Protein dBrPRPL1 for regulating and controlling golden yellow leaf color of Chinese cabbage, coding gene and application of protein dBrPRPL1

By cloning and verifying the dBrPRPL1 gene, the technical difficulties in controlling the color of golden leaves of Chinese cabbage were solved, and the color control and quality improvement of the color control and provide genetic resources for color-leafed Chinese cabbage breeding.

CN120399019APending Publication Date: 2025-08-01HEBEI AGRICULTURAL UNIV.
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510614816.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

The lack of effective genes to regulate the golden leaf color of Chinese cabbage in the prior art has affected the cultivation of Chinese cabbage appearance and nutritional quality.

Method used

The protein dBrPRPL1 and its encoding gene that regulates the golden leaf color of Chinese cabbage were cloned and verified. The dBrPRPL1 gene was extracted from the EMS mutants through PCR technology, and its function was verified using qRT-PCR and VIGS technology. It was found that the BrPRPL1 gene plays a key role in regulating leaf color formation.

Benefits of technology

The successful regulation of the color of Chinese cabbage leaves significantly reduced the expression of key photosynthesis proteins, achieved yellowing of Chinese cabbage leaves, provided a theoretical basis for gene editing, and laid the foundation for cultivating new varieties of Chinese cabbage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120399019A_ABST
    Figure CN120399019A_ABST
Patent Text Reader

Abstract

The invention discloses application of a protein dBrPRPL1 for regulating and controlling the leaf color of Chinese cabbage and a coding gene to cultivation of a colored-leaf Chinese cabbage variety with golden yellow leaf color, a specific primer is designed, and a gene is cloned from an EMS mutant of the Chinese cabbage with golden yellow leaf color by utilizing a PCR (Polymerase Chain Reaction) technology and is named as dBrPRPL1; qRT-PCR analysis shows that the expression quantity of the gene in a mutant plant in the rosette stage is obviously lower than that of a wild plant, and the expression quantity of dBrPRPL1 in other stages has no obvious difference between the mutant plant and the wild plant; the Chinese cabbage containing the dBrPRPL1 gene shows golden yellow leaf color in the seedling stage, the rosette early stage and the rosette stage, and grows slowly; the BrPRPL1 is silenced, the leaves of the plant are yellow, and the leaves of a control plant are still green. Therefore, the dBrPRPL1 is a key gene for regulating and controlling the golden leaf color of the Chinese cabbage, can be used as a gene resource for improving the leaf color of the plant, can realize precise design and breeding of plant gene editing, and has important theoretical significance and application value in the aspects of creating new germplasm and improving yield and quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a protein dBrPRPL1 for regulating the golden leaf color of Chinese cabbage, a coding gene and applications thereof. Background Art

[0002] Chinese cabbage ( Brassica rapa L. ssp. pekinensis Chinese cabbage (Brassica rapa) is a leafy vegetable in the Brassicaceae family. It is highly sought after for its nutritious properties, high yield, storage durability, and ease of transportation. Chinese cabbage leaf color significantly influences its appearance and quality, largely determining its market value. Furthermore, leaf color is related to the types and levels of pigments it contains, such as carotenoids and anthocyanins, which have anti-cancer, antibacterial, and anti-inflammatory properties. Therefore, leaf color is significantly correlated with nutritional quality. Breeding Chinese cabbage varieties with different leaf colors can meet consumer demand for cabbage with diverse nutritional benefits. In recent years, yellow-heart Chinese cabbage has become a popular choice in the market due to its excellent appearance and crispy, sweet texture, making it suitable for both cold and cooked dishes and for making Korean kimchi. This has made the development of yellow-leaf Chinese cabbage varieties a key area of Chinese cabbage breeding. Therefore, identifying the key genes that regulate leaf yellowing in Chinese cabbage and elucidating the underlying molecular mechanisms is crucial to providing a theoretical basis for the development of new colorful Chinese cabbage varieties.

