Defect engineering-based metal organic framework as well as preparation method and application thereof

Abstract

The invention discloses a metal organic framework based on defect engineering as well as a preparation method and application thereof, and relates to the technical field of biosensors, Zr-TCPE-BA (X) MOFs are prepared by taking zirconium tetrachloride and 1, 1, 2, 2-tetracarboxystyrene as precursors and benzoic acid as a defect regulating agent, and X is the molar equivalent of BA relative to the 1, 1, 2, 2-tetracarboxystyrene; in Zr-TCPE-BA (X) MOFs, benzoic acid and 1, 1, 2, 2-tetracarboxystyrene compete for coordination of metal nodes to form defects, and the defects serve as a recombination center to accelerate hole injection and electron-hole pair recombination in the electrooxidation process, so that the Zr-TCPE-BA (X) MOFs have high electrogenerated chemiluminescence. According to the preparation method, Zr-TCPE-BA (X) MOFs are synthesized by adopting 1, 1, 2, 2-tetracarboxystyrene and zirconium tetrachloride as precursors and benzoic acid as a regulator, the ECL efficiency of MOFs / GCE can be effectively improved, and Zr-TCPE-BA (X) MOFs / GCE shows excellent ECL performance through a self-co-reaction way.

Description

Technical Field

[0001] The present invention relates to the technical field of biosensors, and particularly relates to a metal-organic framework based on defect engineering, a preparation method thereof, and an application thereof. Background Art

[0002] Perfluorooctanoic acid (PFOA) is a typical representative of perfluoroalkyl compounds, and has excellent surface activity, weather resistance, and flame retardancy. In recent years, PFOA has been recognized as a persistent pollutant, and has many adverse effects on human health, including reducing fertility, inhibiting immune function, causing thyroid diseases, and even causing cancer.

[0003] The trace detection of PFOA has become a difficult problem to be solved urgently in environmental monitoring. At present, high-performance liquid chromatography-mass spectrometry (HPLC-MS) is the standard method for detecting PFOA, but its operation is time-consuming and complex, and the detection limit can only reach the ng / L level. Although fluorescence method, electrochemical method, and surface-enhanced Raman spectroscopy have the advantages of simple operation and rapid detection, the detection limit for PFOA is usually higher than ng / L. Obviously, these reported methods are difficult to meet the need for trace monitoring of PFOA far below the limit value. Therefore, this challenge urgently requires the development of a new detection method with simple operation and high sensitivity.

[0004] Electrochemiluminescence (ECL) is a luminescence phenomenon generated by an electrochemical reaction on the electrode surface, and has the advantages of high sensitivity, wide dynamic range, strong controllability, simple operation, and rapid response. As a typical class of porous materials, metal-organic frameworks (MOFs) have become a research hotspot in the current ECL field due to their adjustable structure, easy modification, and high specific surface area.

[0005] However, the ECL efficiency of MOFs is relatively limited, and improving its ECL efficiency has always been the unremitting pursuit of researchers. Although a variety of strategies have been adopted to enhance its ECL efficiency, such as preparing multi-metal MOFs, doping transition metal ions, applying mixed ligands, and introducing co-reaction accelerators, these reported MOF-based systems usually require exogenous co-reactants, such as tripropylamine in anodic emission and persulfate in cathodic emission.

[0006] The prior art lacks the technology to directly regulate the self-ECL efficiency of MOFs through defect engineering, and lacks a technical solution to improve the ECL efficiency without exogenous co-reactants. Summary of the Invention

[0007] Aiming at the above-mentioned deficiencies of the prior art, the present invention provides a metal-organic framework based on defect engineering without exogenous co-reactants, a preparation method thereof, and an application thereof.

[0008] To achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows:

[0009] Provide a metal-organic framework Zr-TCPE-BA(X)MOFs based on defect engineering, which is prepared by using zirconium tetrachloride and 1,1,2,2-tetracarboxystyrene as precursors and benzoic acid as a defect regulator, where X is the molar equivalent of BA relative to 1,1,2,2-tetracarboxystyrene;

[0010] In Zr-TCPE-BA(X)MOFs, benzoic acid competes with 1,1,2,2-tetracarboxystyrene for the coordination of metal nodes to form defects, and the defects act as recombination centers, accelerating the hole injection and electron-hole pair recombination during the electrooxidation process, and having high electrochemiluminescence.

[0011] The present invention also provides a preparation method of the above-mentioned metal-organic framework based on defect engineering, and the specific steps are as follows:

[0012] A1: Ultrasonically and uniformly disperse zirconium tetrachloride, 1,1,2,2-tetracarboxystyrene and benzoic acid in a solvent;

[0013] A2: React the mixture at 120 °C for 24 h, and after cooling to room temperature, centrifuge and filter to obtain a filtrate;

[0014] A3: Wash and dry with N,N-dimethylformamide and methanol to obtain the metal-organic framework Zr-TCPE-BA(X)MOFs.

[0015] Furthermore, the mass ratio of zirconium tetrachloride to 1,1,2,2-tetracarboxystyrene is 12:3-4; and the molar ratio of benzoic acid to 1,1,2,2-tetracarboxystyrene is 50-150:1.

[0016] The present invention also provides an application of the above-mentioned metal-organic framework in the preparation of an electrochemiluminescent biosensor, which is characterized in that the electrochemiluminescent biosensor is obtained by combining Zr-TCPE-BA(X)MOFs with a nucleic acid amplification reaction triggered by a nucleic acid aptamer.

