A method for culturing endometrial organoids

Abstract

This invention relates to the field of biotechnology, specifically, to a method for culturing endometrial organoids. By optimizing the endometrial organoid differentiation and culture system, compared to existing methods, the optimized system is simple to operate, does not require co-culturing with stromal cells to prepare organoids with more complete physiological functions, and can be cultured continuously for at least one year. The resulting organoids exhibit complete secretory function and a more pronounced ciliated cell phenotype.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a method for culturing endometrial organoids. Background Technology

[0002] Organoids are tissue analogs with a specific spatial structure, formed through three-dimensional (3D) in vitro culture of adult stem cells or pluripotent stem cells. Although organoids are not true human organs, they can structurally and functionally mimic real organs, closely resembling in vivo tissue structure and function, and can be stably passaged long-term. Compared to traditional two-dimensional culture models, organoids represent an innovative technology that can encompass the entire physiological process of an organism, offering advantages such as closer approximation of physiological cell composition and behavior, a more stable genome, and better suitability for biological transfection and high-throughput screening. Compared to animal models, organoid models are simpler to operate and can be used to study the mechanisms of disease occurrence and development, thus showing broad application prospects in organ development, precision medicine, regenerative medicine, drug screening, gene editing, and disease modeling. In 2013, organoids were named one of the top ten technologies of the year by *Science* magazine. In early 2018, organoids were named *Nature Methods*' Method of the Year for 2017.

[0003] The uterus is a vital organ for women, responsible for menstruation and fetal development. It provides the physiological microenvironment for embryo implantation, establishes a functional mother-fetus connection, ensures fetal growth and development, and ultimately leads to the birth of healthy offspring. Different animal species possess unique reproductive characteristics, exhibiting distinct uterine physiological structures. The female uterus, in particular, displays menstrual cycle reproductive features, demonstrating its complexity and evolutionary uniqueness. Consequently, scientists have conducted a series of studies on the anatomy and physiology of the female uterus. However, due to the complexity of the female uterus and the lack of easily manipulated experimental systems, many key physiological mechanisms remain unresolved. Current advancements in organoid technology offer research possibilities and in vitro experimental paradigms for exploring human uterine tissues and organs.

[0004] In 2017, Turco MY reported the optimized creation of uterine organoids derived from human adult stem cells, advancing research into the physiological mechanisms of the human endometrium. The constructed endometrial organoids can mimic the glandular epithelium of the endometrium, exhibiting phenotypes of ciliated cells and secretory cells, and can model responses to estrogen and progesterone. However, the phenotype of organoids constructed using this method still differs somewhat from that of the endometrium under physiological conditions; the secretory phenotype is not obvious, and the cellular composition of ciliated cells and secretory cells and their respective physiological functions in reproduction are not clearly elucidated. Therefore, no studies have yet utilized such organoid models to investigate the mechanisms of female reproductive disorders related to the endometrium. This invention optimizes the differentiation and culture method of endometrial organoids, constructing a more functionally mature culture method. Furthermore, using this method, a model of aging endometrium was established for the first time, and the mechanism of reduced receptivity in aging endometrium was investigated.

[0005] Currently, research on optimizing endometrial organoids focuses on co-culturing stromal cells and endometrial organoids to refine their physiological functions. This involves collecting clinical endometrial samples and simultaneously constructing endometrial organoids and primary stromal cells. The stromal cells are then mixed with the endometrial organoids for co-culture to refine the phenotype and function of the endometrium. However, this method has drawbacks. The stromal cells are primary cultured fibroblasts, which cannot be continuously passaged, affecting the system's continued usability. Furthermore, the methods for identifying secretory function and ciliated cell phenotype after co-culture are not yet mature, thus limiting its application to the study of endometrial disease mechanisms. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a method for culturing endometrial organoids, and offers the following technical solution:

[0007] Firstly, in a first aspect, the present invention provides a method for culturing endometrial organoids, the method comprising the following steps:

[0008] (1) Endometrial tissue fragments were digested with collagenase to obtain a single-cell suspension;

[0009] (2) Cells were resuspended in Matrigel, solidified to form gel particles, and then added to endometrial organoid amplification culture medium for amplification culture.