[0003] In response to the above problems, it is particularly important to study a gene that regulates the golden leaf color of Chinese cabbage. Summary of the Invention

[0004] The purpose of the present invention is to solve the deficiencies in the prior art and provide a protein dBrPRPL1 for regulating the golden leaf color of Chinese cabbage and a coding gene and application thereof.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions: A protein dBrPRPL1 regulating the golden leaf color of Chinese cabbage, characterized by being a protein as shown in (a) or (b): (a) The amino acid sequence is the protein shown in the amino acid sequence of BrPRPL1 in the original Chinese cabbage, and the amino acid sequence of the protein BrPRPL1 is shown in SEQ ID NO.1; (b) a protein dBrPRPL1 derived from the protein shown in (a) by replacing one amino acid, wherein the amino acid sequence of the protein dBrPRPL1 is shown in SEQ ID NO. 2; The second object of the present invention is to provide a gene encoding the protein dBrPRPL1 that regulates the golden leaf color of Chinese cabbage, wherein the gene encoding the protein dBrPRPL1 is obtained by a DNA molecule encoding the protein dBrPRPL1 according to claim 1, wherein the DNA molecule is: (1) The nucleotide sequence is BrPRPL1 The DNA molecule of the gene BrPRPL1 The nucleotide sequence of the gene is shown in SEQ ID NO. 3; (2) The nucleotide sequence is BrPRPL1 Derived from the nucleotide sequence of a gene by substitution, deletion, or / and insertion of one or more bases dBrPRPL1 Gene, shown dBrPRPL1 The nucleotide sequence of the gene is shown in SEQ ID NO.4.

[0006] Furthermore, the dBrPRPL1 The open reading frame of the gene is 1752 bp and encodes 339 amino acids. dBrPRPL1 The primer pair for gene amplification is shown in SEQ ID NO.5.

[0007] The third object of the present invention is to provide a method for using a protein dBrPRPL1 or a coding gene for regulating the golden leaf color of Chinese cabbage in cultivating colorful Chinese cabbage varieties.

[0008] The present invention successfully cloned a gene from the EMS mutant of Chinese cabbage with golden leaves by designing specific primers and using PCR technology. dBrPRPL1 qRT-PCR analysis showed that the expression level of this gene in the mutant plants was significantly lower than that in the wild-type plants during the rosette stage, while there was no significant difference in expression between the mutant and the wild-type plants during other growth stages. dBrPRPL1 The Chinese cabbage with the gene showed golden leaf phenotype at the seedling stage, pre-roset stage and rosette stage, and the plant growth rate was significantly slowed down; VIGS technology was used to verify BrPRPL1 The function of the gene in Chinese cabbage. qRT-PCR analysis showed that pTY- BrPRPL1 In the plant BrPRPL1 The expression level of pTY- BrPRPL1 The leaves of the plants turned yellow, while those of the pTY plants remained green. In addition, compared with the PDS plants and pTY plants, the pTY- BrPRPL1 Plants showed different color characteristics in chlorophyll content and chlorophyll fluorescence parameters (Fv / Fm, Fq' / Fm' and rETR) imaging. BrPRPL1 The chlorophyll imaging of the plant was blue, while that of the pTY plant was yellow, indicating that PDS and pTY- BrPRPL1The chlorophyll content of the plant is lower than that of the pTY plant. Consistent with this, the contents of chlorophyll a and chlorophyll b in the pTY- BrPRPL1 and PDS plants are significantly reduced by 1.2-fold and 9.1-fold, 1.9-fold and 5.3-fold, respectively, compared with those of the pTY plant. In terms of fluorescence parameters, the Fv / Fm and Fq' / Fm' imaging of the PDS plant and the pTY- BrPRPL1 plant shows red, while that of the pTY plant shows yellow, indicating that the Fv / Fm and Fq' / Fm' values of the PDS and pTY- BrPRPL1 plants are lower than those of the pTY plant. In addition, the rETR imaging of the PDS and pTY- BrPRPL1 plants shows blue, while that of the pTY plant shows red, indicating that the rETR values of the PDS and pTY- BrPRPL1 plants are lower than those of the pTY plant. These results indicate that BrPRPL1 is involved in regulating the formation of the leaf color of Chinese cabbage. Western blot analysis shows that the expression level of the large subunit protein RbcL of Rubisco encoded by the chloroplast ribosome is significantly lower in the mutant plants than in the wild type; in addition, the key proteins PsaA and PsaB of photosystem I are almost completely absent in the mutant plants, while they are normally expressed in the wild type. These results confirm that BrPRPL1 the leaf color development of Chinese cabbage is affected by regulating the stability or expression of key photosynthesis proteins. Therefore BrPRPL1 is the key gene regulating the golden leaf color of Chinese cabbage, which can be used as a gene resource for plant leaf color improvement, enabling precise design breeding of plant gene editing, and having important theoretical significance and application value in creating new germplasms and improving yield and quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 shows the phenotypes of Chinese cabbage containing BrPRPL1 and dBrPRPL1 genes; Figure 2 shows the chloroplast structure and chlorophyll content of Chinese cabbage containing BrPRPL1 and dBrPRPL1 genes; Figure 3 shows the chlorophyll fluorescence imaging of Chinese cabbage containing BrPRPL1 and dBrPRPL1 genes; Figure 4 shows the phenotypes, chlorophyll fluorescence imaging and chlorophyll content of plants after BrPRPL1 silencing; Figure 5 shows the BrPRPL1 relative expression levels at different developmental stages of Chinese cabbage; Figure 6 shows the Western blot analysis of proteins encoded by chloroplast ribosomes; DETAILED DESCRIPTION OF THE INVENTION