[0017] The present invention also provides an application of the above-mentioned metal-organic framework in the preparation of an electrochemiluminescent biosensor for detecting perfluorooctanoic acid, which is characterized in that the electrochemiluminescent biosensor for detecting perfluorooctanoic acid is obtained by combining Zr-TCPE-BA(X)MOFs with a nucleic acid amplification reaction triggered by a nucleic acid aptamer capable of responding to perfluorooctanoic acid.

[0018] The present invention also provides a preparation method of the above-mentioned electrochemiluminescent biosensor for detecting perfluorooctanoic acid, and the specific steps are as follows:

[0019] B1: Prepare hairpin chains H1 and H2 by annealing method; then mix 1-(3-(dimethylamino)propyl)-3-ethylcarbodiimide hydrochloride with carboxyl-labeled magnetic beads MB and react at room temperature for 20 min to obtain microbeads with activated surface carboxyl groups;

[0020] The sequence of hairpin chain H1 is shown as SED ID NO.1: NH2-(CH2)6-TTTAAACTTTGCCG TGCCGTGGATGTAACAGCTGAGGTCCACGGCACGGCATTT;

[0021] The sequence of hairpin chain H2 is shown as SED ID NO.2: TGTTACATCCACGGCACGGCA AATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT GCCGTGCCGTGGACCTCAGC;

[0022] B2: Add hairpin chain H1 and N-hydroxysuccinimide to the microbeads with activated surface carboxyl groups obtained in step B1 and react overnight at 4 °C; after the reaction is completed, collect the H1 / MB complex by magnetic separation;

[0023] B3: Mix the H1 / MB complex, DNA single strand S1, hairpin chain H2, DNA polymerase Phi29, restriction enzyme Nt.BbvCI, nucleoside triphosphates dNTPs, 10×Phi29 buffer and 10×Nt.BbvCI buffer, and react at 37 °C for 2 h; collect the supernatant by magnetic separation and inactivate at 80 °C for 20 min to obtain the secondary target ST;

[0024] The sequence of single strand S1 is shown as SED ID NO.3: TACATCCACGGCACGGCAAAGT TTTTT;

[0025] B4: Ultrasonically disperse Zr-TCPE-BA(X) MOFs in ultrapure water to obtain a dispersion, and drop the dispersion on the surface of a cleaned glassy carbon electrode and naturally dry at room temperature to obtain a metal-organic framework layer;

[0026] B5: Drop platinum nanoparticle solution on the surface of the metal-organic framework layer and naturally dry to obtain a platinum nanoparticle layer;

[0027] B6: Incubate amino-labeled single strand S2 on the surface of the platinum nanoparticle layer at 4 °C for 12 h, and then incubate hexanethiol at 4 °C for 1 h;

[0028] The sequence of single-stranded S2 is shown in SED ID NO.4: NH2-(CH2)6-AAACTTTGCCGTGCCGTGGATGTAACAGCTGA;

[0029] B7: Then, the mixture of single-stranded S3 labeled with BHQ1 and the secondary target ST obtained in step B6 was incubated at 37 °C for 2 h; thus, an electrochemiluminescence biosensor for detecting perfluorooctanoic acid was obtained.

[0030] The sequence of single-stranded S3 is shown in SED ID NO.5: TGTTACATCCACGGC-BHQ1.

[0031] Furthermore, in step B1, 10 μL of 1-(3-(dimethylamino)propyl)-3-ethylcarbodiimide hydrochloride with a concentration of 0.16 g / mL and 15 μL of carboxyl-labeled magnetic beads MB with 0.1% w / V were used to prepare surface carboxyl-activated beads.

[0032] Furthermore, when preparing the H1 / MB complex in step B2, the dosage of hairpin chain H1 was 5 μL, 10.0 μM; the dosage of N-hydroxysuccinimide was 10 μL, 0.04 g / mL;

[0033] And in step B3 when preparing the secondary target ST, the dosage of DNA single-stranded S1 was 25 μL, 2 μM; the dosage of hairpin chain H2 was 5 μL, 10.0 μM; the dosage of DNA polymerase Phi29 was 0.5 μL, 10 U / μL; the dosage of endonuclease Nt.BbvCI was 1 μL, 10 U / μL; the dosage of nucleoside triphosphates dNTPs was 2.5 μL, 10 mM; the dosage of 10×Phi29 buffer was 5 μL and the dosage of 10×Nt.BbvCI buffer was 5 μL.

[0034] Furthermore, in steps B4 - B7, the diameter of the glassy carbon electrode was 4 mm, the dosage of the dispersion was 10 μL, 1.0 mg / mL; the dosage of the platinum nanoparticle solution was 5 μL, 0.1 - 1 mM; the dosage of amino-labeled single-stranded S2 was 10 μL, 0.5 μM; the dosage of hexanethiol was 10 μL, 1.0 mM; the dosage of BHQ1-labeled single-stranded S3 was 5.0 μL, 1.0 μM; the dosage of the secondary target ST was 5.0 μL.

[0035] The beneficial effects of the present invention are:

[0036] In the present invention, Zr-TCPE-BA(X) MOFs were synthesized by using 1,1,2,2-tetracarboxystyrene and zirconium tetrachloride as precursors and benzoic acid as a regulator, which can effectively improve the ECL efficiency of MOFs / GCE, and Zr-TCPE-BA(X) MOFs / GCE exhibits excellent ECL performance through a self-co-reactant pathway.

