A pegRNA and GRAND editing system specifically identifying the polled locus of cattle and its application

Abstract

The present invention discloses a pegRNA, a GRAND editing editing system and an application for specifically identifying the polled site of cattle without horns. The present invention belongs to the field of gene editing technology. Based on the lead editing, the present invention constructs a GRAND editing editing system and designs a specific pegRNA and a GE-pegRNA expression vector, which can target the polled site of cattle without horns, and realizes the replacement of the 6 bp sequence between 1706055-1706060 bp and the 208 bp sequence between 1705837-1706044 bp of the cattle genome, breaking through the bottleneck that the PE editing system can only insert ≤44bp fragments and has low insertion efficiency, realizing the insertion-deletion mutation of the 202 bp repetitive sequence, improving the insertion efficiency, and greatly enriching the application scenarios of the gene editing technology of long fragment sequence insertion without donor insertion.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and more specifically to a pegRNA that specifically recognizes the bovine hornless polled site, a GRAND editing system, and applications. Background Art

[0002] Horns are a unique structure unique to bovines. Hornless cattle, naturally lacking horns (known as the polled trait), do exist, but their numbers are extremely small. In modern animal husbandry, horned cattle are considered more aggressive and pose a higher risk of harm to both the herd and the caretakers. Therefore, physical dehorning is commonly used in livestock production. However, this can cause physiological abnormalities (such as elevated cortisol levels and imbalanced body temperature) and behavioral abnormalities (such as vocalization and head rubbing) in cattle, leading to negative emotions and compromising intensive cattle production and animal welfare requirements.

[0003] It has been shown that there are four mutations that can cause hornless traits in the approximately 300 kb region of chromosome 1 of cattle, namely Celtic mutation (P C ), Frisian mutation (P F ), Mongolian mutation (P M ) and the Guarani mutation (P G ). Among them, PC is composed of a 202 bp repetitive sequence insertion-deletion mutation. The study found that through TALEN technology, a 202 bp (chr1:1706051-1706060 bp) repetitive sequence of hornless Angus cattle was inserted into chromosome 1 of Holstein cows, and finally a gene-edited hornless Holstein cow was successfully obtained. In 2020, researchers used the CRISPR / Cas12a system to successfully integrate the PC mutation into bovine fibroblasts and obtained a hornless Holstein bull through cloning technology. The results show that P C The 202 bp duplication in the mutation is the key factor causing the hornless phenotype.

[0004] In recent years, gene editing technology has developed rapidly. New gene editing technologies based on the CRISPR / Cas system are gradually becoming a star in the field of gene editing, with a wide range of applications in the biopharmaceutical, animal husbandry, and agriculture industries. Anzalone et al. developed primer editing (PE) by coupling the Cas9 nickase with reverse transcriptase (RT) to perform targeted modification guided by guide RNA (pegRNA). This system can mediate different types of base editing and can perform small insertions and deletions without donor DNA, demonstrating its superiority in mammalian cell gene editing. However, PE can only effectively insert fragments of 44 bp, and the insertion efficiency is relatively low, at approximately 10%.

[0005] GRAND editing (genome editing by partially aligned RTTs to each other but nonhomologous to target sequences within duo pegRNA) is a novel gene editing technology developed by the team of Professors Yin Hao and Zhang Ying at the Wuhan University School of Medicine and published in Nature Methods in 2022. GRAND editing, based on Prime editing, introduces and cleverly designs a pair of pegRNAs, enabling a new strategy for precisely inserting long sequences into genomic DNA without the need for a DNA donor.

[0006] The core of GRAND editing lies in the use of a pair of special pegRNAs. These pegRNAs not only contain a targeted DNA binding region, but also carry a primer binding site (PBS) and a reverse transcription template sequence (RTT). Under the guidance of the pegRNA, the reverse transcriptase can reverse transcribe the template sequence to a specific location in the genome, thereby achieving the insertion of large fragments.

[0007] Therefore, how to achieve Pc mutation and improve insertion efficiency at the polled site in the cattle genome is a technical problem that needs to be solved urgently by those skilled in the art. Summary of the Invention

[0008] In view of this, the present invention provides a pegRNA, a GRANDediting editing system and an application that specifically recognize the polled site of hornless cattle. A pegRNA that specifically recognizes the polled site of hornless cattle is constructed, and a GRANDediting editing system is constructed, which successfully achieves the targeting of the polled site and Pc mutation, providing technical support for the breeding of hornless cattle.