[0010] (3) After passage, the endometrial organoid amplification culture medium is converted into an endometrial epithelial organoid differentiation culture medium, which can differentiate into mature endometrial organoids. The components of the endometrial epithelial organoid differentiation culture medium are:

[0011] Advanced F12 / DMEM

[0012] HEPES1M 1%

[0013] GlutaMAX 1%

[0014] P / S 10%

[0015] N2 supplement 1X

[0016] B27 supplement 1X

[0017] N-acetylcysteine ​​1mM

[0018] Noggin 100ng / ml

[0019] Y-27632 10uM

[0020] FGF10100ng / ml

[0021] A8301 500nM Primocin 50mg / ml.

[0022] In one embodiment, the endometrial organoid amplification culture medium comprises:

[0023] Advanced F12 / DMEM

[0024] HEPES1M 1%

[0025] GlutaMAX 1%

[0026] P / S 1%

[0027] Rspondin and Noggin conditioned medium 10%

[0028] N2 supplement 1X

[0029] B27 supplement 1X

[0030] N-acetylcysteine ​​1mM

[0031] Nicotinamide 10nM

[0032] Y-27632 10uM

[0033] A8301500nM

[0034] FGF10100ng / ml

[0035] EGF 50ng / ml

[0036] Primocin 50mg / ml.

[0037] In one embodiment, in step (3), the organoids are passaged every 7 days at a ratio of 1:6, and the passaged endometrial organoids are cultured in amplification medium for about 4 days and then replaced with endometrial epithelial organoid differentiation medium.

[0038] A second aspect of the present invention provides an endometrial organoid differentiation culture medium, wherein the differentiation culture medium is an organoid amplification culture medium with Rspondin I component removed, wherein the amplification culture medium includes AdvancedF12 / DMEM, HEPES, GlutaMAX, P / S, N2 supplement, B27 supplement, N-acetylcysteine, Noggin, Y-27632, FGF10, A8301, Primocin, Rspondin I, Nicotinamide and EGF.

[0039] In one embodiment, the differentiation medium is an organoid amplification medium with Rspondin I and Nicotinamide removed.

[0040] In one embodiment, the differentiation medium is an organoid amplification medium with Rspondin I, Nicotinamide, and EGF removed.

[0041] In a preferred embodiment, the endometrial organoid differentiation culture medium is composed of AdvancedF12 / DMEM, HEPES, GlutaMAX, P / S, N2 supplement, B27 supplement, N-acetylcysteine, Noggin, Y-27632, FGF10, A8301, and Primocin.

[0042] In a more preferred embodiment, the endometrial organoid differentiation culture medium is:

[0043] Advanced F12 / DMEM

[0044] HEPES1M 1%

[0045] GlutaMAX 1%

[0046] P / S 10%

[0047] N2 supplement 1X

[0048] B27 supplement 1X

[0049] N-acetylcysteine ​​1mM

[0050] Noggin 100ng / ml

[0051] Y-27632 10uM

[0052] FGF10100ng / ml

[0053] A8301 500nM

[0054] Primocin 50mg / ml.

[0055] Compared with the prior art, the present invention has the following significant advantages:

[0056] 1. To address the shortcomings of current endometrial organoid culture methods, this invention optimizes the composition of the differentiation culture medium and the differentiation time of endometrial organoids, making the function and cellular composition of endometrial organoids closer to the physiological state. Compared with existing culture methods, the optimized culture system is simple to operate, can be used stably and sustainably for at least one year, and exhibits complete secretory function and a more pronounced ciliated cell phenotype.

[0057] 2. This invention establishes a mature method for detecting cell phenotype and secretory function;

[0058] 3. This invention establishes an organoid model of aging endometrium for the first time, and compares the aging endometrial organoids with young endometrium, discovering key cell types and molecules that may affect the receptivity of aging endometrium, thus realizing the use of organoid models to study pathological mechanisms. Attached Figure Description

[0059] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0060] Figure 1 To optimize the differentiation medium: Rspondin I, Rspondin I and Nicotamide were removed respectively. After differentiation culture with Rspondin I, Nicotamide and EGF, the following changes were observed: A) cell morphology; B) spheroidization rate; C) changes in cell viability.

