DNA dual-responsive nano-enzyme, preparation method thereof, detection kit containing DNA dual-responsive nano-enzyme and application of DNA dual-responsive nano-enzyme
By preparing DNA biresponsive nanoenzymes and combining with rolling ring amplification reaction, the complexity and cost of organophosphorus pesticide detection in the prior art are solved, and a portable detection of high specificity and low detection limits of malathion are achieved.
Patent Information
- Application Number
- CN202510499194.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-04-14
- Filing Date
- 2025-04-21
- Publication Date
- 2025-08-01
AI Technical Summary
The prior art is difficult to achieve sensitive and convenient detection of organic phosphorus pesticides in environmental water samples and fruit and vegetable foods. The detection process is complex and costly, making it difficult to meet the rapid detection needs of food safety.
DNA biresponsive nanoenzymes were prepared and combined with rolling ring amplification reaction. Through specific probes and DNA ligases, efficient detection of organophosphorus pesticides was achieved, and signal amplification was performed using colorimetric method and fluorescence method.
High specificity, low detection limit (0.0605nM), low cost, portable detection of paramalathion is achieved, simplifying the operation process and avoiding complex pre-processing steps.
Smart Images

Figure CN120399201A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of pesticide detection, and particularly relates to a DNA dual-responsive nanozyme, a preparation method thereof, a detection kit containing the same, and an application thereof. Background Art
[0002] Nanozymes are a class of artificial nanomaterials with catalytic activities similar to natural enzymes, and can mimic the functions of biological enzymes such as redox enzymes, hydrolases, and peroxidases. Nanozymes can still maintain their activities under extreme conditions such as high temperature, acid, and alkali, and have both the stability of nanomaterials and the high catalytic characteristics of enzymes, and have important application values in the fields of biomedicine, environmental remediation, industrial catalysis, etc. The high specific surface area and catalytic activity of nanozymes can significantly enhance the detection signal, and have shown great potential in the field of biomedical detection in recent years. DNA dual-responsive nanozymes are a class of intelligent nanozyme systems that can dynamically regulate their catalytic activities through DNA molecules. This type of nanozyme combines the precise recognition ability of DNA with the catalytic function of nanozymes, and can achieve highly specific and programmable response behaviors in scenarios such as biosensing and disease treatment.
[0003] Organophosphorus pesticides (OPs) are a class of organic compound pesticides containing phosphorus elements, and are widely used in the production of agriculture, forestry, and animal husbandry in various countries around the world, and play an important role in increasing agricultural production and harvest. According to statistics, among the pesticides produced and sold globally in agricultural production, organophosphorus pesticides account for 34%. The huge usage amount has caused serious residues of organophosphorus pesticides in the environment. Once ingested by humans, it will cause neurotoxic symptoms. In severe cases, respiratory paralysis will occur, and even death may occur, seriously endangering public health. Malathion is an organophosphorus insecticide, which is widely used in the prevention and control of agricultural and sanitary pests (such as mosquitoes and mites). Its mechanism of action is to inhibit the acetylcholinesterase (AChE) of insects, resulting in the accumulation of the neurotransmitter acetylcholine (ACh), and triggering neurotoxic death. Malathion may remain after being used on crops such as fruits, vegetables, and grains. Excessive intake will cause acute or chronic poisoning, and it is also easy to enter rivers and groundwater through rainwater scouring, and is highly toxic to fish and aquatic organisms.
[0004] At present, the detection methods for organophosphorus pesticides in the environment include chromatographic analysis, spectroscopic analysis, enzyme inhibition method, immunoassay, nanomaterial enhancement technology, and molecular imprinting technology, etc. Although they have good accuracy, the detection process is complex and time-consuming, the cost is high, some instruments require professional personnel to operate, and the detection signal is easily interfered, making it difficult to achieve sensitive and convenient detection of organophosphorus pesticides in environmental water samples and matrixes such as fruits, vegetables, and foods.