[0009] In order to achieve the above object, the present invention adopts the following technical solutions:

[0010] The first object of the present invention is to provide: a pegRNA specifically targeting the POLLED gene, wherein the pegRNA includes pegRNA1 and pegRNA2; both pegRNA1 and pegRNA2 include sgRNA, RT template and PBS, and the specific sequences are as follows:

[0011] pegRNA1:

[0012] The sequence of the sgRNA is shown in SEQ ID NO.1;

[0013] The sequence of the RT template is shown in SEQ ID NO.2;

[0014] The sequence of the PBS is shown in SEQ ID NO.3;

[0015] pegRNA2:

[0016] The sequence of the sgRNA is shown in SEQ ID NO.5;

[0017] The sequence of the RT template is shown in SEQ ID NO.6;

[0018] The sequence of the PBS is shown in SEQ ID NO.7.

[0019] As a preferred technical solution, the nucleotide sequence of the pegRNA1 is shown as SEQ ID NO.4; the nucleotide sequence of the pegRNA2 is shown as SEQ ID NO.8.

[0020] Another object of the present invention is to provide: a DNA molecule encoding the above-mentioned pegRNA1 and / or pegRNA2.

[0021] Another object of the present invention is to provide: a biomaterial, wherein the biomaterial is any one of the following:

[0022] 1) An expression cassette containing the above-mentioned DNA molecule;

[0023] 2) a recombinant vector containing the aforementioned DNA molecule, or a recombinant vector containing the expression cassette described in 1);

[0024] 3) A transgenic cell line containing the aforementioned DNA molecule, or a transgenic cell line containing the recombinant vector described in 2);

[0025] 4) A recombinant bacterium containing the aforementioned DNA molecule, or a recombinant bacterium containing the expression cassette described in 1), or a recombinant bacterium containing the recombinant vector described in 2).

[0026] Another object of the present invention is to provide: an application of the above-mentioned pegRNA, the above-mentioned DNA molecule or the above-mentioned biomaterial, wherein the application is any one of the following:

[0027] 1) Application in the specific identification of polled sites in cattle;

[0028] 2) Application in constructing PC mutations;

[0029] 3) Application in hornless cattle breeding;

[0030] 4) Application in the preparation of a GRAND editing system for editing Pc mutations;

[0031] 5) Application in GRAND editing of Pc mutations.

[0032] Another object of the present invention is to provide a GRAND editing system comprising at least one of the following:

[0033] 1) The above-mentioned pegRNA;

[0034] 2) the above expression cassette;

[0035] 3) The above-mentioned recombinant vector.

[0036] As a preferred technical solution, the GRAND editing system further includes a GRAND editing protein.

[0037] Another object of the present invention is to provide: an application of the GRAND editing system, wherein the application is any one of the following:

[0038] 1) Application in the specific identification and editing of polled sites in cattle;

[0039] 2) Application in constructing PC mutations;

[0040] 3) Application in hornless cattle breeding;

[0041] 4) Application in GRAND editing of Pc mutations.

[0042] Another object of the present invention is to provide: a GRAND editing method for constructing a Pc mutation, the method comprising the step of performing GRAND editing using the above-mentioned pegRNA, the above-mentioned DNA molecule, the above-mentioned expression cassette, the recombinant vector or the above-mentioned GRAND editing system.

[0043] It can be seen from the above technical solutions that compared with the prior art, the present invention has the following beneficial effects:

[0044] 1) In order to achieve Pc mutation, the present invention further constructed a GRAND editing editing system based on the PE system. The system comprises Cas9 nickase and pegRNA (comprising sgRNA, partially complementary RT template and primer binding site PBS). The 3'-carried reverse transcription template (RRTs) contains a base complementary pairing region. When the RT enzyme initiates reverse transcription, the ends of the two template chains complement each other to produce a stable double-stranded structure, thereby introducing exogenous fragment insertion. This breaks through the bottleneck of the PE editing system that can only insert fragments ≤44bp and has low insertion efficiency. The successful insertion of a 202bp fragment is achieved, the insertion efficiency is improved, and the targeted insertion efficiency is 19.44%, which greatly enriches the application scenarios of donor-free long fragment sequence gene editing technology.

