5.0×10 3 CFU / mL.

[0070] Step 2. Remove microorganisms and DNA from marine sediment samples: Place about 200 mL of marine sediment in an SN-PF2 type non-contact cell crusher (product of Shenzhen Keli Yixiang Instrument Equipment Co., Ltd.), and process it for 20 min under the conditions of 50 kHz and 1800 W to lyse the microbial cells therein and completely destroy the DNA, so that the DNA in the sediment sample cannot be recognized and amplified by primers, thereby preparing a sediment sample without microorganisms and DNA.

[0071] Step 3. Preparation of artificially contaminated samples: Press the open end of a disposable tubular sterile sampler (product of Qingdao Gufeng Experimental Instrument Co., Ltd.) into the above-pretreated sediment sample free of microorganisms and DNA. After pulling it out, use a sterile scalpel (No. 20, product of Huaiyin Medical Instrument Co., Ltd.) to level the port, and obtain 1 mL of sediment sample. Then, squeeze the push rod and inject it into a 10 mL sterile centrifuge tube (product of Millipore) pre-filled with 8.9 mL of sterile artificial seawater. Next, use a single-channel pipette (range 0 - 1.0 mL, product of Eppendorf) to aspirate 0.1 mL of bacterial suspension with a concentration of 5.0×10 8 CFU / mL and add it to this centrifuge tube, and manually oscillate for 1 min to prepare a simulated marine sediment with a bacterial content of 5.0×10 6 CFU / mL. Prepare simulated marine sediment samples with bacterial contents of 5.0×10 5 、5.0×10 4 、5.0×10 3 、5.0×10 2 、5.0×10 1 CFU / mL in the same way.

[0072] Step 4. Preparation of LAMP templates: Centrifuge the simulated marine sediment samples with bacterial contents of 5.0×10 6 、5.0×10 5 、5.0×10 4 、5.0×10 3 、5.0×10 2 、5.0×10 1 CFU / mL at room temperature for 4 min (3,000×g) to precipitate the particulate matter. Take the supernatant in the centrifuge tubes respectively, and record them as ST6, ST5, ST4, ST3, ST2, and ST1 in sequence, which are used as templates for LAMP amplification.

[0073] Step 5. Prepare the LAMP biochemical system: For the reaction mixture with a total volume of 75 μL, after adding the template, in the V.parahaemolyticus detection tube, the concentrations of primers VP-F3 and VP-B3 are 0.2 μmol / L, the concentrations of VP-FIP and VP-BIP are 1.6 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, the concentration of Tween 80 is 0.3 mmol / L, and in addition, it includes 3 μL of the supernatant (ST6, ST5, ST4, ST3, ST2 or ST1) as the template; in the V.alginolyticus detection tube, the concentrations of primers VA-F3 and VA-B3 are 0.2 μmol / L, the concentrations of VA-FIP and VA-BIP are 1.6 μmol / L, the concentration of VA-LB is 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, the concentration of Tween 80 is 0.3 mmol / L, and in addition, it includes 3 μL of the supernatant (ST6, ST5, ST4, ST3, ST2 or ST1) as the template; in the E.coli O157 detection tube, the concentrations of primers EC-F3 and EC-B3 are 0.2 μmol / L, the concentrations of EC-FIP and EC-BIP are 1.6 μmol / L, the concentrations of EC-LF and EC-LB are 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, the concentration of Tween 80 is 0.3 mmol / L, and in addition, it includes 3 μL of the supernatant (ST6, ST5, ST4, ST3, ST2 or ST1) as the template. Unless otherwise specified, ultrapure water is used as the negative control in the experiment. The test sample and the negative control are respectively loaded into a U-shaped disposable glass test tube (outer diameter 1.0 mm, 0.8 mm, length 180.0 mm, product of Qingdao Elf Instrument Co., Ltd.) and sealed with a rubber stopper (product of Qingdao Elf Instrument Co., Ltd.).

[0074] The LAMP primer group sequences of E.coli O157, V.parahaemolyticus and V.alginolyticus respectively refer to Parts 2, 5 and 12 of the LAMP Detection Method for Pathogenic Bacteria in Export Foods - SN / T 2754.2 - 2011, the industry standard of the People's Republic of China for entry - exit inspection and quarantine. The primer sequences of V.parahaemolyticus, V.alginolyticus and E.coli O157 are as follows:

[0075] V.parahaemolyticus marker gene primer sequences (5’-3’):

[0076] VP-F3: GACTGCCATTCATTTGATGT;

[0077] VP-B3: ACTCGTATGAGAACGTGAC;

[0078] VP-FIP: ATGTAGGCCAGGGTGCGGATATGGCGATGGTGGCATTG;

[0079] VP-BIP: CCGCTCTGGGTAATGGTCGTTTCTAACGCTGCGCTTGCTC.