[0037] In the present invention, an ECL aptasensor with low LOD, good selectivity and stability was constructed by coupling self-driven and self-enhanced DNA walker-mediated SDA strategy using Zr-TCPE-BA(X) MOFs, which can be used to detect persistent micro-pollutant PFOA, showing potential practical application prospects. It has the advantages of preparing a sensor with high ECL efficiency without an external co-reactant and being simple and efficient. Description of the Drawings

[0038] Figure 1 It is a characterization result diagram of four MOFs in Example 2;

[0039] Figure 2 It is a physical adsorption test result diagram of four MOFs in Example 2;

[0040] Figure 3 It is an ECL performance detection result diagram of four MOFs in Example 4;

[0041] Figure 4 It is a schematic diagram of electron-hole recombination of Zr-TCPE-BA(100) MOFs in Example 5;

[0042] Figure 5 It is an ECL response result diagram of Zr-TCPE-BA(100) MOFs / GCE in Example 6;

[0043] Figure 6 It is a stability verification result diagram of Zr-TCPE-BA(100) MOFs / GCE in Example 7;

[0044] Figure 7 It is a schematic diagram of the principle for the biosensor of the present invention to detect perfluorooctanoic acid. Detailed Embodiments

[0045] The following describes the detailed embodiments of the present invention to facilitate those skilled in the art to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the detailed embodiments. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions and creations using the concept of the present invention are within the scope of protection.

[0046] The sources of raw materials and instruments used in the examples are as follows:

[0047] 1,1,2,2-Tetracarboxystyrene (H4TCPE) was purchased from Titan Scientific Co., Ltd. (Shanghai, China). Benzoic acid (BA) was purchased from Hynes Biochemical Technology Co., Ltd. (Tianjin, China). Zirconium tetrachloride (ZrCl4) was provided by Xianding Biotechnology Co., Ltd. (Shanghai, China). Perfluorooctanoic acid (PFOA) was purchased from Ehrenstorfer GmbH (Augsburg, Germany). Perfluorononanoic acid (PFPA) and perfluoroheptanoic acid (PFHA) were purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). Shanghai Macklin Biochemical Co., Ltd. provided N,N-dimethylformamide (DMF) and N-hydroxysuccinimide (NHS). Carboxyl-labeled magnetic beads (MBs) were purchased from Evonik Chemical Technology Co., Ltd. (Shanghai, China). Magnesium chloride (MgCl2) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) were purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). Chloroplatinic acid (H2PtCl6·6H2O) was purchased from Shanghai Macklin Biochemical Co., Ltd. (Shanghai, China). Nt.BbvCI nicking enzyme (recognition sequence: 5’-CC↓TCAGC-3’) was provided by New England Biolabs (Beijing) Co., Ltd. (Beijing, China). Hexanethiol (HT) was purchased from Sigma-Aldrich Co. (St. Louis, Missouri, USA). Sodium citrate, sodium borohydride (NaBH4) and methanol (CH3OH) were purchased from Chongqing Chuandong Chemical Co., Ltd. (Chongqing, China). Phi29 DNA polymerase (10U / μL), deoxynucleoside triphosphates (dNTPs), N,N,N,N-tetramethylethylenediamine (TEMED), ammonium persulfate (APS), acrylamide and all DNA oligonucleotides were provided by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). Ultra-pure water (≥18MΩ·cm-1) was used throughout the experiment. Phosphate buffer (PBS, pH 7.4) was prepared from 0.10M KH2PO4, 0.10M Na2HPO4 and 0.10M KCl. 1×TE buffer (pH 8.0) consisted of 10.0mM Tris, 1.0mM ethylenediaminetetraacetic acid (EDTA) and 12.5mM MgCl2 standard solution. 5×TBE buffer (pH 8.0) was prepared from 10mM EDTA, 445mM Tris base and 445mM boric acid.

[0048] Electrochemiluminescence signals were collected using an MPI-A electrochemiluminescence analyzer (Xi'an Ruima Analytical Instruments Co., Ltd., Xi'an, China). Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) measurements were performed using a CHI600D electrochemical workstation (Shanghai Chenhua Instruments, China). Electrochemiluminescence spectra were obtained by combining a CHI 760E electrochemical workstation (Vertex, Ivium, Netherlands) with a Newton EMCCD spectral detector (A&D, Japan). Fluorescence and ultraviolet-visible absorption spectra were analyzed using an FL-5700 fluorescence spectrophotometer (Hitachi, Tokyo, Japan) and a UV-2450 ultraviolet-visible spectrophotometer (Shimadzu, Japan), respectively. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observations of the nanomaterials were carried out using an SU8020 scanning electron microscope (Hitachi, Japan) and an H-800 transmission electron microscope (Hitachi, Japan). Fourier transform infrared spectroscopy (FT-IR) was performed on a Summit X Fourier transform infrared spectrometer (Thermo Fisher Scientific). Thermogravimetric analysis (TGA) was obtained by NETZSCH STA449F3. Physical adsorption data were provided by American MACStritar II 3020.