[0045] 2) The present invention targeted the Polled site of wild-type cattle, designed a specific sgRNA, RT template, and primer binding site PBS sequence, successfully prepared pegRNA, and constructed a related GE editing system based on pegRNA, successfully achieving the replacement of a 6 bp sequence between 1706055-1706060 bp and a 208 bp sequence between 1705837-1706044 bp in the cattle genome, constructing a Pc mutation, and providing technical support for the breeding of hornless cattle. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0047] Figure 1 Schematic diagram of the principle of GRAND targeted DNA insertion.

[0048] Figure 2Schematic diagram of inserting the Pc fragment into the gene of wild cattle.

[0049] Figure 3 Figure 1 is the band pattern of Pc insertion detected by PCR using primers F1 / R1 and F2 / R2, with F1 / R1 corresponding to the left and F2 / R2 corresponding to the right.

[0050] Figure 4 Figure 2: Sanger sequencing results of the insertion site.

[0051] Figure 5 Figure 1 is the band pattern of the PC site detected by PCR using primers F3 / R3 and F4 / R4, with F3 / R3 corresponding to the left and F4 / R4 corresponding to the right.

[0052] Figure 6 Figure 3: Band pattern of restriction enzyme digestion verification of the amplified product.

[0053] Figure 7 Figure 1: PCR electrophoresis of monoclonal cells.

[0054] Figure 8 Figure 1: TA clone sequencing diagram of monoclonal cells.

[0055] Figure 9 Figure 1: Representative images of blastocysts.

[0056] Figure 10 For: Photo of hornless Mongolian cattle. DETAILED DESCRIPTION

[0057] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0058] Example 1

[0059] Design of pegRNA specifically recognizing the polled locus in cattle

[0060] GRAND editing involves Cas9 nickase and pegRNA (including sgRNA, partially complementary RT template and primer binding site PBS). The 3'-carried reverse transcription template (RRTs) contains a base complementary pairing region. When the RT enzyme initiates reverse transcription, the two template strands complement each other to produce a stable double-stranded structure, thereby introducing exogenous fragment insertion ( Figure 1 ).

[0061] In order to achieve the purpose of replacing the 6 bp sequence between 1706055-1706060 bp in the cattle genome (Gene ID: 281415, Location: chromosome: 1) with the 208 bp sequence between 1705837-1706044 bp by gene editing technology ( Figure 2 ), two pegRNA sequences were designed for the wild-type Horned site sequence, where the sgRNA sequence, RT template and PBS sequence, and the full-length pegRNA sequence are as follows:

[0062] sgRNA: AGATAGTTTTCTTGGTAGGC, SEQ ID NO.1;

[0063] RT template (11 nt):TTTACATTAGGTATGAATCCGTTTGTAGACTATTTTAC

[0064] AAAAGTAGACGTCATATTGTTCTTTCCGCGTCTGCAGGTCGACACGCACTCGAGTCTTCATCAACCATGGTGCATGAGAAGTAAAGTGTCG, SEQ ID NO.2;

[0065] PBS (14 nt): TACCAAGAAAACT, SEQ ID NO.3;

[0066] pegRNA1:

[0067] AGATAGTTTTCTTGGTAGGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTACATTAGGTATGAATCCGTTTGTAGACTATTTTACAAAAGTAGACGTCATATTGTTCTTTCCGCGTCTGCAGGTCGACACGCACTCGAGTCTTTCATCAACCATGGTGCATGAGAAGTAAAGTGTCGTACCAAGAAAACT, SEQ ID NO.4;

[0068] sgRNA: AGGACACCTCCCACACTTTT, SEQ ID NO.5;

[0069] RT template (11 nt):

[0070] TTGTAAAATAGTCTACAAACGGATTCATACCTAATGTAAAAAGATACATATTTTTCTTTCTTGTCTGAAAGTCTTTGTAGTGAGAGCAGGCTGGAATTATGTCTGGGGTGAGATAGTTTTCTTTTGCTCTTTAGATCAAAACTCTCTTTTCATTTTTAAGTCTATCCCAAA, SEQ ID NO.6;

[0071] PBS (14 nt): AGTGTGGGAGGTG, SEQ ID NO.7;

[0072] pegRNA2:

[0073] AGGACACCTCCCACACTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGTAAAATAGTCTACAAACGGATTCATACCTAATGTAAAAAGATA CATATTTTTCTTTCTTGTCTGAAAGTTCTTTGTAGTGAGAGCAGGCTGGAATTATGTCTGGGGTGAGATAGTTTTCTTTTGCTCTTTAGATCAAAACTCTCTTTTCATTTTTAAGTCTATCCCAAAAGTGTGGGAGGTG, SEQ. ID NO.8.