[0080] V. alginolyticus marker gene primer sequences (5'-3'):

[0081] VA-F3: CAGCACGCGTACTTACCG;

[0082] VA-B3: TCAGCACCGATTGATGACG;

[0083] VA-FIP: TTGCGCATATACCAGTGCTGGGTTTTCAAGTGACCCAGTG

[0084] GCTTAC;

[0085] VA-BIP: TGGGCAGTGGAACGAGCAATTTTTTTCCTCAGAGCAAAAT

[0086] CGCCTA;

[0087] VA-LB: AACCAAACAGACCTTGCCGA.

[0088] E. coli O157 marker gene primer sequences (5'-3'):

[0089] EC-F3: GGTGGAATGGTTGTCACGA;

[0090] EC-B3: TGGACTTGTACAAGACTGTTGA;

[0091] EC-FIP: AACGTCATGCCAATATTGCCTATGTATGACAAAACACTTTATGACCGT;

[0092] EC-BIP: GGATGACAAATATCTGCGCTGCTATTCAGCAATTTCACG

[0093] TTTTCG TGATAT;

[0094] EC-LF: CAGCTAATCCTTGGCCTTTAAAATG;

[0095] EC-LB: TAGCCCAGTTAGAACAAGCTGAT。

[0096] Step 6. Determine the LAMP amplification curve and reaction kinetic parameters: Place the disposable glass test tubes into the detection channels of the ERG832 type electronic isothermal gene amplification instrument (product of eDAQ Company, Australia) respectively, and set the working parameters of the instrument as excitation voltage 19V, excitation frequency 4MHz, ΔC 4 acquisition period 1s, acquisition duration 50 min, temperature 58 °C. Click "Start" to measure the ΔC 4 -t curve, dv / dt-t curve and T p . The dv / dt-t curves of V.parahaemolyticus, V.alginolyticus and E.coli O157 are respectively as Figure 4 、 Figure 5 and Figure 6 shown.

[0097] Step 7. Develop the working curves for the determination of each bacterium: Plot the logarithm of the bacterial concentration logC (CFU / mL) in the marine sediment samples against T p to establish the standard working curves with linear relationships, which are respectively as Figure 7 、 Figure 8 and Figure 9 shown. Therefore, the quantitative detection regression equations for these 3 bacteria are as follows respectively:

[0098] V.parahaemolyticus: T p (s) = -197.51logC (CFU / mL) + 1857.5 (R 2 = 0.9971);

[0099] V.alginolyticus: T p (s) = -267.05logC (CFU / mL) + 2584.5 (R 2 = 0.9706);

[0100] E.coli O157: T p (s) = -199.11logC (CFU / mL) + 1770.7 (R 2 = 0.9998).

[0101] Example 3: On-site detection of V. parahaemolyticus, V. alginolyticus and E. coli O157 in sediment samples from Jiaozhou Bay

[0102] Step 1. Sample collection: At the site (120°19.00′; 36°13.50′) in the Manila clam farming area of Jiaozhou Bay, a grab sampler (product of Qingdao Haohai Experimental Instrument Co., Ltd.) was used to collect 0.1 m of surface sediment 2 . Immediately after the sample emerged from the water, a disposable tubular sterile sampler (product of Qingdao Gufeng Experimental Instrument Co., Ltd.) was used to press the open end into the sample for sampling. After pulling out the disposable tubular sterile sampler, a sterile blade (No. 20, product of Huaiyin Medical Instrument Co., Ltd.) was used to level the port, and 1 mL of sediment sample was obtained

[0103] Step 2. Sample pretreatment: The obtained 1 mL of sediment sample was squeezed into a 10 mL sterile centrifuge tube (product of Millipore) pre-filled with 9 mL of sterile artificial seawater, manually shaken for 1 min, and then centrifuged at room temperature for 4 min (3,000×g) to precipitate the particulate matter. The supernatant in the centrifuge tube was used as the template for LAMP amplification

[0104] Step 3. Add 3 μL of the supernatant to each LAMP reaction mixture to prepare 3 reaction systems in total, and measure V. parahaemolyticus, V. alginolyticus, and E. coli O157 respectively. For each reaction mixture with a total volume of 75 μL, after adding the supernatant, the concentrations of primers VP-F3 and VP-B3 in the V. parahaemolyticus detection tube are both 0.2 μmol / L, the concentrations of VP-FIP and VP-BIP are both 1.6 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / L; the concentrations of primers VA-F3 and VA-B3 in the V. alginolyticus detection tube are both 0.2 μmol / L, the concentrations of VA-FIP and VA-BIP are both 1.6 μmol / L, the concentration of VA-LB is 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / L; the concentrations of primers EC-F3 and EC-B3 in the E. coli O157 detection tube are both 0.2 μmol / L, the concentrations of EC-FIP and EC-BIP are both 1.6 μmol / L, the concentrations of EC-LF and EC-LB are 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / L. Place the 3 reaction systems into a disposable glass detection tube and seal them respectively. Meanwhile, use ultrapure water to replace the supernatant as a negative control. The primer sequences of V. parahaemolyticus, V. alginolyticus, and E. coli O157 are shown in Step 5 of Example 2.