[0005] Malathion may remain as a residue after being used on fruits, vegetables, grains and other crops. Excessive intake may lead to acute or chronic poisoning. To ensure that food meets the national limit standards, there is an urgent need to develop efficient, sensitive, portable, accurate, economical and on-site rapid detection methods to reduce or avoid its harm to the human body. Summary of the Invention
[0006] The first object of the present invention is to provide a DNA dual-responsive nanozyme, and the DNA dual-responsive nanozyme is prepared by the following method:
[0007] (1) Preparation of polypyrrole particles: React pyrrole monomer with ammonium persulfate in an ice-water bath, centrifuge to obtain a black product, wash, purify by dialysis, and dry to obtain polypyrrole;
[0008] (2) Preparation of oxidized polypyrrole nanozyme: Add H2O2 to the polypyrrole prepared in step (1), react in a water bath, filter, perform hydrothermal reaction in an oven, filter again, purify by dialysis, and freeze-dry to obtain a DNA dual-responsive nanozyme.
[0009] The second object of the present invention is to provide the application of the DNA dual-responsive nanozyme in the preparation of a detection kit.
[0010] The third object of the present invention is to provide a pesticide dual-mode detection kit based on DNA dual-responsive enzyme-coupled rolling circle amplification reaction. The kit includes a pesticide capture primer H1-Apt, a circular template CT, T4 DNA ligase, Phi29 DNA polymerase, dNTPMix, SA-MB, o-ppy nanozyme and a TMB color development system;
[0011] The pesticide capture probe H1-Apt contains a nucleic acid aptamer Apt for the pesticide to be detected and its complementary sequence H1 with a biotin molecule connected to the 5' end; the circular template CT is a sequence that is complementary to the H1 strand at both ends and rich in C bases.
[0012] Preferably, the TMB color development system includes TMB, H2O2, and sodium acetate buffer with a pH of 4.
[0013] Preferably, the pesticide detected by the kit is malathion,
[0014] The H1 sequence is:
[0015] 5’biotin-ATACGGGAGCCAACACCA-3’;
[0016] The Apt sequence is:
[0017] 5'-ATCCGTCACAACCTGCTCTTATACACAATTGTTTTTCTCTTAACTTCTTGACTGCTGTGTTGGCTCCCGTAT-3';
[0018] The CT sequence is:
[0019] 5'P-CTCCCGTATTACCTAGCTCCCTTCCCACCCTTCCCACCCTCCCTTCCCATGGTGT TGG-3'.
[0020] The fourth object of the present invention is to provide the use of the kit in detecting the pesticide malathion.
[0021] A fifth object of the present invention is to provide a dual-mode detection method for organophosphorus pesticides based on a DNA dual-responsive enzyme-coupled rolling circle amplification reaction, comprising the following steps:
[0022] (1) Add the pesticide capture probe H1-Apt to the sample solution to be tested, so that the pesticide standard in the sample to be tested binds to the corresponding nucleic acid aptamer on H1-Apt to form Apt-pesticide, releasing the H1 sequence. The free H1 and the C-rich ring template CT are connected into a ring through base complementary pairing under the action of T4 DNA ligase to form a ring probe. At the same time, nuclease I is added to degrade the unreacted H1 in the system;
[0023] (2) adding Phi29 DNA polymerase, buffer, and reaction substrate dNTPMix to the reaction solution containing the circular template in step (1) to initiate a rolling circle amplification reaction to obtain a G-base-rich RCA product fragment;
[0024] (3) Colorimetric detection of pesticides: The G-base-rich RCA product fragment obtained in step (2) is combined with streptavidin-modified magnetic beads, and the pure RCA product is obtained by magnetic separation and then reacted with the DNA dual-responsive nanozyme in a water bath. After the reaction is complete, a SA-MB-o-ppy nanozyme@ssDNA complex is obtained. The change in the peroxidase activity of the o-ppy nanozyme before and after the reaction is observed, the color change of TMB is observed, and the absorbance value is measured. The content of the organophosphorus pesticide in the sample solution to be tested is calculated by comparing it with the standard curve;
[0025] (4) Detection of pesticides by fluorescence method: The G-base-rich RCA product fragment obtained in step (2) is reacted with the DNA dual-responsive nanozyme in a water bath. After the reaction is complete, the o-ppy nanozyme@ssDNA complex is obtained. The fluorescence intensity before and after the reaction is measured. The fluorescence intensity value measured above is compared with the standard curve to calculate the content of the organophosphorus pesticide in the sample solution to be tested.