[0074] Example 2

[0075] Construction of GE-pegRNA expression vector

[0076] (1) Construction of GE gene editing vector

[0077] First, using pCMV-PE2 (Addgene #132775) as a template, the Cas9 (H840A)-MMLV RT fragment was cloned. The PCR reaction system and primer sequences are as follows:

[0078] Table 1 PCR reaction system

[0079]

[0080] Primer F: 5'-agccgctagtcgacaGACAAGAAGTACAGCATCGG-3', SEQ ID NO.9;

[0081] Primer R: 5'-caaagtctgtttcacGGGTGATGAATTTTCTATGA-3', SEQ ID NO.10;

[0082] Then, pCRISPR-S12 (Addgene #84031) was used as the gene editing vector backbone. Age I and Fse I double enzyme digestion and linearization, using homologous recombination kit to insert Cas9 (H840A)-MMLV RT fragment (system as follows), to obtain GE gene editing vector, GE-epi vector;

[0083] Table 2 Homologous recombination reaction system

[0084]

[0085] Since the GE gene editing vector has two pegRNAs, we constructed a multi-site editing vector based on Csy4. Similarly, the EGFP sequence in the GE-epi vector was replaced with Csy4 through homologous recombination to construct a GE-epi-Csy4 vector.

[0086] The GE-epi-Csy4 vector was Nhe I and Xho I double enzyme digestion and linearized GE-epi-Csy4 expression vector were obtained.

[0087] (2) Design and cloning of the Csy4 site-pegRNA1-Csy4 site-pegRNA2-Csy4 site sequence

[0088] Csy4 recognition sequences were added to both ends of the two pegRNA sequences to construct the Csy4 site-pegRNA1-Csy4site-pegRNA2-Csy4 site sequence. The Csy4 site-pegRNA1-Csy4 site-pegRNA2-Csy4 site sequence was synthesized by TAKARA. The specific process is as follows:

[0089] 1.0 μL Oligo F (100 μM)

[0090] 1.0 μL Oligo R (100 μM)

[0091] 8.0 μL 1× Annealing Buffer

[0092] The above solutions were mixed in a PCR tube and the temperature was gradually decreased from 95°C to 22°C at 1.5°C per minute in a PCR instrument to prepare annealing products;

[0093] The primer sequences of specific Oligo F and Oligo R are as follows:

[0094] Oligo F:

[0095] 5’-ctaggttcactgccgtataggcagAGATAGTTTTCTTGGTAGGCGTTTTAGAGCT

[0096] AGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTACATTAGGTATGAATCCGTTTGTAGACTATTTTACAAAAGTAGACGTCATATTGTTCTTTCCGCGTCTGCAGGTCGACACGCACTCGAGTCTTTCATCAACCATGGTGCATGAGAAGTAAAGTGTCGTACCAAGAAAACTgttcactgccgtataggcagAGGACACCTCCCACACTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGTAAAATAGTCTACAAACGGATTCATACCTAATGTAAAAAGATACATATTTTTCTTTCTTGTCTGAAAGTCTTTGTAGTGAGAGCAGGCTGGAATTATGTCTGGGGTGAGATAGTTTTCTTTTGCTCTTTAGATCAAAACTCTCTTTTCATTTTTAAGTCTATCCCAAAAGTGTGGGAGGTGgttcactgccgtataggcag-3’, SEQ ID NO. 11;

[0097] Oligo R:

[0098] 5’-tcgactgcctatacggcagtgaacCACCTCCCACACTTTTGGGATAGACTTAAA

[0099] -3', SEQ ID NO. 12;