[0049] Example 1: Synthesis of Zr-TCPE-BA(X) MOFs

[0050] ZrCl4 (60 mg), H4TCPE (19 mg), and different masses of BA (0.0, 0.2284, 0.4567, 0.6851 g, corresponding to X taking 0, 50, 100, and 150 respectively) were added to a mixed solvent (4.0 mL DMF + 2.0 mL H2O). After ultrasonic dispersion, the mixture was transferred to a Teflon-lined reaction kettle and hydrothermally reacted at 120 °C for 24 h. After the system cooled to room temperature, the product was collected by centrifugation (12,000 rpm, 10 min), washed three times with DMF and methanol respectively, and dried overnight at room temperature. If a dispersion was needed, the obtained Zr-TCPE-BA(X) MOFs were dispersed in ultrapure water to prepare a uniform dispersion of 1.0 mg / mL for standby.

[0051] Example 2: Characterization and Detection of Zr-TCPE-BA(X) MOFs

[0052] The MOFs prepared with four BA equivalents in Example 1 were characterized and detected, including SEM detection, XRD detection, Fourier transform infrared spectroscopy detection, and thermogravimetric analysis; the results are as Figure 1 shown, where Figure 1 A is the SEM image of the four MOFs, Figure 1 B is the XRD detection results of the four MOFs, Figure 1C is the Fourier transform infrared spectroscopy detection results of four MOFs. Figure 1 D is the thermogravimetric analysis results of four MOFs.

[0053] Depend on Figure 1 As can be seen from A, Zr-TCPE-BA(0)MOFs and Zr-TCPE-BA(50)MOFs exhibit irregular small particle aggregation structures. When the equivalent X of BA increases to 100, the degree of particle aggregation is significantly weakened, and relatively dispersed small crystals appear. With the further increase of X, Zr-TCPE-BA(150)MOFs present a regular monodisperse nanoflower structure. The morphological changes of Zr-TCPE-BA(X)MOFs with different X values indicate that the regulator BA plays a vital role in the crystallization process of MOFs.

[0054] Depend on Figure 1 As shown in Figure 2, no characteristic peaks are observed in Zr-TCPE-BA(0)MOFs. The XRD peaks of the other three Zr-TCPE-BA(X)MOFs (X=50, 100, 150) are consistent with the XRD spectra of the scu topological mimic structure of Zr-MOFs. The XRD characterization of Zr-TCPE-BA(X)MOFs reveals the promoting effect of the regulator BA on the growth of MOFs crystals.

[0055] Depend on Figure 1 It can be seen that the four MOFs have similar FT-IR spectra with the wavelengths at 3394, 1656, 1180 and 768 cm -1 The characteristic peaks at correspond to the stretching vibrations of -OH, C=O, and CO, and the bending vibrations of CH on the benzene ring. As the BA equivalent X increases, the stretching vibration peaks of CO and the bending vibration peaks of CH gradually increase, proving that BA was successfully introduced into MOFs.

[0056] Depend on Figure 1 D shows that the TGA curves of the four MOFs (red solid lines) show three weight loss stages and have good stability at temperatures up to 460°C. Before 200°C, the solvents (N, N-dimethylformamide and H2O) in the MOFs volatilize. At 200-460°C, the Zr6 cornerstone undergoes a dehydroxylation reaction. In the range of 460-560°C, the linker and benzoate are lost, the skeleton decomposes, and the final residue is ZrO2. Accordingly, differential scanning calorimetry (DSC) analysis was performed on the four Zr-TCPE-BA(X)MOFs. Figure 1D gives the corresponding curve (blue dotted line). In the third stage of 460 - 560 °C, a strong absorption peak appears, and the absorption peak increases with the increase of the BA equivalent X. At 460 - 560 °C, the weight loss of Zr-TCPE-BA(X) MOFs increases with the increase of the BA equivalent X, and the amount of BA used is proportional to the weight loss, further proving that BA is successfully introduced into Zr-TCPE-BA(X) MOFs.

[0057] To verify the structural defects of Zr-TCPE-BA(X) MOFs, physical adsorption tests were carried out on Zr-TCPE-BA(X) MOFs. The results are as Figure 2 shown, where Figure 2 A is the nitrogen adsorption-desorption isotherm, Figure 2 B is the BET specific surface area and pore volume. As can be seen from Figure 2 A, with the increase of the BA equivalent X, the nitrogen absorption amount gradually increases. As can be seen from Figure 2 B, as the BA equivalent X increases from 0 to 150, the BET surface area of the MOFs increases from 212.37 to 447.68 m 2 / g, and the pore volume increases from 0.15 to 0.65 cm 3 / g. The specific values are shown in Table 1 below. The physical adsorption test confirmed that the regulator BA would induce the formation of defects in Zr-TCPE-BA(X) MOFs by competing with H4TCPE for the coordination of metal nodes, and with the increase of the BA equivalent X from 0 to 150, the defects also increased.

