Application of tRF-Glu as target molecule for inducing pyroptosis of cardiac muscle cells by TMAO

Abstract

The invention belongs to the technical field of medical biology, and relates to an application of tRF-Glu as a target molecule of TMAO induced pyroptosis of cardiac muscle cells. The invention provides an application of tRF-Glu as a target molecule in preparation of drugs for inhibiting pyroptosis of myocardial cells induced by TMAO, and also provides an application of a tRF-Glu inhibitor in preparation of drugs for preventing and treating pyroptosis. The tRF-Glu inhibitor provided by the invention can be used as an intervention medicine for repairing after myocardial injury, the pyroptosis level of myocardial cells can be remarkably reduced by inhibiting tRF-Glu expression, and damaged myocardial tissue repairing is activated.

Description

Technical Field

[0001] The present invention belongs to the field of medical biotechnology, and relates to the application of tRF-Glu as a target molecule for TMAO-induced pyroptosis of cardiomyocytes, that is, it relates to the application of tRF-Glu as a target molecule in the preparation of a drug for inhibiting TMAO-induced pyroptosis of cardiomyocytes. Background Art

[0002] tRF&tiRNA (tsRNAs) are a class of tRNA-derived small RNAs, which are novel regulatory RNAs formed by specific cleavage of their precursors, including tRNA-derived fragments (tRFs) and tRNA half-fragments (tiRNAs). Recent studies have confirmed that tsRNAs play biological roles through multiple mechanisms, including the regulation of gene expression, the control of the cell cycle, and the regulation of chromatin and epigenetic modifications. Research shows that the expression profile of tsRNAs changes significantly during the progression of cardiovascular diseases. The level of 5' tRNA-Val in ischemic cardiomyocytes changes significantly, and tsRNAs in plasma are unique markers of cellular stress and biomarkers for cardiac surgery with extracorporeal circulation. Therefore, developing nucleotide molecules derived from tsRNAs for the treatment of myocardial injury and repair has important research value, especially in improving cardiac function and myocardial remodeling.

[0003] Myocardial infarction is one of the main factors for global morbidity and mortality, mainly manifested as irreversible loss of cardiomyocyte function, and ultimately developing into heart failure, seriously affecting the quality of life of patients. The latest research shows that myocardial injury can soon trigger cardiomyocyte pyroptosis and inflammatory regulation. Although the strong inflammatory response triggered by myocardial injury is necessary for heart repair, the loss of a large number of cardiomyocytes will induce irreversible myocardial fibrosis, leading to disorders in the structure and function of cardiac mitochondria, and further aggravating pathological cardiac remodeling. During the cardiovascular pathophysiological process, the translocation of gut microbiota and their metabolites leads to impaired intestinal barrier function and systemic inflammatory responses, further exacerbating myocardial injury.

[0004] Plasma trimethylamine N-oxide (Trimethylamine N-oxide, TMAO) is an endogenous small molecule that has been a hot topic in recent research in the fields of cardiovascular diseases, metabolic diseases, etc. As an intestinal microbial metabolite produced by phosphatidylcholine, elevated plasma trimethylamine N-oxide is independently associated with an increased risk of poor cardiovascular disease prognosis and can trigger the pathological processes of cellular reactive oxygen species, inflammatory signaling pathways, and various metabolic diseases. In patients with chronic cardiovascular diseases such as myocardial infarction and myocardial ischemia, the level of TMAO in the blood is significantly elevated. Reports have shown that excessive TMAO in the human body promotes vascular calcification and myocardial cell damage by activating the NLRP3 inflammasome and NF-κB signaling. Ultrastructurally, TMAO-treated cardiomyocytes exhibit glycogen accumulation, increased mitochondrial fission, and lipofuscin deposition, indicating altered cellular energy metabolism and increased oxidative damage. However, the mechanism of TMAO-induced cardiomyocyte damage and the therapeutic targets have not been elucidated.

[0005] Therefore, it is urgent to identify regulatory molecules related to TMAO-induced myocardial injury through a myocardial infarction injury model, screen and develop a specific tsRNAs nucleotide drug, and then improve and perfect the diagnosis and treatment level of myocardial injury, which will play potential research value and application prospects in the fields of disease prevention, diagnosis, and drug research and development.

[0006] Currently, there are reports that TMAO induces pyroptosis of vascular endothelial cells and exacerbates atherosclerosis in mice. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to provide a new target that can effectively reduce TMAO-induced pyroptosis and cardiac injury of cardiomyocytes.