[0026] The beneficial effects of the present invention are as follows:
[0027] (1) The present invention provides a DNA dual-responsive nanozyme. The DNA dual-responsive nanozyme can effectively avoid problems such as energy consumption and environmental pollution caused by high-temperature and high-pressure treatment by operating under low-temperature and low-pressure conditions. At the same time, the preparation method has strong operability and is environmentally friendly; it has strong peroxidase-like activity and can be widely used in the fields of biocatalysis and sensing detection; the prepared polypyrrole oxide nanozyme has good responsiveness to DNA sequences with specific bases.
[0028] (2) The present invention also provides a detection kit containing the DNA dual-responsive nanozyme. The kit is used for detecting malathion and has high specificity, high stability and a low detection limit. The lowest detection limit is 0.0605 nM.
[0029] (3) The detection kit of the present invention is used for detecting malathion, has the characteristics of simple operation, no need for complex pretreatment of the sample to be detected, no need for expensive reagents, low detection cost, and can achieve portable detection. Description of the Drawings
[0030] Figure 1 It is a transmission electron microscope image of polypyrrole oxide nanozyme;
[0031] Figure 2 It is a particle size distribution diagram of polypyrrole oxide nanozyme;
[0032] Figure 3 It is a fluorescence spectrum diagram of polypyrrole oxide nanozyme;
[0033] Figure 4 It is an infrared spectrum diagram of polypyrrole oxide nanozyme;
[0034] Figure 5 It is the verification of peroxidase-like activity of polypyrrole oxide nanozyme;
[0035] Figure 6 It is the optimization of peroxidase-like activity conditions of polypyrrole oxide nanozyme;
[0036] Figure 7 It is the enzyme catalysis kinetics of peroxidase-like of polypyrrole oxide nanozyme;
[0037] Figure 8 It is the TMB colorimetric responsiveness of polypyrrole oxide nanozyme to different DNA strands;
[0038] Figure 9 It is the fluorescence responsiveness of polypyrrole oxide nanozyme to different DNA strands;
[0039] Figure 10Schematic diagram of the detection principle of the method of the present invention;
[0040] Figure 11 Detection standard curve for detecting malathion at different concentrations by colorimetry;
[0041] Figure 12 Detection standard curve for detecting malathion at different concentrations by fluorescence method;
[0042] Figure 13 Specific detection of malathion by fluorescence method;
[0043] Figure 14 Specific detection of malathion by colorimetry; Specific implementation mode
[0044] The present invention will be further described in detail below with reference to specific examples and data. The following examples are only for illustrating the present invention and do not limit the scope of the present invention in any way. The terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art unless otherwise specified.
[0045] It should be noted that in the following examples, unless otherwise specified, the methods are all conventional methods and the reagents can all be purchased on the market.
[0046] In the following examples, the T4 DNA ligase, Phi29 DNA polymerase, and dNTP Mix were purchased from Shanghai Sangon Biotech Co., Ltd.; the SA-MB was purchased from Shanghai Beyotime Biotechnology Co., Ltd.
[0047] It should be noted that in the present invention, the inventor prepared the DNA dual-responsive nanozyme by himself for preparing the detection kit. However, the nanozymes that can be purchased on the market can also be used for preparing the detection kit.
[0048] Example 1. Preparation of DNA dual-responsive nanozyme
[0049] (1) Preparation process of polypyrrole particles: Take 180 μL of pyrrole monomer and dissolve it in 72 mL of pure water and stir. Then add 18 ml of ammonium persulfate at 0.14 mol L -1 Magnetically stir and react for 3 h in an ice-water bath. The black product obtained by centrifugation is washed three times each with ethanol and water. After washing, it is purified by dialysis with a 3000 Da dialysis bag for 24 h, and finally dried at 60 °C in a vacuum drying oven. The obtained polypyrrole is stored at room temperature;
[0050] (2) Preparation process of oxidized polypyrrole nanozyme: Mix 10 mL of H2O2, 50 mL of pure water, and 50 mg of the polypyrrole particles prepared in step (1) in a water bath at 45 °C for 24 h, and then filter through a 0.1 μm filter membrane. Put the filtered solution into an oven for a low-temperature hydrothermal reaction at 85 °C for 2.5 h. The obtained solution is filtered again through a 0.1 μm filter membrane, and then subjected to dialysis purification treatment. Finally, it is freeze-dried to obtain the final product, which is stored in a refrigerator at 4 °C for standby.
