A method for transient expression of sandalwood callus and its application

Abstract

This invention discloses a method for transient expression of sandalwood callus and its application. Using sandalwood embryogenic callus as the transformation recipient, an Agrobacterium-mediated transformation is used to transiently introduce a GFP-tagged target gene into the embryogenic callus. Positive materials are screened using fluorescence microscopy, which can rapidly detect the transient expression of the target gene in the callus. Further, samples are collected and GC-MS analysis of gene expression or metabolites is performed to identify the function of the gene / enzyme.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for transient expression of sandalwood callus and its application. Background Technology

[0002] Sandalwood (Santalum album) is a semi-parasitic evergreen shrub or small tree belonging to the genus Santalum and family Santalaceae. It is considered the finest sandalwood, and its essential oil, extracted from its heartwood, is extremely valuable, often referred to as "liquid gold." It is used to make perfumes and fragrances and possesses antibacterial, antitumor, and anti-inflammatory properties. Its price on the international market exceeds US$5,000 per kilogram. Driven by market demand and considerable economic value, wild sandalwood resources have been severely depleted, leading to resource shortages. Sandalwood is not native to my country. In 1962, our garden successfully introduced sandalwood seeds from Indonesia for the first time for propagation; in the 1980s, we successfully introduced "Laoshanxiang," a high-quality sandalwood seed source, from India. The main component of sandalwood essential oil is santalol, including α-santalol ((Z)-α-santalol) and β-santalol ((Z)-β-santalol), accounting for over 80% of the total essential oil content. With the development of biotechnology, the biosynthesis of sandalwood essential oil has attracted keen attention from researchers.

[0003] Terpenes are one of the most diverse and structurally varied families of natural products, possessing antibacterial and antitumor activities; examples include the antimalarial drug artemisinin and the anticancer drug paclitaxel. Therefore, plant terpenes have broad application prospects in the pharmaceutical and aromatic industries. The upstream pathways of terpenoid biosynthesis mainly include the mevalonate pathway and the 2-methyl-D-erythritol 4-phosphate pathway. Terpenoid synthases (TPS) are key enzymes in the downstream synthesis pathways. Therefore, the molecular regulatory mechanisms of plant terpenoid synthesis have always been a frontier and hot topic in the field of plant secondary metabolism research both domestically and internationally.

[0004] Transient expression is an important technique for rapidly studying gene expression and gene-gene interactions. It can complete the expression and functional analysis of target genes within a few days, offering advantages such as simplicity, speed, and efficiency, and is currently a commonly used method in functional genomics research. Transient expression methods include gene gun bombardment, protoplast transformation, and Agrobacterium-mediated transformation. Among these, Agrobacterium-mediated transient expression is widely used in plant functional gene research due to its simplicity, high transformation efficiency, and low cost.

[0005] Under natural growth conditions, sandalwood grows slowly and has a long growth cycle, which greatly limits its genetic transformation and slows down the progress of functional research on sandalwood-related genes. Currently, there are no reports on transient expression systems for sandalwood plants. Therefore, developing efficient genetic transformation systems is of great significance for the study of sandalwood functional genes. Summary of the Invention

[0006] To develop an efficient genetic transformation system for sandalwood genes, the present invention aims to provide a method for transient expression of sandalwood callus. Using sandalwood embryogenic callus as the transformation recipient, the target gene tagged with GFP is transiently introduced into the embryogenic callus using Agrobacterium-mediated transformation. Positive materials are screened using fluorescence microscopy, which can rapidly detect the transient expression of the target gene in the callus. Further, samples are collected and GC-MS analysis of gene expression or metabolites is performed to identify the function of the gene / enzyme.

[0007] The first objective of this invention is to provide a transcription factor SaMYC2 that regulates the santalene synthase gene (SaSSY), the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] A second objective of this invention is to provide the sandalwood terpene synthase gene SaTPS11, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0009] A third objective of this invention is to provide the sandalwood terpene synthase gene SaTPS21, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0010] A fourth objective of this invention is to provide the use of the transcription factor SaMYC2 in the catalytically promoted production of α-santalene, α-bergamerene, epi-β-santalene, and / or β-santalene.

[0011] A fifth objective of this invention is to provide the application of the sandalwood terpene synthase gene SaTPS11 in catalytically promoting the production of cis-nerolidol ((Z)-nerolidol) and / or trans-nerolidol ((E)-nerolidol).