[0100] (3) pegRNA ligation

[0101] 0.5 μL annealing product

[0102] 1.0 μL linearized GE-epi-Csy4 expression vector

[0103] 1.0 μL T4 ligase

[0104] 2.0 μL 5×T4 Buffer

[0105] 5.5 μL HO (ultrapure water)

[0106] The above solutions were mixed in a 1.5 mL EP tube and incubated at room temperature for 30 min to prepare the ligation product;

[0107] (4) Conversion

[0108] 10 μL of ligation product was added to 50 μL of E. coli DH5α competent cells (pfu×10 8) for transformation. Then, plate onto LB plates containing 50 μg / mL ampicillin and incubate inverted at 37°C overnight. Single clones were selected for amplification and sequencing verification. Those successfully linked to the Csy4 site-pegRNA1-Csy4 site-pegRNA2-Csy4 site were selected as the GE-pegRNA expression vector.

[0109] Example 3

[0110] Screening and identification of PE-POLLED gene-edited monoclonal cells

[0111] (1) Isolation, culture and transfection of bovine fetal fibroblast cell lines

[0112] Bovine fetal fibroblasts were isolated and cultured in our laboratory using Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS (Gibco) and 1% double-stranded antibody (Gibco) at 37°C and 5% CO2. Fetal fibroblasts were cultured in six-well plates (Corning). When the cells reached 70% confluence, they were transfected with 10 μg of the GE-pegRNA expression vector using Lipofectamine 3000 reagent (Invitrogen). Cells were harvested 72 hours after transfection for subsequent analysis.

[0113] (2) Identification of positive cells

[0114] a: PCR identification

[0115] Genomic DNA extraction and PCR amplification

[0116] 72 h after cell transfection, the cells were digested with 0.05% trypsin (Gibco) and washed three times with PBS (Gibco). The cells were collected in 1.5 mL centrifuge tubes (Axgen), and DNA from the transfected cells was extracted using a genomic DNA extraction kit (Vazyme). The target sequence was amplified by PCR using Green Taq Mix (Vazyme, P131) with primers F1 / R1 and F2 / R2 (Table 3). The PCR products were analyzed by 2% TAE agarose gel electrophoresis and sent to Shanghai Sangon Biotechnology Co., Ltd. for Sanger sequencing. The experimental results are shown in Figure 3. Figure 3 and Figure 4 shown.

[0117] Result analysis: The results showed that GRAND editing could successfully introduce Pc repeats into the target site of the bovine genome, indicating the existence of a 6 bp deletion and a targeted insertion of 208 bp.

[0118] In order to further identify whether the target fragment is inserted into the targeted editing site, the PC fragment was used as the target sequence and specific primer sequences F3 / R3 and F4 / R4 were designed (F3 / R3 is used as a control and can bind to the non-target sites on the wild-type genome and the edited genome, while F4 / R4 can only specifically bind to the targeted site of the edited genome). The primer sequences are shown in Table 3. The PCR products were analyzed by 2% TAE agarose gel electrophoresis. The experimental results are shown in Table 3. Figure 5 shown.

[0119] Table 3 Primer sequences

[0120]

[0121] Result analysis: PCR results showed that GRAND gene editing successfully achieved the insertion of the Pc fragment.

[0122] b: Kpn I restriction endonuclease identification of accurate insertion of fragments

[0123] The PCR product after F2 / R2 amplification can be further used for restriction enzyme digestion identification. The fragment amplified with the wild-type genome as a template contains 1 Kpn I restriction endonuclease, and the fragment obtained by amplification of the genomic template of the gene insertion contains 2 Kpn I restriction endonuclease. 20 μL of the enzyme digestion reaction solution to be identified was incubated at 37°C for 1 h. The digestion products were analyzed by 2% TAE agarose gel electrophoresis. The experimental results are shown in Figure 2. Figure 6 shown.

[0124] Result analysis: Compared with the wild-type bovine genome, the inserted 208 bp repeat introduced an additional KpnI restriction site. Kpn I enzyme digestion verification showed that both the wild-type PCR product and the edited PCR product showed fragments consistent with the expected size, indicating that GRAND gene editing can target the insertion of Pc fragments.