[0010] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0011] It should be noted that: Figure 1 In which, a is the seedling stage; b is the early rosette stage; c is the rosette stage; the scale bar is 5 cm; Figure 2 In which, a is the chloroplast structure of wild type A03 and the mutant Mut298 ; b is the pigment content and net photosynthetic rate; Figure 3 In which, a is the imaging of chlorophyll; b is the imaging of the maximum photochemical quantum yield (Fv / Fm); c is the imaging of the photochemical quantum yield (Fq' / Fm'); d is the imaging of the relative electron transport rate (rETR); Figure 4 In which, a is the plant phenotype of PDS, pTY and pTY- BrPRPL1 ; b is the chlorophyll fluorescence imaging of PDS, pTY and pTY- BrPRPL1 plants; c is the expression level after gene silencing; d is the chlorophyll content of PDS, pTY and pTY- BrPRPL1 plants; Figure 5 For the seedling stage, early rosette stage and rosette stage BrPRPL1 The expression levels in wild type A03 and the mutant Mut298 ; Figure 6 In which, A03-1, A03-2 and A03-3 are respectively three biological replicates of A03 plants; M298-1, M298-2 and M298-3 are respectively Mut298 three biological replicates of the plants.

[0012] Example 1 Phenotypic identification and determination of physiological indexes of Chinese cabbage containing BrPRPL1 and dBrPRPL1 genes Experimental materials and reagents Using the Chinese cabbage inbred line A03 containing BrPRPL1 gene and the golden leaf color mutant containing dBrPRPL1 gene obtained by EMS mutagenesis of A03 Mut298 as experimental materials. Mut298The M5 generation of homozygous mutants was obtained through multiple generations of self-crossing. Reagents such as ethanol and acetone were provided by Xinxuan Biotechnology Co., Ltd. The ultraviolet-visible spectrophotometer (UV-1800; Shimadzu, Japan), LI-6800 portable photosynthesis instrument (LI-COR, Co., Ltd., USA) and multi-functional plant photosynthetic phenotype measurement system (PlantExplorer Pro+ , PhenoVation, Co., Ltd., Netherlands) were provided by the State Key Laboratory of North China Crop Improvement and Regulation, Hebei Agricultural University.

[0013] Experimental methods and result analysis: Phenotypic identification and determination of physiological indexes of Chinese cabbage containing BrPRPL1 and dBrPRPL1 genes.