[0012] The sixth objective of this invention is to provide the application of the sandalwood terpene synthase gene SaTPS21 in catalytically promoting the production of cis-nerolidol ((Z)-nerolidol).

[0013] This invention also provides a method for transient expression of sandalwood callus, which involves inserting the target gene into an expression vector, transforming it into Agrobacterium, infecting the embryogenic callus of sandalwood through Agrobacterium-mediated infection, and then obtaining positive materials through screening.

[0014] Preferably, the expression vector is pGreen 35S-GFP(C17).

[0015] Preferably, the target gene is the transcription factor SaMYC2, the santalene synthase gene SaTPS11, or SaTPS21 that regulates the santalene synthase gene (SaSSY).

[0016] Preferably, the method for preparing the embryogenic callus tissue of sandalwood is as follows:

[0017] Sandalwood stem segments were used as explants and cultured on embryogenic callus induction medium. The induction medium was MS basal medium supplemented with 1-2 mg / L 2,4-D and 0.2-0.5 mg / L TDZ.

[0018] Embryogenic callus was cultured on subculture medium to obtain sandalwood embryogenic callus; the embryogenic callus was then subcultured to obtain vigorous embryogenic callus, which served as a transformation recipient. The subculture medium consisted of MS basal medium supplemented with 0.2-0.5 mg / L 2,4-D and 0.1-0.2 mg / L TDZ.

[0019] Embryogenic callus was inoculated in Agrobacterium tumefaciens infection solution containing the target gene, and then transferred to a co-culture medium for dark culture to obtain transient transformation material. The co-culture medium consisted of MS basal medium, 20-30 g / L sucrose, 1.5-2 g / L plant gel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, and 40-100 mg / L acetylsylgenone.

[0020] After dark culture, the transiently transformed material was washed with sterile water and then inoculated onto MS basal medium containing 20-30 g / L sucrose, 1.5-2 g / L plant gel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, 50-200 mg / L termethin, and 0.05-0.1 mg / L BASTA. The medium was then cultured normally, and positive materials were obtained through screening.

[0021] The screening method described is PCR screening, which obtains positive materials transformed with the target gene by amplifying the sequence in the target gene.

[0022] This invention enables rapid analysis of the regulatory effects of transcription factors on target genes or identification of the function of terpene synthase genes. It is simple to operate and provides a technical means for screening transcription factor-regulated target genes and conducting in-depth research on the function of sandalwood genes. Alternatively, it can provide technical support for more rapid identification of the function of plant terpene synthase genes without the need for E. coli protein expression and in vitro enzyme activity analysis. Attached image description:

[0023] Figure 1Transcription factors regulate the expression of the SaSSY gene. AB, GFP fluorescence signal in callus tissue; A, wild-type callus tissue; B, fluorescence signal in callus tissue after overexpression of the transcription factor; C, expression level of the SaSSY gene after transient expression of the transcription factor; D, GC-MS detection of metabolites after transient expression of the transcription factor; Peak 1, α-santalene; 2, α-bergamerene; 3, epi-β-santalene; 4, β-santalene; OE-TF represents sandalwood-positive material transformed with the target gene; Empty vector represents sandalwood material transformed with an empty vector.

[0024] Figure 2 This represents the transient expression of the terpene synthase gene. AC, GFP fluorescence signal of callus tissue; A, wild-type callus tissue; B, fluorescence signal of callus tissue overexpressing SaTPS11; C, fluorescence signal of callus tissue overexpressing SaTPS21; D, GC-MS detection of metabolites after transient expression of SaTPS11 and SaTPS21; Peak 1, cis-nerolidol (Z), 2, trans-nerolidol (E); E, nerolidol isomer standard; OE-SaTPS11 and OE-SaTPS12 represent sandalwood positive materials transformed with the target genes SaTPS11 and SaTPS21, respectively; Empty vector represents sandalwood material transformed with an empty vector. Detailed implementation method:

[0025] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0026] Example 1:

[0027] A method for transient expression of sandalwood callus and its application, comprising the following steps:

[0028] 1. The target gene was inserted into the EcoRI and XbaI restriction sites of pGreen 35S-GFP(C17) (the preparation method of the vector is described in the literature: Hou XL, Zhou JN, Liu C, Liu L, Shen LS, Yu H (2014) Nuclear factor Y-mediated H3K27me3demethylation of the SOC1 locus orchestrates flowering responses of Arabidopsis. Nat Commun 5:4601. https: / / doi.org / 10.1038 / ncomms5601), thus obtaining the overexpression vector pGreen 35S-target gene; then the overexpression vector pGreen 35S-target gene and pGreen 35S-GFP(C17) (empty vector) were transformed into Agrobacterium strain GV3101, and inoculated into LB containing 50 μg / ml kanamycin (Kan) (containing 10g Tryptone, 5g Yeast extract, and NaCl per liter). 10g of Agrobacterium and 15g of agar powder (autoclaved at 121℃ for 20 min) were placed on culture medium and incubated upside down at 28℃ for 2-3 days. Positive clones were screened to obtain Agrobacterium single clones carrying the target gene and Agrobacterium single clones transformed with empty vectors. The single clones were then transferred to 100ml of LB liquid medium and shaken until OD was reached. 600 Centrifuge at 1000g for 5 min with a pH of 0.6-0.8, discard the supernatant, suspend the bacterial cells in the infection solution, and incubate in the dark at 28℃ for 2-3 h. The infection solution is: MES 10g / L + acetylsyl syringone 40mg / L + 0.05% Silwet L-77.

[0029] The target genes are SaMYC2 (its nucleotide sequence is shown in SEQ ID NO.1), sandalwood terpene synthase gene SaTPS11 (its nucleotide sequence is shown in SEQ ID NO.2), and SaTPS21 (its nucleotide sequence is shown in SEQ ID NO.3). The target genes include a GFP tag protein.

[0030] 2. Using sandalwood stem segments as explants, inoculate them onto embryogenic callus induction medium and culture for 2-3 weeks. The induction medium is MS basal medium supplemented with 2 mg / L 2,4-D and 0.5 mg / L TDZ. Continue culturing the embryogenic callus on subculture medium to obtain sandalwood embryogenic callus. Subculture the embryogenic callus for another 2 weeks to obtain vigorous embryogenic callus, which serves as the transformation recipient. The subculture medium is MS basal medium supplemented with 0.5 mg / L 2,4-D and 0.2 mg / L TDZ. The light conditions for induction and subculture are a light intensity of 80-120 μmol / m². 2 s -1 Light exposure time is 14 hours per day.

[0031] 3. Embryogenic callus tissue was directly placed into infection solutions of Agrobacterium GV3101 containing the target gene and Agrobacterium GV3101 transformed with an empty vector for 10-15 minutes, with gentle shaking every 5 minutes. Excess bacterial solution was thoroughly blotted out onto filter paper. The embryogenic callus tissue was then transferred to a co-culture medium and cultured in the dark for 2-3 days to obtain transiently transformed material. The co-culture medium consisted of MS basal medium, 30 g / L sucrose, 1.5 g / L plant gel, 0.5 mg / L 2,4-D, 0.2 mg / L TDZ, and 100 mg / L acetylsylgenone.

[0032] 4. After dark culture, wash the callus twice with sterile water, then inoculate it onto MS basal medium containing 30 g / L sucrose, 1.5 g / L plant gel, 0.5 mg / L 2,4-D, 0.2 mg / L TDZ, 50 mg / L termethin, and 0.05 mg / L BASTA. Culture normally for 5-7 days under a light intensity of 80-120 μmol / m². 2 s -1 The light exposure time was 14 h / d; the transformation results were observed and screened using a fluorescence microscope.

[0033] 5. Take 200mg of sample, extract RNA, and use... The One-Step gDNA Removal and cDNA Synthesis SuperMix kit (Beijing, TransGold) was used to reverse transcribe the DNA into cDNA, and the gene expression was quantitatively analyzed using qRT-PCR primers (Table 1).

[0034] 6. Take 1g of sample and place it in a 10mL headspace vial. Add the SPME adsorption rod and adsorb at 30℃ for 20min. Detect by GC-MS, analyze metabolites, and identify the function of the target gene.