[0008] To solve the above technical problem, the present invention provides the application of tRF-Glu as a target molecule in the preparation of a drug for inhibiting TMAO-induced pyroptosis of cardiomyocytes, and tRF-Glu is: 5’-TCCCATATGGTCTAGCGGTTAGGATTCCTGG-3’.

[0009] That is, the present invention provides the application of a tRNA-derived small RNA (tRF-Glu) as a target molecule in inhibiting TMAO-induced pyroptosis of cardiomyocytes. Further, the present invention provides the application of a pharmaceutical composition containing a tRF-Glu inhibitor in the prevention and treatment of myocardial pyroptosis and the repair after cardiac injury.

[0010] As an improvement of the application of the present invention: tRF-Glu as a biomarker for TMAO-induced pyroptosis of cardiomyocytes. As a further improvement of the application of the present invention: tRF-Glu as a target for the diagnosis and treatment of myocardial infarction.

[0011] The present invention also provides the use of a tRF-Glu inhibitor in the preparation of a drug for preventing and treating myocardial pyroptosis, and the tRF-Glu inhibitor is: 5’- CCAGGAATCCTAACCGCTAGACCATATGGGA -3’.

[0012] As an improvement of the use of the present invention: the tRF-Glu inhibitor can also be used for the repair after heart injury.

[0013] The tRF-Glu molecule provided by the present invention can be used as a biomarker for TMAO-induced myocardial cell pyroptosis, that is, a new tRF-Glu molecule screened by the present invention can be used as a target for the diagnosis and treatment of myocardial infarction and for the preparation of a drug target for treating cardiovascular diseases, so as to improve the clinical prognosis of myocardial infarction. The method for inhibiting tRF-Glu in vivo is: continuously injecting the tRF-Glu inhibitor antagomir (anta) intravenously in vivo.

[0014] Based on this, the present invention provides a tRF-Glu molecular marker that is significantly up-regulated after myocardial injury. By preparing its inhibitor, it is expected to have the effect of inhibiting myocardial cell pyroptosis after myocardial infarction and thus improving the clinical prognosis of myocardial infarction patients.

[0015] The tRF-Glu inhibitor provided by the present invention can be used as an intervention drug for the repair after myocardial injury. Inhibiting the expression of tRF-Glu can significantly reduce the level of myocardial cell pyroptosis and activate the repair of damaged myocardial tissue. The invention of the tRF-Glu inhibitor effectively alleviates the problems of poor prognosis of myocardial infarction patients and the treatment of heart diseases. Description of the Drawings

[0016] The following further details the specific embodiments of the present invention with reference to the drawings.

[0017] Figure 1 Showing an increase in the detected TMAO level during the high-choline diet of mice.

[0018] Figure 2 To evaluate the therapeutic effect of the tRF-Glu inhibitor, it is the effect of knocking down tRF-Glu in mice on the myocardial infarction area in mice; Figure 2 Among them: A is the Masson staining of mouse heart tissue to evaluate the level of myocardial fibrosis, and B is the quantitative data of the myocardial infarction area.

[0019] Figure 3Based on the mouse tRF&tiRNA-seq sequencing technology, the expression changes of tRF-Glu in the hearts of MI+Cho and MI+Con mice were detected respectively: the effect of tRF-Glu molecules on their mRNA levels during the high-choline diet of mice was detected by real-time fluorescence quantitative RT-qPCR; among them, "Con" was the control group of mice, and "cho" was the mice on high-choline diet; Figure 3 In it: A is the heat map of tsRNAs of the MI+Con group and the MI+cho group, and B is the expression level of tRF-Glu in the mouse heart tissue of the MI+Con group and the MI+cho group.

[0020] Figure 4 It shows that TMAO exacerbates the damage of mouse cardiomyocytes and TMAO exacerbates the pyroptosis of cardiomyocytes; Figure 4 In it: A is the release level of lactate dehydrogenase (LDH) in cardiomyocytes, and B is the expression level of the pyroptosis protein GSDMD in cardiomyocytes.

[0021] Figure 5 After treating cardiomyocytes with TMAO, the effect of TMAO on the mRNA level of tRF-Glu was detected by real-time fluorescence quantitative RT-qPCR; among them, "Control" was the control group of cells, and "TMAO" was the cardiomyocytes treated with TMAO.