[0014] (1) Determination of phenotypic identification, chlorophyll content, net photosynthetic rate and chlorophyll fluorescence parameters At the seedling stage, early rosette stage and rosette stage, the phenotypes of Chinese cabbage were observed and photographed respectively. The results showed that the Chinese cabbage showed a golden leaf color phenotype in all three stages ( Figure 1 ). Chlorophyll was extracted by the ethanol-acetone extraction method. Accurately weigh 0.2 g of fresh leaves and place them in 50 ml graduated centrifuge tubes respectively. Pipette 10 ml of extraction solution (ethanol:acetone = 1:1) into the centrifuge tube and extract in the dark for 24 h, shaking from time to time until the leaves turn white and their leaf color completely fades. Use the UV1800 ultraviolet-visible spectrophotometer to measure the spectrophotometric value, with the extraction solution as the blank control, and measure the absorbance at wavelengths of 646 nm and 663 nm respectively. Each sample was measured 3 times. Calculate the photosynthetic pigment content according to the Inskeep formula: Chlorophyll a (mg•g -1 ) = (12.21 A663 - 2.81 A646)V / 1000W Chlorophyll b (mg•g -1 ) = (20.13 A646 - 5.03 A663)V / 1000W Where: V is the volume of the extraction solution (ml), and W is the weight of the material (g). The results showed that the chlorophyll content of the mutant Mut298 plants was significantly lower than that of the wild-type A03 plants ( Figure 2 b).

[0015] From the wild-type A03 and the mutant Mut298Three plants were selected to collect the fifth true leaf counted from the inside outwards. On sunny mornings (9:00 - 11:00), a LI-6800 portable photosynthesis meter was used to measure photosynthetic parameters such as stomatal conductance, transpiration rate, and net photosynthetic rate at different parts (upper, middle, and lower parts) of the leaves. A multi-functional plant photosynthetic phenotype measurement system was used to measure the chlorophyll fluorescence parameters of wild type A03 and the mutant Mut298 at the seedling stage (15 days after sowing). The results showed that the Mut298 net photosynthetic rate and chlorophyll fluorescence parameters of the mutant plants were significantly lower than those of wild type A03 plants ( Figure 2 b and Figure 3 ).

[0016] (2) Chloroplast ultrastructure The leaves of wild type A03 and the mutant Mut298 were fixed and examined according to the method of Woodson et al. Ultra-thin sections were obtained by cutting with a diamond knife on a Leica EM UC7 ultramicrotome (Leica Microsystems, USA), and chloroplasts were observed and photographed using a H7600 transmission electron microscope (Hitachi, Japan) at 75 - 100 kV. The results showed that the chloroplasts in the leaves of A03 plants were ellipsoidal, with completely developed chloroplast morphology, arranged neatly, and normal stacking of grana lamellae and starch grains. The chloroplast ultrastructure of the mutant Mut298 was abnormal, with an undense structure and less starch grain accumulation in the chloroplasts ( Figure 2 a).