[0051] Figure 1 Figure 4 is the transmission electron microscope image of the prepared oxidized polypyrrole nanozyme. It can be seen from the figure that the prepared oxidized polypyrrole nanozyme is spherical particles with good dispersibility. Figure 2 Figure 5 is the particle size distribution diagram of the prepared oxidized polypyrrole nanozyme. It can be known from the particle size distribution diagram that its average size is about 5 nm. Figure 3 Figure 6 is the fluorescence excitation and emission spectrum of the aqueous solution of the prepared oxidized polypyrrole particles. Its maximum excitation wavelength is 365 nm, and the maximum emission wavelength is 447 nm. Figure 4 Figure 7 is the infrared spectrum of the prepared oxidized polypyrrole nanozyme. It can be seen from the figure that the stretching vibration peak intensity of the C=O bond of the oxidized polypyrrole nanozyme obtained by low-temperature hydrothermal treatment is enhanced at 1715 cm -1 .
[0052] Example 2. Verification of peroxidase-like and fluorescence properties of DNA dual-responsive nanozyme
[0053] ((1) Peroxidase-like activity of oxidized polypyrrole nanozyme
[0054] The experimental process is as follows:
[0055] System ①: Set a system of 0.2 mM TMB with an addition amount of 0.125 mL, 30 μg / mL oxidized polypyrrole nanozyme with an addition amount of 0.150 mL, and 2 mM H2O2 with an addition amount of 0.250 mL. Use 0.975 mL of sodium acetate solution with pH = 4 as the system buffer;
[0056] System ②: Set a system of 0.2 mM TMB with an addition amount of 0.125 mL and 30 μg / mL oxidized polypyrrole nanozyme with an addition amount of 0.150 mL. Use 1.225 mL of sodium acetate solution with pH = 4 as the system buffer;
[0057] System ③: Set a system of 0.2 mM TMB with an addition amount of 0.125 mL and 2 mM H2O2 with an addition amount of 0.250 mL. Use 1.125 mL of sodium acetate solution with pH = 4 as the system buffer;
[0058] React the systems ①②③ at 50 °C for 10 min using a water bath or a metal bath.
[0059] The oxidized polypyrrole nanozyme has peroxidase-like activity. The results are as Figure 5 shown. From the experimental results, it can be seen that in the system with TMB and H2O2 present, the catalytic degree of the system containing the oxidized polypyrrole nanozyme is significantly higher than that of the system without the oxidized polypyrrole nanozyme, indicating that the oxidized polypyrrole nanozyme has strong peroxidase-like activity.
[0060] (2) Optimization of the peroxidase-like activity conditions of the oxidized polypyrrole nanozyme
[0061] Using the experimental conditions of system ① in (1), under the condition that other parameters remain unchanged, a single-factor experiment was conducted. The pH, reaction time, reaction temperature, and the addition amount of the oxidized polypyrrole nanozyme were changed, and the catalytic ability of the oxidized polypyrrole nanozyme was observed. The specific parameters are as follows:
[0062] Group 1 Group 2 Group 3 Group 4 Group 5 Group 6 Group 7 Different pH 3 3.5 4 4.5 5 5.5 6 Different reaction time (min) 0 5 10 15 20 25 30 Different reaction temperature (°C) 25 30 35 40 45 50 55 Different addition amounts of oxidized polypyrrole nanozyme (μg / mL) 0 10 20 30 40 50
[0063] The experimental results are as Figure 6 shown. From Figure 6 A, it can be seen that the catalytic ability of the oxidized polypyrrole nanozyme is the strongest at pH 3.5. Figure 6 From B, it can be seen that at 10 min, the reaction process gradually slows down, and the catalytic ability of the enzyme in the subsequent reaction decreases. This may be because as time goes by, H2O2 will decompose, resulting in a decrease in the reaction rate and a corresponding decrease in absorbance. Figure 6 From C, it can be seen that the catalytic ability of the oxidized polypyrrole nanozyme is the strongest at 50 °C; Figure 6 From D, it can be seen that the reaction rate is the fastest at 30 μg / mL, and subsequently, as the addition amount increases, the reaction rate gradually becomes slow.