[0061] Figure 2To optimize the response of endometrial organoids to estrogen: Rspondin I, Nicotamide, and EGF were removed, respectively. After differentiation culture, estrogen E2 was added to simulate the proliferative phase of the endometrium, and E2, P4, and cAMP were added to simulate the secretory phase. A) qPCR was used to detect the induction of ER and PR during the proliferative and secretory phases; B) qPCR was used to detect the expression of stem cell-related genes SOX9 and SOX17 during the secretory phase; C) ELISA was used to detect the secretion of SSP1 during the secretory phase. Detailed Implementation

[0062] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0063] Example 1: Establishment of a differentiation and culture system for endometrial organoids

[0064] The endometrial organoid amplification culture medium provided by this invention is an optimization of the medium developed by Turco MY et al. in 2017. Specifically, Rspondin I, Nicotinamide, and EGF were removed from the amplification culture medium. The specific culture medium formulation is as follows:

[0065] The components and concentrations of organoid amplification culture media disclosed in the prior art are as follows:

[0066] Table 1

[0067] AdvancedF12 / DMEM - HEPES1M 1％ GlutaMAX 1％ P / S 1％ Rspondin and Noggin conditioned medium 10％ N2 supplement 1X B27 supplement 1X N-acetylcysteine 1mM Nicotinamide 10nM Y-27632 10uM A8301 500nM FGF10 100ng / ml EGF 50ng / ml Primocin 50mg / ml

[0068] The optimized composition and concentration of the organoid differentiation culture medium in this application are as follows:

[0069] Table 2

[0070] AdvancedF12 / DMEM - HEPES1M 1％ GlutaMAX 1％ P / S 10％ N2 supplement 1X B27 supplement 1X N-acetylcysteine 1mM Noggin 100ng / ml Y-27632 10uM FGF10 100ng / ml A8301 500nM Primocin 50mg / ml

[0071] The specific steps for culturing endometrial epithelial cell organoids using the above-mentioned culture medium are as follows:

[0072] 1. Using a scalpel, the endometrial tissue (discarded tissue from patients at Peking University Third Hospital after surgery, all of whom had signed informed consent forms) was cut into small fragments, transferred to a 15ml centrifuge tube, and 10ml of Advanced DMEM / F12 culture medium (Thermo Fisher Scientific, 12634010) was added. The tube was centrifuged at 300g for 5 minutes, and the supernatant was discarded.

[0073] 2. Resuspend the tissue fragments in a 5 ml solution of collagenase (Sigma, C9407) at a concentration of 2 mg / mL and incubate at 37°C for 10–20 minutes.

[0074] 5. Add 2% FBS (Gibco, 10099141C) to the digested tissue suspension to stop digestion, then add 5 ml of Advanced DMEM / F12 culture medium (Thermo Fisher Scientific, 12634010) and pipette 20 times.

[0075] 6. Filter the agitated cell suspension through a 100μm cell filter to remove incompletely digested tissue fragments.

[0076] Centrifuge at 7.300g for 5 minutes to precipitate the single cells separated from the tissue digestion, and discard the supernatant.

[0077] 8. If there are many red blood cells in the precipitated cells, add 1 ml of red blood cell lysis buffer to resuspend the cells and react at room temperature for 5 minutes.

[0078] 9. Add 10 ml of Advanced DMEM / F12 culture medium (Thermo Fisher Scientific, 12634010), mix well by pipetting, and centrifuge at 300 g for 5 minutes.

[0079] 10. Resuspend the cells using Matrigel and mix thoroughly.

[0080] 11. Carefully add the suspension as droplets to preheated 24-well plates, 40 μl per well. After incubating at 37°C for 20 minutes, the Matrigel suspension will solidify into gel particles. At this point, add 500 μl of the optimized endometrial organoid amplification medium shown in Table 1 to each well. Then, incubate the 24-well plates at 37°C in a 5% CO2 cell culture incubator.