[0105] Step 4. Measurement on the machine: Place the disposable glass detection tubes into the detection channels of an ERG832 type electronic isothermal gene amplification instrument (product of eDAQ Company, Australia) respectively, and set the working parameters of the instrument as excitation voltage 19 V, excitation frequency 4 MHz, ΔC 4 acquisition period 1 s, acquisition duration 50 min, and temperature 58 °C. Measure the ΔC 4 -t curve, dv / dt-t curve, and T p , and the results are as Figure 10 and Figure 11 shown.

[0106] Step 5. Calculate the concentrations of the 3 bacteria in the marine sediment sample: For the T corresponding to V. parahaemolyticus, V. alginolyticus, and E. coli O157p Substitute the values into the regression equation:

[0107] V.parahaemolyticus: T p (s) = -197.51 log C (CFU / mL) + 1857.5

[0108] (R 2 = 0.9971);

[0109] V.alginolyticus: T p (s) = -267.05 log C (CFU / mL) + 2584.5 (R 2 = 0.9706);

[0110] E.coli O157: T p (s) = -199.11 log C (CFU / mL) + 1770.7 (R 2 = 0.9998);

[0111] The calculated concentrations of V.parahaemolyticus, V.alginolyticus and E.coli O157 in the marine sediment sample are 1.2×10 2 CFU / mL, 0.4×10 2 CFU / mL and 1.1×10 2 CFU / mL, respectively.

Claims

1. A method for on-site synchronous quantitative determination of three pathogenic bacteria in marine sediments, the three pathogenic bacteria being Vibrio parahaemolyticus, Vibrio alginolyticus, and Escherichia coli O157. The method is for non-disease diagnosis and prevention purposes and is characterized in that, The method is as follows: Step 1: Collect marine sediment samples and put them into centrifuge tubes filled with sterile seawater. Mix well and centrifuge, and take the supernatant as the template for LAMP amplification. Step 2: Add the supernatant from Step 1 to the test tubes pre-loaded with the LAMP reaction systems for Vibrio parahaemolyticus, Vibrio alginolyticus, and Escherichia coli O157 respectively and seal them. After adding the supernatant, the concentrations of primers VP-F3 and VP-B3 in the Vibrio parahaemolyticus test tube are both 0.2 μmol / L, the concentrations of VP-FIP and VP-BIP are both 1.6 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / mL. In the Vibrio alginolyticus test tube, the concentrations of primers VA-F3 and VA-B3 are both 0.2 μmol / L, the concentrations of VA-FIP and VA-BIP are both 1.6 μmol / L, the concentration of VA-LB is 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / mL. In the Escherichia coli O157 test tube, the concentrations of primers EC-F3 and EC-B3 are both 0.2 μmol / L, the concentrations of EC-FIP and EC-BIP are both 1.6 μmol / L, the concentrations of EC-LF and EC-LB are 0.8 μmol / L, the concentration of dNTPs is 1.4 mmol / L, the concentration of MgSO4 is 2.0 mmol / L, and the concentration of Tween 80 is 0.3 mmol / mL. Step 3: Insert the detection tube into the detection channel of the portable electronic isothermal gene amplification instrument to measure ΔC 4 -t curve, dv / dt-t curve, and T p ; Instrument working parameters: temperature is 58°C, excitation voltage is 19V, excitation frequency is 4MHz, ΔC 4 acquisition period is 1s, acquisition duration is 50min; Step 4, ΔC 4 -t curve, dv / dt-t curve and T p After the measurement, substitute the T p value into the working curve formula to calculate the contents of Vibrio parahaemolyticus, Vibrio alginolyticus and Escherichia coli O157 in the corresponding marine sediment samples in the test tubes.

2. The method according to claim 1, wherein The regression equations of the working curves for the three bacteria are as follows: Vibrio parahaemolyticus: T p (s) = -197.51 log C (CFU / mL) + 1857.5 (R 2 = 0.9971); Vibrio alginolyticus: T p (s) = -267.05 log C (CFU / mL) + 2584.5 (R 2 = 0.9706); Escherichia coli O157:T p (s)=-199.11logC(CFU / mL)+1770.7(R 2 =0.9998).

3. The method according to claim 2, wherein Before detection, use a portable electronic isothermal gene amplification instrument to establish a working curve for quantitative determination of the three bacteria.

Images