[0022] Figure 6 It is about the effect of knocking down tRF-Glu in mice on the protein expression levels of the pyroptosis proteins GSDMD (GSDMD-FL and GSDMD-N) and Caspase1 in the heart. Specific implementation manners

[0023] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments. The described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. The reagents and materials used in the following embodiments can be obtained from conventional biochemical reagent and equipment suppliers without special instructions. The experimental methods used in the following embodiments are all conventional methods in the art without special instructions.

[0024] The present invention provides a biomarker of tRF-Glu in TMAO-induced pyroptosis of cardiomyocytes.

[0025] Preferably, the present invention uses mouse tRF&tiRNA-seq sequencing technology to screen tsRNAs significantly expressed during myocardial injury through expression profiling analysis, so as to determine biomarkers with potential diagnostic and therapeutic value after myocardial infarction. tRF-Glu nucleic acid sequence: 5'-TCCCATATGGTCTAGCGGTTAGGATTCCTGG-3' (SEQ ID NO.1).

[0026] The present invention provides the application of a tRF-Glu inhibitor pharmaceutical composition in blocking pyroptosis and preventing and / or treating heart diseases. Among them, the inhibitor sequence of tRF-Glu: 5'-CCAGGAATCCTAACCGCTAGACCATATGGGA-3' (SEQ ID NO.2).

[0027] Through the research of the present invention, it is found that tRF-Glu is up-regulated in the myocardial infarction tissues of high-choline mice, suggesting that tRF-Glu is involved in the damage function of the heart. By intramuscular injection or tail vein injection of the tRF-Glu inhibitory pharmaceutical composition in mice, the prognosis of myocardial infarction can be effectively alleviated, so as to achieve the purpose of preventing and / or treating heart diseases.

[0028] To help better understand the process and content of the present invention, the following further elaborates on the present invention through specific embodiments and in conjunction with the drawings.

[0029] Example 1: Correlation study on the exacerbation of pathological cardiac remodeling by circulating TMAO I. In this study, 6-8-week-old male C57BL6 / J mice were used. 1.2% (weight%) of choline (2-hydroxy-N,N,N-trimethylammonium) was added to the standard rodent diet as the "choline group (MI+Cho group)"; the standard rodent diet was used as the "control group (MI+Con group)".

[0030] After 3 weeks of high-choline diet in the "choline group" and 3 weeks of standard diet in the "control group", the TMAO levels in their blood were detected as Figure 1 described; according to Figure 1 it can be known that the TMAO level increases during the high-choline diet in mice.

[0031] II. Inhibiting the generation of tRF-Glu in mice An inhibitor of tRF-Glu (antagomir, anta) was designed according to the tRF-Glu sequence. It is a highly efficient blocker for inhibiting endogenous tRF-Glu, with higher stability and inhibitory effect in in vivo experiments. NC is its negative control.

[0032] The tRF-Glu inhibitor is: 5’-CCAGGAATCCTAACCGCTAGACCATATGGGA-3’ (SEQ ID NO.2).

[0033] The NC is: 5’-CAGTACTTTTGTGTAGTACAA-3’ (SEQ ID NO.3).

[0034] The delivery method of the in vivo inhibitor (anta) of tRF-Glu and its control agent (NC) is: Inject the tRF-Glu inhibitor anta or NC into the tail vein of 8-week-old male C57BL / 6 mice, with a single dose of 10 mg / kg per mouse, twice a week for 2 weeks, to obtain mice with low expression of tRF-Glu. Figure 2 Among them, anta represents the in vivo inhibitory mice of tRF-Glu, and NC represents its control.

[0035] Third, perform myocardial infarction surgery on mice fed a high-choline diet for 3 weeks, and evaluate left ventricular function and structure by two-dimensional echocardiography. The specific implementation is as follows: (1) Construction of an adult mouse myocardial infarction model: 6-8-week-old C57BL / 6J mice were maintained with normal respiration by a ventilator, and the left anterior descending branch (LAD) of the coronary artery was ligated 2-3 mm distal to the ascending aorta to establish a mouse myocardial infarction model. Each group of mice was given a high-choline diet.

[0036] Use the in vivo inhibitor (anta) of tRF-Glu and its control (NC) to inhibit the in vivo expression of tRF-Glu by continuous intravenous injection after myocardial infarction. The dosage of the inhibitor and the control is 100 μL per mouse, and the single-dose concentration is 10 mg / kg. After mixing with the neutral lipid material (invivo-siRNA mate) liposome at a ratio of 1:1, it is injected into the mice through the tail vein; the number of injections is 1 time.