[0081] 12. Organoids are usually passaged at a ratio of 1:6 every 7 days. After passage, endometrial organoids are cultured in expansion medium for about 4 days. The expansion medium is then transferred to the endometrial epithelial organoid differentiation medium shown in Table 2. The medium is changed every other day. After 10 days, they can differentiate into mature endometrial organoids.

[0082] To compare the culture results of the optimized culture media, the passaged endometrial organoids were cultured in expansion medium for 4 days, and then cultured in three optimized differentiation media: -RS1 (expansion medium with only Rspondin I removed), -RS1-NICO (expansion medium with only Rspondin I and Nicotinamide removed), and -RS1-NICO-EGF (expansion medium with Rspondin I, Nicotinamide, and EGF removed). The medium was changed every other day, and the organoids were collected for downstream applications after 10 consecutive days of culture.

[0083] The -RS1 differentiation medium was:

[0084] Table 3

[0085]

[0086]

[0087] The RS1-NICO differentiation medium is:

[0088] Table 4

[0089] AdvancedF12 / DMEM - HEPES1M 1％ GlutaMAX 1％ P / S 1％ Noggin 100ng / ml N2 supplement 1X B27 supplement 1X N-acetylcysteine 1mM Y-27632 10uM A8301 500nM FGF10 100ng / ml EGF 50ng / ml Primocin 50mg / ml

[0090] The differentiation medium for RS1-NICO-EGF is:

[0091] Table 5

[0092]

[0093]

[0094] Organoid cell viability was tested by lysing organoids using CellTiter-Glo 3D (G9683, Promega) to release ATP and then detecting the ATP levels using TECANInfinite MPLEX.

[0095] The function of amplification culture medium and three optimized differentiation culture media was compared by observing the morphology of endometrial organoids under a light microscope.

[0096] Experimental results showed that, compared with endometrial organoids cultured using amplification medium, organoids cultured using optimized differentiation medium did not show significant changes in spheroidization rate and cell viability as observed under a light microscope. However, the morphology of the organoids was significantly different (e.g., Figure 1(As shown). Cell clumps of vacuolated endometrial organoids cultured using amplification medium significantly increased in size over culture time, while clumps cultured using Rspondin I removal showed no significant increase in size. Cell clumps cultured using Rspondin I and Nicotinamide removal, or Rspondin I, Nicotinamide, and EGF removal, formed glandular pit structures similar to physiological endometrium, especially organoids cultured using the removal of all three components simultaneously.

[0097] Example 2: Establishment of an endometrial organoid model and functional testing of the model (estrogen response)

[0098] After passaged endometrial organoids were grown in expansion medium for 4 days, the expansion medium was replaced with the aforementioned different differentiation media, each supplemented with 10 nM β-estradiol (E2, MCE HY-B0708). Two days later, the medium was replaced with the following conditions: differentiation medium supplemented with 10 nM E2 to simulate the endometrial proliferative phase; or 10 nM E2 + 1 μM progesterone (P4, Sigma P7556) + 1 μM 8-bromoadenosine 3,5-cyclic monophosphate (cAMP, MCE HY-B1511) to simulate the endometrial secretory phase; or 10 nM E2 + 1 μM P4 + 1 μM cAMP + 20 ng / ml PRL + 20 ng / ml hPL + 1 μg / ml hCG for 8 days before organoid collection. Specific procedures are as follows:

[0099] 1. Preliminary identification of gene expression levels in endometrial organoids using qPCR

[0100] RNA was extracted using the RaPure Total RNA Kit (Magen, R4011-03) and PrimeScript. TM Reverse transcription was performed using the RTreagent Kit (Takara, RR037A). Upstream and downstream primers targeting different genes were designed using Primer 3.0; specific sequence information is provided in the appendix. TB was used for the transcription. Premix Ex Taq (Takara, RR420A) for quantitative PCR:

[0101] Primer name forward primer reverse primer ESR GCTTACTGACCAACCTGGCAGA GGATCTCTAGCCAGGCACATTC PR CCCAGCATGTCGCCTTAGAAA AGTGCTCTCACAACTCTGACTT SOX9 AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG SOX17 GTGGACCGCACGGAATTTG GGAGATTCACACCGGAGTCA

[0102] 2. Identification of protein expression levels in endometrial organoids using immunofluorescence.