[0058] Table 1

[0059] <![CDATA[BET specific surface area (m 2 / g)]]> <![CDATA[Pore volume (cm 3 / g)]]> Zr-TCPE-BA(0)MOFs 212.371 0.152672 Zr-TCPE-BA(50)MOFs 267.207 0.210152 Zr-TCPE-BA(100)MOFs 318.327 0.408862 Zr-TCPE-BA(150)MOFs 447.676 0.653222

[0060] Example 3 Construction of an Electrochemiluminescence Biosensor for Detecting Perfluorooctanoic Acid

[0061] Before preparation, the specific reaction between the single-stranded DNA Apt and perfluorooctanoic acid was verified, specifically:

[0062] 1-(3-(Dimethylamino)propyl)-3-ethylcarbodiimide hydrochloride (EDC) (10 μL, 0.16 g / mL) was added to 15 μL of washed carboxyl-labeled magnetic beads (MB) (w / V, 0.1%), and the reaction was carried out at room temperature for 20 min to activate the carboxyl groups on the surface of MB. Subsequently, N-hydroxysuccinimide (NHS) (10 μL, 0.04 g / mL) and amino-labeled single-stranded nucleic acid aptamer (Apt) (5.0 μL, 10.0 μM) were added, and the reaction was carried out at 4.0 °C overnight. After the reaction was completed, the Apt / MB complex (20 μL) was collected by magnetic separation and mixed with single-stranded S1 (5.0 μL, 10.0 μM), and the reaction was carried out at 37 °C for 2 h to complete the hybridization of Apt and S1 on MB, and the S1-Apt / MB complex was collected by magnetic separation.

[0063] The S1-Apt / MB complex was mixed with different concentrations of the target PFOA, and the supernatant after standing was collected by magnetic separation, and single-stranded S1 was verified to appear in the supernatant, proving that PFOA can specifically bind to the S1-Apt / MB complex to release S1.

[0064] The method for constructing an electrochemiluminescence biosensor for detecting perfluorooctanoic acid is specifically as follows:

[0065] S1: Single-stranded H1 and single-stranded H2 were annealed at 95 °C to form H1 and H2 hairpin strands respectively. Subsequently, EDC (10 μL, 0.16 g / mL) was mixed with 40 μL of washed carboxyl-labeled magnetic beads (MB) (w / V, 0.1%), and the reaction was carried out at room temperature for 20 min to activate the carboxyl groups on the surface of MB;

[0066] Then, amino-labeled hairpin strand H1 (5.0 μL, 10.0 μM) and NHS (10 μL, 0.04 g / mL) were added, and the reaction was carried out at 4.0 °C overnight to form the H1 / MB complex. Subsequently, single-stranded S1 (25 μL, 2 μM), hairpin strand H2 (5.0 μL, 10.0 μM), Phi29 DNA polymerase (0.5 μL, 10 U / μL), Nt.BbvCI restriction enzyme (1.0 μL, 10 U / μL), dNTPs (2.5 μL, 10 mM), 10×Phi29 buffer (5.0 μL) and 10×Nt.BbvCI buffer (5.0 μL) were mixed with the H1 / MB complex (6.0 μL), and the reaction was carried out at 37 °C for 2 h. Finally, the supernatant was collected by magnetic separation and inactivated at 80 °C for 20 min to obtain the secondary target ST, which was stored at 4 °C;

[0067] S3: First, polish a glassy carbon electrode (GCE) with a diameter of 4.0 mm using 0.3 μm alumina powder, and alternately clean it with ethanol and distilled water to obtain a smooth surface.

[0068] Subsequently, uniformly drop the Zr-TCPE-BA(X) MOFs dispersion (1.0 mg / mL) prepared in Example 1 onto the surface of the GCE and naturally dry it at room temperature.

[0069] Next, drop 5.0 μL of a platinum nanoparticle (Pt NPs) solution and naturally dry it again.

[0070] After that, incubate 10 μL of amino-labeled single-stranded S2 (0.5 μM) on the surface of the platinum nanoparticle layer at 4 °C for 12 h, and assemble S2 onto the electrode surface through the Pt-N bond.

[0071] Subsequently, incubate with hexanethiol (HT) (10 μL, 1.0 mM) at 4 °C for 1 h to block non-specific binding sites. Finally, incubate a mixture of 5.0 μL of BHQ1-labeled single-stranded S3 (5.0 μL, 1.0 μM) and 5.0 μL of the secondary target ST prepared from S2 at 37 °C for 2 h to complete the construction of the electrochemiluminescence biosensor.

[0072] During specific implementation, after each step of modification, wash the modified GCE with PBS (0.10 M, pH 7.4) to remove unbound reactants and impurities.

[0073] The platinum nanoparticle (Pt NPs) solution is prepared using the prior art. Specifically: Dilute 350 mL of 1.0% chloroplatinic acid (H2PtCl6) with deionized water to 15 mL, and then fully mix it with 1.0 mL of 50 mM sodium citrate solution in a 50 mL beaker. Next, drop in 0.5 mL of 30 mM NaBH4 solution, seal and stir for 30 min to obtain a Pt NPs solution with a concentration of 0.1 - 1 mM, a particle size range of 1 - 6 nm, and an average particle size of 3.25 nm. During specific implementation, the platinum nanoparticles can be prepared by purchasing commercially available products with the corresponding particle size. The dosage of the platinum nanoparticles does not affect the performance of the prepared MOFs / GCE. Under the condition of being economical and applicable, a concentration of 0.1 - 1 mM is acceptable.