[0017] Example 2 dBrPRPL1 Analysis of gene expression pattern and functional verification Experimental materials and reagents In this study, the Chinese cabbage inbred line A03 (containing the BrPRPL1 gene) and its leaf yellowing mutant obtained by EMS mutagenesis Mut298 (containing the dBrPRPL1 gene) were used as materials, where Mut298M5 generation homozygous mutants were obtained through multiple generations of self-pollination. Competent Escherichia coli 'DH5α' cells and Agrobacterium tumefaciens 'GV3101' cells used in this experiment were maintained by the State Key Laboratory of Crop Improvement and Regulation in North China, Hebei Agricultural University. The main reagents were purchased from TaKaRa; the column-based plant total RNA extraction kit was purchased from Shanghai Sangon Biotechnology Co., Ltd.; and the plasmid miniprep kit (spin column type) was purchased from Shanghai Jierui Biotechnology Co., Ltd.; Taq DNA polymerase, dNTPs, Taq buffer, T4 DNA ligase, PCR product purification and recovery kit, gel recovery kit, pEASY-T1 cloning vector kit, EasyScript one-step gDNA removal and cDNA synthesis SuperMix kit, and TransStart Top Green qPCR SuperMix kit were all purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0018] 2. Experimental methods and results analysis: dBrPRPL1 Gene expression pattern analysis and functional verification (1) Chinese cabbage BrPRPL1 and dBrPRPL1 Gene cloning Total RNA was extracted from wild-type A03 and mutants using a total RNA extraction kit (Tiangen, China). Mut298 Total RNA from leaves was used. First-strand cDNA was synthesized according to the instructions of the HiScript QRT SuperMix for qPCR Kit. Primers ZJ1: CGAAACTATGCAGTTCTCCGC; ZJ2: CCGTCACAGCTAACATTCCAC were designed. PCR amplification was performed using the cDNA as a template. The amplified product was cloned into a T vector and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. Sequencing results showed that the resulting fragment size was consistent with the expected size, with a total length of 1752 bp. This fragment contains the complete ORF reading frame (start codon ATG to stop codon TGA), with a mutation site at position 50, and encodes 339 amino acids (see SEQ ID NOs. 3 and 4 in the sequence listing for details).

[0019] (1) dBrPRPL1 Real-time fluorescence quantitative analysis of genes ChamQ Universal SYBR qPCR Master Mix (Novizan, Nanjing) was used for fluorescence quantitative analysis. Fluorescence quantitative analysis was performed on QuantStudio5 (Thermo Fisher, USA) according to the following conditions (95°C for 2 min; 95°C for 10 sec; 60°C for 30 sec; 95°C for 15 sec; 60°C for 1 min; 95°C for 15 sec; 40 cycles). Using the method of 2 –△△Ct to calculate the relative expression levels of candidate genes in wild-type A03 and mutants Mut298 in rosette-stage leaves of plants. The results showed that during the rosette stage Mut298 plants BrPRPL1 had significantly lower expression levels than WT plants. At other stages BrPRPL1 the expression levels were Mut298 not significantly different between plants and WT plants ( Figure 5 ).

[0020] (2) Preliminary verification of key gene functions using VIGS A 40-bp specific CDS sequence of the key gene was selected, reverse-complemented to form an 80-bp specific fragment, ligated to the vector pTY-s, and the ligation product was transformed into Escherichia coli. The plasmid was cultured and extracted. When the seedlings grew to two true leaves, seedlings with consistent growth, strong growth, and no pests and diseases were selected for VIGS analysis. Two weeks later, the phenotypes were observed and the target genes were quantitatively verified. The results showed that BrPRPL1 after silencing, the plants showed leaf chlorosis. qRT-PCR analysis was performed on pTY plants and pTY- BrPRPL1 plants. The results showed that BrPRPL1 the expression level of BrPRPL1 was significantly reduced in pTY- BrPRPL1 plants. In addition, the chlorophyll content in pTY- Figure 4 plants and PDS plants was significantly lower than that in pTY plants (

[0021] (3) Immunoblot analysis of chloroplast ribosome-encoded proteins Wild-type A03 and mutants Mut298The leaves were quickly ground into powder in liquid nitrogen. The powder was poured into a 2 mL cryogenic centrifuge tube and placed on ice. An equal volume of NP-40 protein lysis buffer was added. After centrifugation at 12,000 r / min for 5 min, the supernatant was taken, 1 / 4 volume of 5×loading Buffer was added, and it was heated at 95 °C for 10 min for electrophoresis. Then the proteins on the gel were transferred to a PVDF membrane (Beyotime Biotechnology, China). After the transfer was completed, the PVDF membrane was placed in the blocking solution and blocked at room temperature for 1 h. Finally, it was incubated with specific primary and secondary antibodies. The protein signals were visualized using an Odyssey infrared imaging system (LI-COR Biosciences, USA). The results showed that the expression levels of RbcL, PsaA, and PsaB in Mut298 plants were significantly lower than those in A03 plants ( Figure 6 ).