[0037] The experimental groups are as follows: Mice that only had the chest opened after 3 weeks of a high-choline diet, named Sham; Mice with LAD ligated after 3 weeks of a high-choline diet, named MI+Cho; Mice with no reduction of tRF-Glu in vivo (negative control small RNA of tRF-Glu injected into the tail vein), and with LAD ligated after 3 weeks of a high-choline diet, named MI+Cho+NC; Mice with reduced tRF-Glu (anta) in vivo, and with LAD ligated after 3 weeks of a high-choline diet, named MI+Cho+anta.

[0038] (2)Measurement of myocardial infarction area: Two weeks after the establishment of the myocardial infarction model (ligation of the LAD), the mice were sacrificed and the hearts were removed. The hearts of the mice in each experimental group of Sham, MI+Cho, MI+Cho+NC, and MI+Cho+anta were removed and fixed in 4% paraformaldehyde. The heart tissues were fixed, dehydrated, cleared, embedded in paraffin, sectioned into paraffin sections, and stained with Masson. The morphological and structural changes of the myocardial tissues were observed under an optical microscope, and the NIH imagej1.6 image analysis software was used to measure the arc lengths of the infarcts in the endocardium and epicardium to calculate the myocardial infarction area. Myocardial infarction area = [(endocardial infarction rate + epicardial infarction rate) / 2]×100.

[0039] The myocardial infarction areas of Sham, MI+Cho, MI+Cho+NC, and MI+Cho+anta are as Figure 2 shown in B of

[0040] In summary, it can be known that inhibiting the expression of tRF-Glu can improve TMAO-induced myocardial injury.

[0041] Example 2: Expression profile characteristics of tRNA-derived tsRNAs small RNAs during high-choline diet in mice.

[0042] I. Set up the following experimental groups: Mice were fed a high-choline diet for 3 weeks; named MI+Cho; Mice were fed a standard diet for 3 weeks; MI+Con.

[0043] II. Screening and analysis of TRF-Glu: Based on the mouse tRF&tiRNA-seq sequencing technology, this study detected the expression levels of tsRNAs in the hearts of MI+Cho and MI+Con mice respectively.

[0044] After sacrificing MI+Cho and MI+Con, the hearts were removed and then subjected to tRF&tiRNA-seq sequencing. Specifically: (1) Heart tissue sample processing and RNA extraction: Use an extraction kit suitable for small RNA enrichment, such as miRNA or small RNA-specific reagents, to ensure the integrity of tRF / tiRNA (usually 18-40 nt). (2) Small RNA enrichment and library preparation: Screen RNA fragments of 18-40 nt using gel electrophoresis or magnetic bead sorting methods (such as BluePippin) to exclude large fragment RNA and rRNA contamination. Synthesize cDNA by reverse transcription and perform limited-cycle PCR amplification to avoid bias caused by over-amplification. (3) High-throughput sequencing: Commonly use the Illumina platform (such as NovaSeq 6000) for paired-end sequencing (PE50 or PE75) to cover the full length of small RNAs and improve alignment accuracy. (4) tRF / tiRNA identification: Use tRNA databases such as tRNAscan-SE or GtRNAdb, combined with tools such as MINTmap or tDRmapper for specific alignment. The obtained results are as shown in Figure 3 shown in A of

[0045] Reverse transcription was performed on the heart tissues of MI+Con and MI+Cho group mice, and the level of tRF-Glu was detected by qRT-PCR. The obtained results are as shown in Figure 3 shown in B of Among them, among the many differentially expressed tsRNAs, the expression level of tRF-1:30-Glu-TTC-2 (tRF-Glu) increased significantly. Therefore, tRF-Glu is a class of small nucleic acid RNAs that this invention focuses on. The nucleic acid sequence of tRF-Glu is shown in SEQ ID NO.1.

[0046] These expression characteristics lay a basic theoretical basis for the subsequent research of this invention, that is, the expression characteristics of tRF-Glu are correlated with pyroptosis of cardiomyocytes.

[0047] Example 3 Isolation and culture of primary mouse cardiomyocytes (1) Put 30 neonatal mouse pups aged 1-2 days into a container, wash them 1-2 times with 75% alcohol, take out the hearts of 30 mouse pups, cut the tissues into pieces with surgical scissors and put them into a conical flask, add lysis solution and digest for 6 min, repeat 6-8 times (the volume of lysis solution used each time is 6 ml, and the lysis solution is 0.2 mg / mL trypsin (Sigma, P-3292) and 1.0 mg / mL type II collagenase (Worthington, LS004176) dissolved in PBS buffer.