[0074] ECL performance detection of electrochemiluminescence biosensors prepared with different MOFs in Example 4

[0075] The ECL efficiency of Zr-TCPE-BA(X) MOFs is explored by referring to the method in the existing literature. According to the formula The relative efficiency was calculated by integrating the changes in electrochemiluminescence intensity (I) and current value (i) over time (t). Among them, φ0 represents the ECL efficiency of Zr-TCPE-BA(0) MOFs modified on the GCE in PBS (0.10 M, pH 7.4), which is used as an internal reference and set to 100%. The acquisition of the ECL signal was carried out in 3.0 mL of PBS (0.10 M, pH 7.4). A three-electrode system was adopted, in which four kinds of MOFs / GCE prepared with different BA equivalents (X = 0, 5, 100, 150) prepared in Example 3 were used as the working electrode, a platinum wire electrode was used as the counter electrode, and an Ag / AgCl electrode was used as the reference electrode. During the measurement, the scanning potential range was set from 0 to +1.25 V, the scanning rate was 300 mV / s, and the photomultiplier tube (PMT) voltage was 800 V.

[0076] The results are as Figure 3 shown, where Figure 3 A is the comparison diagram of the ECL response, Figure 3 B is the cyclic voltammogram, Figure 3 C is the EIS measurement result, Figure 3 D is the comparison diagram of the ECL transient analysis, and a, b, c, and d are MOFs / GCE prepared with BA equivalents of 0, 50, 100, and 150 in sequence. From Figure 3 A, it can be seen that from Zr-TCPE-BA(0) MOFs / GCE to Zr-TCPE-BA(100) MOFs / GCE, as the defect level increases, the ECL signal gradually increases. Zr-TCPE-BA(100) MOFs / GCE exhibits the strongest and most stable high electrochemiluminescence without an external coreactant. While Zr-TCPE-BA(50) MOFs / GCE exhibits stable but weaker high electrochemiluminescence than Zr-TCPE-BA(100) MOFs / GCE; the ECL signal at Zr-TCPE-BA(150) MOFs / GCE is strong but unstable, which may be due to the excessive defects causing the instability of the Zr-TCPE-BA(150) MOFs structure.

[0077] Taking Zr-TCPE-BA(0) MOFs / GCE as the standard and setting its ECL efficiency to 1, the ECL efficiencies of MOFs / GCE with different defect levels were calculated, and the results are shown in Table 2;

[0078] Table 2

[0079]

[0080] As can be seen from Table 2, the ECL efficiencies of Zr-TCPE-BA(50)MOFs / GCE, Zr-TCPE-BA(100)MOFs / GCE, and Zr-TCPE-BA(150)MOFs / GCE are approximately 7.98 times, 14.30 times, and 8.09 times that of Zr-TCPE-BA(0)MOFs / GCE, respectively. Obviously, Zr-TCPE-BA(X)MOFs / GCE (X≠0) with appropriate defects significantly enhances the high electrochemiluminescence of Zr-MOFs / GCE. Therefore, it can be used as an ECL emitter to prepare biosensors.

[0081] As Figure 3 shown in B, an obvious oxidation peak was observed at +1.29 V, which originated from the oxidation of MOFs. When the BA equivalent X increased from 0 to 150, the peak current increased with the increase in the defect level, indicating that the defects accelerated the generation of cation radicals and promoted the charge transfer on the GCE surface.

[0082] The electrochemical impedance spectra (EIS) of four Zr-TCPE-BA(X)MOFs / GCE were detected in 5.0 mM [Fe(CN)6] 3- / 4- , and the results are shown in Figure 3 C. As Figure 3 shown in C, with the increase in the defect degree, the semicircle diameter of the EIS diagram gradually decreased, which also indicated that the defects accelerated the charge transfer on the electrode surface.

[0083] The ECL transients of four Zr-TCPE-BA(X)MOFs / GCE in PBS (0.10 M, pH 7.4) were studied by chronoamperometry, and the results are shown in Figure 3 D. As Figure 3 shown in D, obvious high electrochemiluminescence was immediately generated at the beginning of the scan for the four Zr-TCPE-BA(X)MOFs / GCE, and with the increase in the defect level, i.e., the increase in X, the ECL signal intensity increased, indicating that the defects in MOFs can act as recombination centers to accelerate the hole injection and the recombination of electron-hole pairs during the electrooxidation process, thereby enhancing the high electrochemiluminescence.

[0084] Example 5 ECL mechanism of Zr-TCPE-BA(100)MOFs / GCE

[0085] Cation radical Zr-TCPE-BA(100)MOFs was obtained by injecting holes into the valence band of Zr-TCPE-BA(100)MOFs ·+ (as shown in the following formula (1)), and then under weak base conditions, Zr-TCPE-BA(100)MOFs ·+It will be further deprotonated to form a strong oxidation intermediate, Zr-TCPE-BA(100) MOFs · (as shown in formula (2) below). Then, Zr-TCPE-BA(100) MOFs ·+ reacts with Zr-TCPE-BA(100) MOFs · to generate a high-energy excited state Zr-TCPE-BA(100) MOFs * (as shown in formula (3) below), and high electrochemiluminescence is produced when returning to the ground state (as shown in formula (4)). The schematic diagram of electron-hole recombination of Zr-TCPE-BA(100) MOFs is as Figure 4 shown, and the chemical formula of the principle is as follows:

[0086] Zr-TCPE-BA(100) MOFs-e - →Zr-TCPE-BA(100) MOFs ·+ (1)

[0087] Zr-TCPE-BA(100) MOFs ·+ →Zr-TCPE-BA(100) MOFs · +H + (2)

[0088] Zr-TCPE-BA(100) MOFs ·+ +Zr-TCPE-BA(100) MOFs · →Zr-TCPE-BA(100) MOFs * +P1(3)

[0089] Zr-TCPE-BA(100) MOFs * →Zr-TCPE-BA(100) MOFs+hv (4).