[0064] (3) Peroxidase-like catalytic kinetics of the oxidized polypyrrole nanozyme
[0065] By fixing the concentrations of TMB (0.1 - 0.4 mM) and H2O2 (0.5 - 3 mM), adding different amounts of H2O2 or TMB correspondingly, under the condition optimization of Example 2 (2), the absorbance at 652 nm was measured using an ultraviolet spectrophotometer, and the initial velocity of the catalytic reaction at different concentrations of H2O2 and TMB was calculated. After fitting with the Michaelis-Menten equation, a double-reciprocal plot was made, and the catalytic kinetic constant of the oxidized polypyrrole nanozyme was calculated.
[0066] The experimental results are as Figure 7 shown. From the figure, it can be seen that the Michaelis constant of the oxidized polypyrrole nanozyme for TMB is 0.186 mM, and the maximum reaction rate is 7.55×10 -9 M / s. Its K mThe value is lower than most of the reported peroxidase-like enzymes, indicating that the prepared oxidized polypyrrole nanozyme has excellent peroxidase-like catalytic activity.
[0067] (4) DNA fluorescence / colorimetric responsiveness of oxidized polypyrrole nanozyme
[0068] Take 100 μL of 1 μM DNA strands (poly-A, poly-T, poly-C, and G-rich) and react them with 100 μL of 30 μg / mL o-ppy nanozyme in a 1.5 mL centrifuge tube at 45 °C in a water bath for 1 - 1.5 h for reaction mixing to obtain o-ppy nanozyme@poly-A, o-ppy nanozyme@poly-T, o-ppy nanozyme@poly-C, and o-ppy nanozyme@G-rich.
[0069] Among them, the poly-A is: 5’-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3’ (SEQ ID No.1);
[0070] Among them, the G-rich is: 5’-TTGGGTTGGGTTGGGTTGGGTTGGGTTGGG-3’ (SEQ ID No.2). Among them, the poly-C is: 5’-CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC-3’ (SEQ ID No.3). Among them, the poly-T is: 5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3’ (SEQ ID No.4)
[0071] Test the fluorescence spectra of the above o-ppy nanozyme@ssDNA mixtures at an excitation wavelength of 365 nm by a fluorescence spectrophotometer to obtain the different fluorescence intensities of o-ppy nanozyme@poly-A, o-ppy nanozyme@poly-T, o-ppy nanozyme@poly-C, and o-ppy nanozyme@G-rich. React the above o-ppy nanozyme@ssDNA mixtures for 10 min under the optimized conditions of Example 2 (2), and use an ultraviolet spectrophotometer to measure the absorbance at 652 nm to obtain the different absorbances of o-ppy nanozyme@poly-A, o-ppy nanozyme@poly-T, o-ppy nanozyme@poly-C, and o-ppy nanozyme@G-rich.
[0072] Figure 8To compare the absorbance values of the TMB system catalyzed by the o-ppy nanozyme@ssDNA mixture with that catalyzed by the oxidized polypyrrole nanozyme alone, adding ssDNA with different sequences can cause varying degrees of changes in the catalytic ability of the oxidized polypyrrole nanozyme. Among them, the efficiency of o-ppy nanozyme@G-rich in catalyzing the TMB solution is significantly enhanced, while the efficiency of o-ppy nanozyme@poly-A in catalyzing the TMB solution is weakened.
[0073] Figure 9 For the comparison of the fluorescence spectra of the o-ppy nanozyme@ssDNA mixture and the oxidized polypyrrole nanozyme alone, adding ssDNA with different sequences can cause varying degrees of changes in the fluorescence of the oxidized polypyrrole nanozyme. Among them, the fluorescence enhancement of the o-ppy nanozyme@G-rich mixture is the most obvious. Subsequently, the fluorescence / colorimetric enhancement effect of G-rich on o-ppy nanozyme is utilized to construct an RCA reaction for signal amplification to detect organophosphorus pesticides portably and sensitively.
[0074] Example 3: A pesticide dual-mode detection kit using DNA dual-responsive enzyme-coupled rolling circle amplification reaction
[0075] A pesticide dual-mode detection kit using DNA dual-responsive enzyme-coupled rolling circle amplification reaction, including a pesticide capture initiation probe biotin H1-Apt, a circular template CT, T4 DNA ligase, Phi29 DNA polymerase, dNTP Mix, SA-MB, o-ppy nanozyme and a TMB color development system; the display principle is as Figure 10 shown.