[0035] 7. The target gene in this invention is a transcription factor (SaMYC2, whose nucleotide sequence is shown in SEQ ID NO.1) that regulates the santalene synthase gene (SaSSY). Transient expression was performed on embryogenic callus tissue to obtain transiently transformed materials, which were then co-cultured. Fluorescence microscopy observation showed that the samples after transient overexpression of the transcription factor exhibited a strong GFP fluorescence signal. Figure 1 (AB) indicates that the transcription factor was successfully overexpressed in embryonic callus tissue with a transformation efficiency of 100%. Gene expression analysis showed that the expression level of the SaSSY gene increased approximately 4-fold. Figure 1 C). GC-MS results showed that transient overexpression of the transcription factor increased the relative content of SaSSY enzyme-catalyzed products α-santalene, α-bergamerene, epi-β-santalene, and β-santalene by approximately 4-5 times. Figure 1 D).

[0036] 8. The target genes in this invention are two santalene synthase genes, SaTPS11 (its nucleotide sequence is shown in SEQ ID NO. 2) and SaTPS21 (its nucleotide sequence is shown in SEQ ID NO. 3). Transient expression was performed on embryogenic callus tissue to obtain transiently transformed materials, which were then co-cultured. Fluorescence microscopy observation showed strong GFP fluorescence signals in all overexpression samples. Figure 2 AC) indicates that all these enzyme genes were successfully expressed in embryogenic callus tissue, with a transformation efficiency of 100%. GC-MS results show that SaTPS11 enzyme catalyzed the production of two products: cis-nerolidol ((Z)-nerolidol) and trans-nerolidol ((E)-nerolidol), while SaTPS21 enzyme catalyzed the production of only one product, (Z)-nerolidol. Figure 2 D).

[0037] This technology can be used to quickly analyze the regulatory effects of transcription factors on target genes or identify the function of terpene synthase genes. It is easy to operate and provides a technical means for screening transcription factors that regulate target genes and for in-depth research on the function of sandalwood genes. Alternatively, it can provide technical support for more rapid identification of the function of plant terpene synthase genes without the need for E. coli protein expression and in vitro enzyme activity analysis.

[0038] Table 1 Primer sequences used in this invention

[0039]

[0040] >SaMYC2 (SEQ ID NO.1)