[0090] Experimental results of the sensor for PFOA detection in Example 6

[0091] According to the detection principle as Figure 7 shown; the ECL responses of different concentrations of PFOA in PBS (0.10 M, pH 7.4) were detected using the Zr-TCPE-BA(100) MOFs / GCE prepared in Example 3. The results are as Figure 5 shown, where Figure 5 A is that the sensor responds to concentrations a to h in sequence as: 1.0×10 -13 , 1.0×10 -12 , 1.0×10 -11 , 1.0×10 -10 , 1.0×10 -9, 5.0×10 -9 , 1.0×10 -8 , 1.0×10 -7 ECL response intensity of M; Figure 5 B has a good linear relationship between the ECL intensity and the logarithm of the PFOA concentration; from Figure 5 it can be seen that as the PFOA concentration increases from 1.0×10 -13 M to 1.0×10 -7 M, the ECL response intensity gradually increases, and there is a good linear relationship between the ECL response intensity and the logarithm of the PFOA concentration. The linear equation is I = 778.08lgc + 12453.04 (R 2 = 0.9982); the detection limit LOD is 22.6 fM.

[0092] The detection limit LOD is calculated using the existing technology. The specific calculation process is as follows: First, perform three parallel ECL intensity tests on the blank sample and calculate the average ECL intensity I B and the standard deviation S B . Subsequently, calculate the detection limit signal I L according to the following formula (a). Among them, the numerical factor κ is 3, and the expected confidence level is 99.86%.

[0093] I L = I B + κ×S B (a)

[0094] In the embodiment, through three parallel tests on the blank sample, it is calculated that I B is 1707.23 and S B is 42.60. Then, according to formula (a), the detection limit signal I L is calculated to be 1835.03. Finally, according to the linear regression equation I = 778.08lgc + 12453.04, when I = I L = 1835.03, it is calculated that c = 2.26×10 -14 , that is, 22.6 fM.

[0095] This embodiment is also compared with other existing PFOA detection methods, and the comparison results are shown in Table 3; the detection limit LOD of PFOA by the sensor adopted in the present invention is significantly reduced.

[0096] Table 3

[0097]

[0098] Example 7 Verification of the stability of the biosensor

[0099] The ECL responses of Zr-TCPE-BA(100) MOFs / GCE prepared in Example 3 to 10 pM, 10 nM, and 100 nM of PFOA were continuously scanned for 12 cycles, and the results are as Figure 6 shown in Figure 6 A. As can be seen from

[0100] A, the relative standard deviations (RSDs) of Zr-TCPE-BA(100) MOFs / GCE to 10 pM, 10 nM, and 100 nM of PFOA were 1.69%, 2.33%, and 1.21%, respectively, indicating good stability. Figure 6 shown in Figure 6 B. As can be seen from

[0101] Example 8 Analysis of actual samples

[0102] The water sample of Jialing River in Chongqing, China was collected as the actual sample, and ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS) was used as the standard method to evaluate the accuracy and applicability of Zr-TCPE-BA(100) MOFs / GCE prepared in Example 3.

[0103] Since the concentration of PFOA in the unspiked sample of Jialing River was extremely low or non-existent, neither UPLC-MS / MS nor the ECL sensor detected PFOA. Therefore, PFOA was added to the sample to detect whether the sensor could detect PFOA in natural water sources and whether the substances in the water source would cause errors in the detection results. 1.00×10 -7 , 2.00×10 -8 , and 5.00×10 -9 M of the three concentrations were prepared and added to the same sample, respectively. The detection results of UPLC-MS / MS and the present invention were used, and the results are shown in Table 4. As can be seen from Table 4, the recovery rate of PFOA detected by the present invention was between 97.0% and 101.8%. Based on the determination results of UPLC-MS / MS as the standard, the relative errors of the results of the present invention were calculated to be -4.9%, -1.0%, and 2.0%, respectively, indicating that the sensor has potential application value.

[0104] Table 4

[0105]

Claims

1. A metal-organic framework Zr-TCPE-BA(X)MOFs based on defect engineering, characterized in that, The Zr-TCPE-BA(X) MOFs are prepared using zirconium tetrachloride and 1,1,2,2-tetracarboxystyrene as precursors and benzoic acid as a defect regulator, where X is the molar equivalent of BA relative to 1,1,2,2-tetracarboxystyrene; In Zr-TCPE-BA(X) MOFs, benzoic acid competes with 1,1,2,2-tetracarboxystyrene for the coordination of metal nodes to form defects, and the defects act as recombination centers, accelerating the hole injection and electron-hole pair recombination during the electro-oxidation process, resulting in high electrochemiluminescence.

2. The preparation method of the metal-organic framework based on defect engineering according to claim 1, characterized in that, The specific steps are as follows: A1: Ultrasonically disperse zirconium tetrachloride, 1,1,2,2-tetracarboxystyrene, and benzoic acid uniformly in a solvent; A2: React the mixture at 120 °C for 24 h, and after cooling to room temperature, centrifuge and filter to obtain a filtrate; A3: Wash and dry with N,N-dimethylformamide and methanol to obtain the metal-organic framework Zr-TCPE-BA(X) MOFs.