[0076] Among them, the pesticide capture initiation probe H1-Apt is prepared by the following method:
[0077] (1) Preparation of H1-Apt:
[0078] ① Take 10 μL of 10 μM malathion aptamer and 10 μL of 10 μM H1 with a biotin molecule linked to the 5'-end, react at 95 °C for 5 min, and react at 25 °C for 35 min for base complementary pairing and binding.
[0079] The nucleic acid sequence of the malathion aptamer is as follows:
[0080] 5’-ATCCGTCACACCTGCTCTTATACACAATTGTTTTTCTCTTAACTTCTTGACTGCTGGTGTTGGCTCCCGTAT-3’; (SEQ ID No.5)
[0081] The described H1 sequence is: 5’biotin-ATACGGGAGCCAACACCA-3’; (SEQ ID No.6)
[0082] The described CT sequence is:
[0083] 5’P-CTCCCGTATTACCTAGCTCCCTTCCCACCCTTCCCACCCTCCCTTCCCATGGTGT TGG-3’; (SEQ ID No.7)
[0084] The described TMB color development system consists of the following components:
[0085] It is composed of 0.2 mM TMB, 2 mM H2O2, and sodium acetate buffer with a pH of 4.
[0086] Taking the detection of malathion as an example, the principle of the technical solution of the present invention is described as Figure 10 shown below:
[0087] (1) Design a biotin-modified H1 strand to bind to the malathion nucleic acid aptamer Apt through the principle of base complementary pairing. When the target malathion exists, the nucleic acid aptamer in H1-Apt will bind to malathion with high specificity and selectivity, so that the originally Apt-bound H1 will fall off, obtaining a solution containing free H1.
[0088] (2) The H1 sequence in the system and the circular template are ligated into a ring through base complementary pairing under the action of T4 DNA ligase. At the same time, exonuclease I is added to degrade the unreacted H1 in the system. Phi29 DNA polymerase and dNTP Mix and other primers are added to synthesize repetitive linear DNA sequences through RCA for DNA signal amplification to improve the detection sensitivity.
[0089] (3) React the RCA product fragment rich in G bases obtained in step (2) with SA-MB. After separating the pure RCA product fragment using a magnetic stand, perform a water bath reaction with o-ppy nanozyme. After the reaction is complete, obtain the SA-MB-o-ppy nanozyme@ssDNA complex, measure the change in peroxidase-like activity before and after the reaction, and calculate the content of the pesticide in the sample solution to be measured by comparing the measured absorbance value with the standard curve; at the same time, perform a water bath reaction with o-ppy nanozyme on the RCA product fragment rich in G bases obtained in step (2). After the reaction is complete, obtain the o-ppy nanozyme@ssDNA complex, measure the fluorescence intensity before and after the reaction, and calculate the content of the pesticide in the sample solution to be measured by comparing the measured fluorescence intensity value with the standard curve.
[0090] Example 4: A method for detecting malathion by using DNA dual-responsive enzyme-coupled rolling circle amplification reaction
[0091] (1) Add 10 μL of the malathion capture primer H1-Apt prepared in Example 3 to the sample solution to be tested, with a total volume of 15 μL. Mix and react in a metal bath or PCR instrument at 37 °C for 30 - 60 min to allow sufficient reaction, so that the pesticide in the sample to be tested binds to the corresponding nucleic acid aptamer on H1-Apt to form Apt-pesticide, releasing the H1 sequence;
[0092] (2) Add 7 μL of 10 μM circular template CT, 2.5 μL of 10×T4 DNA ligase buffer, and 2.5 μL of DEPC-treated water, react at 95 °C for 5 min, then cool to 25 °C and react for 1 h. Subsequently, add 2.5 μL of T4 DNA ligase and react at 22 °C for 2.5 h, inactivate at 65 °C for 10 min to ligate H1 to the circular template CT into a ring. Add 1 μL (20 U / μL) of exonuclease I to degrade the unreacted H1 in the system;
[0093] (3) Add 2 μL of 10×Phi29 DNA polymerase buffer, 0.6 μL of Phi29 DNA polymerase, 1 μL of dNTPMix, and 17.4 μL of DEPC-treated water, then react at 37 °C for 5 min and then at 65 °C for 10 min to terminate the reaction, obtaining an RCA product rich in G-base sequences by amplification;
[0094] (4) React the G-base-rich RCA product fragment obtained in step (3) with SA-MB, separate with a magnetic stand for 30 - 60 s to obtain a pure RCA product fragment, then perform a water bath reaction with o-ppy nanozyme for 1 - 1.5 h. After the reaction is complete, obtain the SA-MB-o-ppy nanozyme@ssDNA complex, measure the absorbance of the reaction, and compare the measured absorbance value with the standard curve to calculate the content of the pesticide in the sample solution to be tested;
[0095] (5) Detection of pesticide by fluorescence method: Mix the G-base-rich RCA product fragment obtained in step (3) with o-ppy nanozyme at a volume ratio of 1:1, perform a water bath reaction for 1 - 1.5 h. After the reaction is complete, obtain the o-ppy nanozyme@ssDNA complex, measure the fluorescence intensity before and after the reaction, and compare the measured fluorescence intensity value with the standard curve to calculate the content of the pesticide in the sample solution to be tested.