[0103] Collect organoids, add 1 ml of 4% PFA, incubate at room temperature for 15 minutes, then centrifuge at 700 rcf for 5 minutes. Discard the supernatant, add 0.5% TX100 to PBS for 10 minutes, wash twice with 2% FBS / PBS, incubate with 3% BSA / PBS at room temperature for 1 hour, stain overnight at 4°C with Acetyl-alpha Tubulin (Lys40) Monoclonal Antibody (6-11B-1) (Thermo Fisher Scientific, 32-2700), wash four times with 2% FBS / PBS, stain with secondary antibody Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific, A-11008) (1:200) at room temperature for 2 hours, wash four times with 2% FBS / PBS, and then stain with DAPI (Sigma, D9542) and Alexa Fluor. TM Stain with 633 phalloidin (Invitrogen, A22284) at room temperature for 1 hour, wash with PBS, centrifuge at 300 rcf for 5 minutes, discard the supernatant, and add approximately 40 μL of ProLong. TM Glass quenching resistant sealing medium (Invitrogen, P36984).

[0104] 3. Identification of the secretory function of endometrial organoids using enzyme-linked immunosorbent assay (ELISA).

[0105] The culture supernatant of the endometrial organoids was collected and analyzed using the Human Osteopontin / SPP1 ELISA Kit.

[0106] (BOSTER, EK0482) The concentration of SPP1 in the amplification medium and the optimization medium was determined according to the kit instructions.

[0107] The results are as follows Figure 2 As shown, organoids differentiated by removing all three components exhibited stronger induced expression of estrogen receptors ER and PR after the addition of estrogen, decreased expression of stem cell-related genes SOX9 and SOX17, and increased secretion of SSP1 (e.g., Figure 2 As shown in the figure, this indicates that endometrial organoids differentiated more maturely. Therefore, endometrial organoids cultured using an optimized differentiation medium that removes Rspondin I, Nicotinamide, and EGF were more functionally mature compared to amplification media.

[0108] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A method for culturing endometrial organoids, characterized in that, The method includes the following steps: (1) Digest the endometrial tissue fragments with collagenase to obtain a single-cell suspension; (2) Cells were resuspended in Matrigel, solidified to form colloids, and then added to endometrial organoid amplification medium for amplification culture; (3) The organoids were passaged every 7 days at a ratio of 1:

6. After passage, the endometrial organoids were cultured in expansion medium for 4 days. The expansion medium was then transferred to endometrial epithelial organoid differentiation medium, and the medium was changed every other day. After 10 days, they could differentiate into mature endometrial organoids. The components of the endometrial epithelial organoid differentiation culture medium are as follows: Advanced F12 / DMEM HEPES 1M1% GlutaMAX 1% P / S 1% N2 supplement1X B27 supplement1X N-acetylcysteine ​​1mM Noggin 100ng / ml Y-27632 10 μM FGF10100ng / ml A8301500nM Primocin 50mg / ml; The components of the endometrial organoid amplification culture medium are as follows: Advanced F12 / DMEM HEPES 1M1% GlutaMAX 1% P / S 1% Rspondin and Noggin conditioned medium 10% N2 supplement1X B27 supplement1X N-acetylcysteine ​​1mM Nicotinamide 10 nM Y-2763210μM A8301500nM FGF10100ng / ml EGF 50ng / ml Primocin 50mg / ml.

2. A culture medium for the differentiation of endometrial organoids, characterized in that, The differentiation medium is prepared by removing Rspondin I, Nicotinamide, and EGF from the organoid expansion medium. The endometrial organoid differentiation medium is as follows: Advanced F12 / DMEM HEPES 1M1% GlutaMAX 1% P / S 1% N2 supplement1X B27 supplement1X N-acetylcysteine ​​1mM Noggin 100ng / ml Y-2763210μM FGF10100ng / ml A8301500nM Primocin 50mg / ml.

Images