3. The preparation method according to claim 2, characterized in that, The mass ratio of zirconium tetrachloride to 1,1,2,2-tetracarboxystyrene is 12:3 - 4; and the molar ratio of benzoic acid to 1,1,2,2-tetracarboxystyrene is 50 - 150:

1.

4. Use of the metal-organic framework according to claim 1 in the preparation of an electrochemiluminescent biosensor, characterized in that, The electrochemiluminescent biosensor is obtained by combining Zr-TCPE-BA(X) MOFs with a nucleic acid amplification reaction triggered by a nucleic acid aptamer.

5. Use of the metal-organic framework according to claim 1 in the preparation of an electrochemiluminescent biosensor for detecting perfluorooctanoic acid, characterized in that, The electrochemiluminescent biosensor for detecting perfluorooctanoic acid is obtained by combining Zr-TCPE-BA(X) MOFs with a nucleic acid amplification reaction triggered by a nucleic acid aptamer that can respond to perfluorooctanoic acid.

6. The preparation method of the electrochemiluminescence biosensor for detecting perfluorooctanoic acid according to claim 5, characterized in that, The specific steps are as follows: B1: Prepare hairpin strands H1 and H2 by the annealing method; then mix 1-(3-(dimethylamino)propyl)-3-ethylcarbodiimide hydrochloride with carboxyl-labeled magnetic beads MB and react at room temperature for 20 min to obtain surface carboxyl-activated beads; The sequence of hairpin strand H1 is as shown in SED ID NO.1: NH2-(CH2)6-TTTAAACTTTGCCG TGCCGTGGATGTAACAGCTGAGGTCCACGGCACGGCATTT; The sequence of hairpin strand H2 is as shown in SED ID NO.2: TGTTACATCCACGGCACGGCA AATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT GCCGTGCCGTGGACCTCAGC; B2: Add hairpin strand H1 and N-hydroxysuccinimide to the surface carboxyl-activated beads obtained in step B1 and react overnight at 4 °C; after the reaction is completed, collect the H1 / MB complex by magnetic separation; B3: Mix the H1 / MB complex, single-stranded DNA S1, hairpin strand H2, DNA polymerase Phi29, restriction enzyme Nt.BbvCI, nucleoside triphosphates dNTPs, 10×Phi29 buffer, and 10×Nt.BbvCI buffer, and react at 37 °C for 2 h; collect the supernatant by magnetic separation and inactivate it at 80 °C for 20 min to obtain the secondary target ST; The sequence of single-stranded S1 is shown in SED ID NO.3: TACATCCACGGCACGGCAAAGT TTTTT; B4: Ultrasonically disperse Zr-TCPE-BA(X) MOFs in ultrapure water to obtain a dispersion, and drop the dispersion onto the surface of a cleaned glassy carbon electrode and naturally dry it at room temperature to obtain a metal-organic framework layer; B5: Drop platinum nanoparticle solution onto the surface of the metal-organic framework layer and naturally dry it to obtain a platinum nanoparticle layer; B6: Incubate amino-labeled single-stranded S2 on the surface of the platinum nanoparticle layer at 4 °C for 12 h, and then incubate hexanethiol at 4 °C for 1 h; The sequence of single-stranded S2 is shown in SED ID NO.4: NH2-(CH2)6-AAACTTTGCCGTGCCGTGGATGTAACAGCTGA; B7: Then incubate the mixture of BHQ1-labeled single-stranded S3 and the secondary target ST obtained in step B6 at 37 °C for 2 h; thus obtaining the electrochemiluminescence biosensor for detecting perfluorooctanoic acid; The sequence of single-stranded S3 is shown in SED ID NO.5: TGTTACATCCACGGC-BHQ1.

7. The preparation method according to claim 6, characterized in that, In step B1, 10 μL of 1-(3-(dimethylamino)propyl)-3-ethylcarbodiimide hydrochloride with a concentration of 0.16 g / mL and 15 μL of carboxyl-labeled magnetic beads MB with 0.1% w / V are used to prepare surface carboxyl-activated beads.

8. The preparation method according to claim 7, characterized in that, When preparing the H1 / MB complex in step B2, the dosage of hairpin strand H1 is 5 μL, 10.0 μM; the dosage of N-hydroxysuccinimide is 10 μL, 0.04 g / mL; And when preparing the secondary target ST in step B3, the dosage of single-stranded DNA S1 is 25 μL, 2 μM; the dosage of hairpin strand H2 is 5 μL, 10.0 μM; the dosage of DNA polymerase Phi29 is 0.5 μL, 10 U / μL; the dosage of restriction enzyme Nt.BbvCI is 1 μL, 10 U / μL; the dosage of nucleoside triphosphates dNTPs is 2.5 μL, 10 mM; the dosage of 10×Phi29 buffer is 5 μL and the dosage of 10×Nt.BbvCI buffer is 5 μL.

9. The preparation method according to claim 8, characterized in that, In steps B4–B7, the diameter of the glassy carbon electrode is 4 mm, the dosage of the dispersion is 10 μL, 1.0 mg / mL; the dosage of the platinum nanoparticle solution is 5 μL, 0.1–1 mM; the dosage of amino-labeled single-stranded S2 is 10 μL, 0.5 μM; the dosage of hexanethiol is 10 μL, 1.0 mM; the dosage of BHQ1-labeled single-stranded S3 is 5.0 μL, 1.0 μM; the dosage of the secondary target ST is 5.0 μL.

Images