[0096] (6) Plotting of the standard curve: Add 1 - 7 nM of malathion pesticide to the above reaction system, and perform operations according to steps (1)-(5). Measure the absorbance before and after the reaction, plot the standard curve for colorimetric detection, and obtain the standard curve formula as y = 0.01464x + 0.1299, R 2 = 0.9952, and the detection limit is 0.54 nM, as Figure 11 shown.
[0097] Measure the fluorescence intensity before and after the reaction, plot the standard curve, and obtain the standard curve formula as y = 25.6073x + 1127.7550, R 2 = 0.9963, and the detection limit is 0.0605 nM, as Figure 12 shown.
[0098] Example 5: Specificity of the malathion detection method
[0099] The experimental system is the same as that in Example 3, and the detection method is the same as that in Example 4. Select four pesticides, chlorpyrifos, dimethoate, phoxim, and acetamiprid, as interfering pesticides to conduct tests simultaneously with malathion. The concentrations of the above pesticides are all 10 nM;
[0100] The specificity results are as Figure 13 and 14 shown: It can be seen from the fluorescence intensity and absorbance after the reaction that the malathion value is significantly higher than that of other pesticides. Therefore, the malathion detection method in Example 4 of the present invention has high specificity for malathion.
[0101] Example 6: Specific sample detection examples
[0102] The pesticide capture initiation probe H1-Apt prepared in Example 3 was added with the test sample solution, and the mixture was reacted at 37 °C for 30 min to allow the pesticide in the test sample to bind to the corresponding nucleic acid aptamer on H1-Apt to form Apt-pesticide, releasing the H1 sequence; the RCA reaction of Example 2 was carried out to obtain the RCA product rich in G-base sequence; 10 μg / mL o-ppy nanozyme prepared in Example 1 was added, and the reaction was carried out in a water bath for 1.5 h. The reaction solution was scanned by a fluorescence spectrophotometer, and the fluorescence emission spectrum at an excitation wavelength of 365 nm was measured. The measured fluorescence intensity was imported into the standard curve, and the concentration of malathion in the test sample was calculated to be 10 nM; the pure RCA product was separated from the system using streptavidin-modified magnetic beads, 30 μg / mL o-ppy nanozyme prepared in Example 1 was added, and the reaction was carried out in a water bath for 1.5 h. Then it was added to the optimized TMB color development system in Example 2(2) for reaction. The absorption peak at 652 nm after the reaction was scanned by an enzyme-linked immunosorbent assay (ELISA) reader or an ultraviolet-visible spectrophotometer. The measured absorbance was imported into the standard curve, and the concentration of malathion in the test sample was calculated to be 10 nM.
[0103] In summary, the present invention provides a DNA dual-responsive nanozyme. The DNA dual-responsive nanozyme can effectively avoid problems such as energy consumption and environmental pollution caused by high-temperature and high-pressure treatment by operating under low-temperature and low-pressure conditions. At the same time, the preparation method has strong operability and is environmentally friendly; it has strong peroxidase-like activity and can be widely used in the fields of biocatalysis and sensing detection; the prepared polypyrrole oxide nanozyme has good responsiveness to DNA sequences with specific bases; the present invention also provides a detection kit containing the DNA dual-responsive nanozyme. The kit is used for detecting malathion, has high specificity, high stability and a low detection limit, and the lowest detection limit is 0.0605 nM; the detection kit of the invention is used for detecting malathion, has the characteristics of simple operation, no need for complex pretreatment of the test sample, no need for expensive reagents, low detection cost, and can realize portable detection.