[0022] SEQ ID NO.1 MAVCATHSSLMIAYAASKDLTIPSLFSSANPRPNKLSVALYPPLVLLAGRRASNPSFPVVVSAVAAEADVDTEDAEQNEATSTTATAVLDPPKPKKGKAALLLKRDRTRSKRFLEIQKLRETKKEYDVKTAISLLKQTANTRFVESVEAHFRLNIDPKYNDQQLRATVSLPKGTGQTVKVAVLAQGEKVDEAKNAGADIVGSDDLIEQIKGGFMEFDKLIASPDMMVKVAGLGKILGPRGLMPNPKAGTVTANIPQAIEEFKKGKVEFRADKTGIVHIPFGKVNFTEEDLLVNFLAAVKSVETNKPKGAKGVYWKSAHICSSMGPSIKLNIREMIDFKP SEQ ID NO.2 MAVCATHSSLMIAYAASKDLTIPSLFSSANPRPNKLSVALYPPLVLLAGRRASNPSFPVVVSAVAAEADVDTEDAEQNEATSTTATAVLDPPKPKKGKAALLLKRDRTRSKRFLEIQKLRETKKEYDVKTAISLLKQTANTRFVESVEAHFRLNIDPKYNDQQLRATVSLPKGTGQTVKVAVLAQGEKVDEAKNAGADIVGSDDLIEQIKGGFMEFDKLIASPDMMVKVAGLGKILGPRGLMPNPKAGTVTANIPQAIEEFKKGKVEFRADKTGIVHIPFGKVNFTEEDLLVNFLAAVKSVETNKPKGAKGVYWKSAHICSSMRPSIKLNIREMIDFKP SEQ ID NO.3 SEQ ID NO.4 SEQ ID NO.5 ZJ1: CGAAACTATGCAGTTCTCCGC ZJ2: CCGTCACAGCTAACATTCCAC Those skilled in the art should understand that the embodiments of the present invention described above and shown in the accompanying drawings are only examples and do not constitute a limitation to the present invention. The object of the present invention has been fully and effectively achieved, and its function and structural principle have been clearly demonstrated and explained in the embodiments. Without departing from the principle of the present invention, the implementation manner can be deformed or modified in any form.

Claims

1. A protein dBrPRPL1 for regulating the golden yellow leaf color of Chinese cabbage, characterized in that, A protein as shown in (a) or (b): (a) A protein whose amino acid sequence is the amino acid sequence of BrPRPL1 in the original Chinese cabbage, and the amino acid sequence of the protein BrPRPL1 is as shown in SEQ ID NO.1; (b) A protein dBrPRPL1 derived by substituting one amino acid for the protein shown in (a), and the amino acid sequence of the protein dBrPRPL1 is as shown in SEQ ID NO.

2.

2. The coding gene of a protein dBrPRPL1 that regulates the golden yellow leaf color of Chinese cabbage, characterized in that, The coding gene of the protein dBrPRPL1 is obtained from a DNA molecule encoding the protein dBrPRPL1 as claimed in claim 1, and the DNA molecule is: (1) The nucleotide sequence is BrPRPL1 the DNA molecule of the gene, and the BrPRPL1 nucleotide sequence of the gene is shown in SEQ ID NO. 3; (2) The nucleotide sequence is derived by substitution, deletion or / and insertion of one or more bases on the basis of the nucleotide sequence of the BrPRPL1 gene, and the dBrPRPL1 gene shown dBrPRPL1 has the nucleotide sequence as shown in SEQ ID NO.

4.

3. The encoding gene of the protein dBrPRPL1 for regulating the golden yellow leaf color of Chinese cabbage according to claim 2, characterized in that: The dBrPRPL1 open reading frame of the gene is 1752 bp and encodes a polypeptide consisting of 339 amino acid residues.

4. A set of genes dBrPRPL1 The amplification primer pair is shown in SEQ ID NO.

5.

5. Use of a protein dBrPRPL1 or a coding gene for regulating the golden leaf color of Chinese cabbage in cultivating a variegated Chinese cabbage variety.