[0048] (2) Filter the cell suspension collected in the last lysis in step (1) and continue culturing it in a cell culture dish for 1 - 1.5 h. The culture conditions are 37 °C and 5% carbon dioxide.

[0049] (3) After 24 hours, change to DMEM / F12 medium (i.e., add 10 ml of DMEM / F12 medium to the cells obtained in step (2)), add TMAO (600 μM) and treat the cardiomyocytes for 24 h (this experimental group is named "TMAO"). Then, detect the LDH release of cardiomyocytes ( Figure 4 of A) and the expression level of GSDMD ( Figure 4 of B). After treating the cardiomyocytes for 24 h, collect the cells and detect the expression level of tRF-Glu by RT-qPCR ( Figure 5 ).

[0050] Cancel "add TMAO (600 μM)" and use this as the "control" group; perform corresponding detections as in "TMAO".

[0051] According to Figure 4 and Figure 5 , it can be known that TMAO can promote the expression of tRF-Glu and trigger the occurrence and development of cardiomyocyte pyroptosis.

[0052] Example 4: Evaluation of tRF-Glu inhibitor in cardiomyocyte pyroptosis after myocardial infarction First, use 6 - 8-week-old C57BL / 6J mice to establish a myocardial infarction model after a 3-week high-choline diet.

[0053] Use tRF-Glu to prepare an in vivo inhibitor (anta) and its control (NC). Respectively, inhibit the in vivo expression of tRF-Glu by continuous intravenous injection after myocardial infarction. The experimental groups are Sham, MI+Cho, MI+Cho+NC, MI+Cho+anta, as Figure 6 . The dosage of the inhibitor and the control is 100 μL per mouse, with a concentration of 10 mg / kg. Mix it with a neutral lipid material (invivo-siRNA mate) at a ratio of 1:1 and inject it into the mice via the tail vein. The number of injections is 1 time.

[0054] The specific settings of the above 4 experimental groups are as follows: Perform a sham operation on the mouse with a 3-week high-choline diet by only opening the chest cavity, named Sham; Ligate the LAD of the mouse with a 3-week high-choline diet, named MI+Cho; Mice in which tRF-Glu was not reduced (negative control microRNA for tRF-Glu was injected via tail vein) and placed on a high-choline diet for 3 weeks with LAD ligation were designated MI+Cho+NC; Mice with reduced tRF-Glu (anta) and a high-choline diet for 3 weeks were fed with LAD ligation and named MI+Cho+anta.

[0055] The expression of GSDMD and Caspase1, markers of cell pyroptosis, was detected 2 weeks after myocardial infarction. Figure 6 It can be seen that inhibiting tRF-Glu significantly reduced the area of myocardial infarction in mice and prevented the progression of cell pyroptosis.

[0056] In summary, the present invention reveals a new tsRNA molecule for myocardial injury and pyroptosis, and tRF-Glu plays a key role in the regulation of myocardial cell pyroptosis. Based on the above cardiac function phenotype analysis, the regulatory role of tRF-Glu in myocardial cell pyroptosis and cardiac repair is further clarified. In summary, tRF-Glu is a potential therapeutic target for myocardial cell pyroptosis and cardiac injury. The use of tRF-Glu inhibitors effectively improves cardiac systolic and diastolic function, reduces myocardial fibrosis, and can provide an ideal drug for achieving long-term prognosis in patients with myocardial infarction.

[0057] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples and is subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention are considered to be within the scope of protection of the present invention.

Claims

1. Use of tRF-Glu as a target molecule in the preparation of a drug for inhibiting TMAO-induced pyroptosis of cardiomyocytes, characterized in that The tRF-Glu is: 5’-TCCCATATGGTCTAGCGGTTAGGATTCCTGG-3’.

2. The application according to claim 1, wherein: tRF-Glu serves as a biomarker for TMAO-induced pyroptosis of cardiomyocytes.

3. The application according to claim 1, wherein: tRF-Glu serves as a target for the diagnosis and treatment of myocardial infarction.

4. Use of a tRF-Glu inhibitor in the preparation of a drug for preventing and treating myocardial pyroptosis, characterized in that The tRF-Glu inhibitor is: 5’-CCAGGAATCCTAACCGCTAGACCATATGGGA-3’.

5. The application according to claim 4, wherein: The tRF-GlT inhibitor can also be used for the repair after cardiac injury.

Images