[0104] The above are only the preferred embodiments of the present invention, and are not intended to limit the present invention in other forms. Any person skilled in the art may use the disclosed technical content to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the technical solution content of the present invention still belong to the protection scope of the technical solution of the present invention.
Claims
1. A DNA dual-responsive nanozyme, characterized in that, The DNA dual-responsive nanozyme is prepared by the following method: (1) Preparation of polypyrrole particles: Dissolve pyrrole monomer in pure water, place it in an ice-water bath with ammonium persulfate for reaction, centrifuge to obtain a black product, wash, purify by dialysis, and dry to obtain polypyrrole; (2) Preparation of oxidized polypyrrole nanozyme: Add H2O2 to the polypyrrole prepared in step (1), react in a water bath, filter, perform hydrothermal reaction in an oven, filter again, purify by dialysis, and freeze-dry to obtain the DNA dual-responsive nanozyme.
2. The application of the DNA dual-responsive nanozyme according to claim 1 in the preparation of a detection kit.
3. A pesticide dual-mode detection kit based on DNA dual-responsive enzyme-coupled rolling circle amplification reaction, characterized in that, The kit includes a pesticide capture primer H1-Apt, a circular template CT, T4 DNA ligase, Phi29 DNA polymerase, dNTP Mix, SA-MB, o-ppy nanozyme, and a TMB color development system; The pesticide capture probe H1-Apt contains the nucleic acid aptamer Apt for the pesticide to be detected and its complementary sequence H1 ligated to a biotin molecule at the 5'-end; the circular template CT is a sequence that is complementary to the H1 strand at both ends and rich in C bases.
4. The kit according to claim 3, wherein The TMB color development system includes TMB, H2O2, and sodium acetate buffer with a pH of 4.
5. The kit according to claim 3, characterized in that, The pesticide to be detected by the kit is malathion, and the H1 sequence is: 5’biotin-ATACGGGAGCCAACACCA-3’; The Apt sequence is: 5’-ATCCGTCACACCTGCTCTTATACACAATTGTTTTTCTCTTAACTTCTTGACTGCTGGTGTTGGCTCCCGTAT-3’; The CT sequence is: 5’P-CTCCCGTATTACCTAGCTCCCTTCCCACCCTTCCCACCCTCCCTTCCCATGGTGT TGG-3’.
6. The application of the kit according to any one of claims 3-5 in the detection of malathion.
7. An organophosphorus pesticide dual-mode detection method based on DNA dual-responsive enzyme-coupled rolling circle amplification reaction, characterized in that, It includes the following steps: (1) Add the pesticide capture probe H1-Apt to the sample solution to be detected, so that the pesticide standard in the sample to be detected binds to the corresponding nucleic acid aptamer on H1-Apt to form Apt-pesticide, release the H1 sequence, and the free H1 and the circular template CT rich in C bases are ligated into a ring by base complementary pairing under the action of T4 DNA ligase to form a circular probe. At the same time, add exonuclease I to degrade the unreacted H1 in the system; (2) Add Phi29 DNA polymerase, buffer, and reaction substrate dNTPMix to the reaction solution containing the circular template in step (1) to initiate a rolling circle amplification reaction to obtain an RCA product fragment rich in G bases; (3) Colorimetric detection of pesticides: The RCA product fragment rich in G bases obtained in step (2) is combined with streptavidin-modified magnetic beads. After obtaining pure RCA products by magnetic separation, a water bath reaction is carried out with DNA dual-responsive nanozymes. After the reaction is complete, an SA-MB-o-ppy nanozyme@ssDNA complex is obtained. By observing the color change of TMB and measuring the absorbance value using the change in the peroxidase-like activity of o-ppy nanozyme before and after the reaction, and referring to the standard curve, the content of organophosphorus pesticides in the sample solution to be measured is calculated; (4) Fluorescent detection of pesticides: The RCA product fragment rich in G bases obtained in step (2) is subjected to a water bath reaction with DNA dual-responsive nanozymes. After the reaction is complete, an o-ppy nanozyme@ssDNA complex is obtained. The fluorescence intensity before and after the reaction is measured. The measured fluorescence intensity value is compared with the standard curve to calculate the content of organophosphorus pesticides in the sample solution to be measured.