[0125] Example 4

[0126] Obtaining hornless gene-edited monoclonal cells

[0127] To obtain a hornless bovine cell line, we transfected GE-pegRNA expression vector into Mongolian bovine fetal fibroblasts and waited for 48 h until the cell number reached 1×10 7, flow cytometry sorting, and single clones were made into 96-well plates. When the cells in the 96-well plate grew to 30%, they were passaged to 24-well plates. When the cells were full, they were passaged to 6-well plates. After the cells were full, we took a part of the cells for DNA extraction and the other part of the cells were frozen. The 36 frozen monoclonal cells were identified using primers F2 / R2. After extracting cell genomic DNA, PCR amplifying the targeted fragment and TA cloning, the sequencing results showed that 7 targeted positive monoclonal strains were finally obtained, all of which were DNA heterozygous mutations ( Figure 7 , 8). Therefore, the targeted insertion efficiency was 19.44%.

[0128] Preparation of hornless gene-edited cloned embryos and hornless Mongolian cattle

[0129] In order to obtain hornless bovine cloned embryos, we first used the bovine fetal fibroblast monoclonal cells obtained above as donor cells for nuclear transplantation. After fusion and activation with the enucleated oocytes, the reconstructed embryos were cultured in culture medium. After cleavage, they were transferred to feeder layers and cultured until they developed to the blastocyst stage ( Figure 9 The blastocysts were transplanted into the uterus of recipient cows that were in estrus at the same time. After about 280 days, we successfully obtained hornless Mongolian cattle ( Figure 10 ).

[0130] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0131] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A pegRNA that specifically recognizes the polled site of cattle, characterized in that: The pegRNA includes pegRNA1 and pegRNA2; both pegRNA1 and pegRNA2 include sgRNA, RT template and PBS, and the specific sequences are as follows: pegRNA1: The sequence of the sgRNA is shown in SEQ ID NO.1; The sequence of the RT template is shown in SEQ ID NO.2; The sequence of the PBS is shown in SEQ ID NO.3; pegRNA2: The sequence of the sgRNA is shown in SEQ ID NO.5; The sequence of the RT template is shown in SEQ ID NO.6; The sequence of the PBS is shown in SEQ ID NO.

7.

2. The pegRNA that specifically recognizes the bovine hornless polled site according to claim 1, characterized in that The nucleotide sequence of the pegRNA1 is shown in SEQ ID NO.4; the nucleotide sequence of the pegRNA2 is shown in SEQ ID NO.

8.

3. A DNA molecule, characterized in that The DNA molecule encodes the pegRNA1 and pegRNA2 according to claim 1 or 2.

4. A biomaterial, characterized in that The biological material is any one of the following: An expression cassette containing the DNA molecule according to claim 3; A recombinant vector containing the DNA molecule of claim 3, or a recombinant vector containing the expression cassette of 1); A transgenic cell line containing the DNA molecule of claim 3, or a transgenic cell line containing the recombinant vector of 2); A recombinant bacterium containing the DNA molecule of claim 3, or a recombinant bacterium containing the expression cassette of claim 1), or a recombinant bacterium containing the recombinant vector of claim 2).

5. Use of the pegRNA according to claim 1 or 2, the DNA molecule according to claim 3, or the biomaterial according to claim 4, characterized in that: The application is any of the following: 1) Application in the specific identification of polled sites in cattle; 2) Application in constructing PC mutations; 3) Application in hornless cattle breeding; 4) Application in the preparation of a GRAND editing system for editing Pc mutations; 5) Application in GRAND editing of Pc mutations.

6. A GRAND editing system, characterized in that: Include at least one of the following: The pegRNA according to claim 1 or 2; The expression cassette of claim 4; The recombinant vector according to claim 4.

7. The GRAND editing system according to claim 6, characterized in that: Also included are GRAND editing proteins.

8. Application of the GRAND editing system according to any one of claims 6-7, characterized in that: The application is any of the following: 1) Application in the specific identification and editing of polled sites in cattle; 2) Application in constructing PC mutations; 3) Application in hornless cattle breeding; 4) Application in GRAND editing of Pc mutations.

9. A GRAND editing method for constructing a Pc mutation, characterized in that: The method comprises the step of performing GRAND editing using the pegRNA according to claim 1 or 2, the DNA molecule according to claim 3, the expression cassette or recombinant vector according to claim 4, or the GRAND editing system according to any one of claims 6-7.

Images