[0041] ATGGCAGATTTCCGGCTACCGGCGATGAATCTGTGGACGGACGATAACGCCACGATGATGGATGCTTTCATGAGCTCCGA

[0042] TCTCTCTTCCATCGGATGGACTCCTCAATCATCCGCCGCATCCGCCGTTTCCAACTCCAGCGCAGCCCCACCCGCGCTGG

[0043] ACCCGTTCCGCACCGCCGCCGGCAGTCAATCGCAGCCACCGATTGTGTTGTTCAACCAGGAGACCCTTCAGCAGCGCCTC

[0044] CAAACCCTAATCGAGGAAGCGAAGGAGAGCTGGACCTACGCCATCTTCTGGCAGCCCTCCTCCGCGGACCCGTCCGGTGC

[0045] GGCGGCGCTCTTAGGGTGGGGCGACGGCTACTACAAGGGGGAGCAGAAGCAGCGGAGGACGACGACTCCATCCTCGGCGG

[0046] CGGAGCAGCAGCACCGGAAAAGGGTCCTCCGCGAGCTCAATTCCCTCATTTCCGGCGGCTCCGCCTCCATCGATGACGCC

[0047] GTCGACGAGGAGGTCACCGATACGGAGTGGTTCTTCCTTGTCTCGATGACGCAGTCTTTCGCCAACGGCACGGGGCTACC

[0048] GGGTCAGGCGTTCTTGAGGTCGAACCCGGTCTGGGTCACCGGCGCCGACCAACTCGCCGGTTCGGGGTGCGAACGGGCGA

[0049] GGCAGGGCCAGGTTTTCGGGTTGCGGACGATCGTGTGCGTTCCGCTGGCTAACGGGGTGGTGGAGTTGGGGTCGACGGAG

[0050] TTGATCTTCCAGACCCCGGATCTGATGAACAAGATTAGGGTTTTGTTCGATTTCAATAGCATGGAGATTGGGTCTTGGGG

[0051] AATCAATGGCGATCAGGGCGAGAACGACCCCTCCGCTCCGTGGATCGCCGACCACCCTTCATCTTCGTCCCTGGAAATTA

[0052] GGGATTCTGTGAACACAGCAACGAGTAATCACAACTTCAACCCTAGTAGTAGCAACCAGCACATTCCCAAGCCGATCCAG

[0053] TTCGAAAATCCGAGTTCAGATAGCTTAAATGATCAAAACCCTAGTGTTTTACATGTGAATTCTCATCCCTACCAGCATAA

[0054] CCAGCGCCGGCAAATCTCGCCGGCGGTGGGGGAAGCGGCGCCTTCGTCGCAGCCGACGCCGGGTTTTTTGACTCGGGATC

[0055] TGAATTTTGCGGAATTGGGGTACGAGGAGAGCCACCGTGTGAAGAACGGGTGCAAGGCGGAGGCCGGTGAGATACTGAAT

[0056] TTTGCGGAAAGTAAGAGGAGTCCGTGTAGTGGAACTAGGAGTTTATTTTCGACTCATTCTGAATTCGTGAGCGAGAAGAA

[0057] TAATAGGAAGCGAAGGTCGCCGCCGGAGGCGTCGAGAGGGAGCAACAACGAGGAGGGGATGCTCTCGTTCACTTCAGGGG

[0058] TGGTTCCGCCGTCCTCCGGTACTGCGAGGTCCACCGGCGGCGGTGATTCCGATCAATCTGATCTCGAGGCATCCGTGATT

[0059] CGAGAATCGGAGACCAGCAGAGTCGTAGATCCTGAAAAACGGCCTCGAAAACGGGGACGAAAACCCGCAAACGGAAGGGA

[0060] AGAGCCATTGAATCACGTTGAAGCGGAGCGGCAGCGGCGAGAGAAGCTCAATCAGAGATTCTACGCCCTCCGCGCCGAAG

[0061] TCCCAAACGTTTCAAAAATGGACAAGGCTTCCCTCCTCGGGGACGCCATTGCTTACATAAAAGAGCTCAAATCCAAGCTT

[0062] CAATCCGCTGAATCCGAGAATGAGGACTTGCAGAAGCAAGTGGACGGGTTGAATAAGGAGACGGCCCGAACCCCCTCACC

[0063] CGATCACGACCCCAAAATGTCGAACCGCGGTGGAGGGAAATTGGTGGACATTGACATTGAAGTGAAGATTATTGCTTGGG

[0064] ACGCAATGATCCGAATCCAATGCAGGAAGAGGAATCATCCGGCCGCGCGGTTAATGGTGGCGTTGAAAGAGCTGGATTTG

[0065] GATGTTCATCACGCCAGCGTTTCAGTGGTTAATGACTTGATGATACAGCAAGCCACAGTGAAGATGGGGACTCGATTTTA

[0066] CACTCAGGAGCAGCTCCGGATGATTTTATCTTGTAAGCTATCAGAGCACCCATGA

[0067] >SaTPS11(SEQ ID NO.2)

[0068] ATGGACTTATTTAGTGATAATGCACACAAGTGCACCAATGATGAAGATGATCATGCCTTTGCTTTAACCCCATCCCCCAG

[0069] CAGCTTTACCGATGAGTATTCCCTGGAAAAGGCACGAAAAGTGAAGGAGGTAAAGGCACTGCTCAACGAGGTGGCTTACG

[0070] AAGAGCCATCAGAAGGGTTGGAAGTGGTTGATGCCATCTATCGCCTAGGCATCGATCACCTTTTTAGAGATGAGATTGAA

[0071] GCACTTCTAAGGAAGCAATACATGAATTTAAGCATCTTGAGCCAAGATCTTGGTAGTGATCTTCATGAGGTTGCAATTAG

[0072] TTTTCGACTATTGAGACAAGAAGGTTATTATGTTCCTGCAGATATTTTTAGCAAATTCATGGACAAGGAAGGGAATTTCA

[0073] ATCAAAAACTATGTCAAGATATGAGAGGATTAATGGAGCTATATGAAGCTTCACACCTAAGCATAGAAGGAGATGATGAT

[0074] ATACTTGATCAGGGCAGAGACTTCAGCAGCCAACTCCTGAAGGCCCACATGACACAAGTTGATCATCTTCAGGCTGAAGT

[0075] GATTCGCAACACTTTGGCACTTCCCCAACGCTCGAGCCTTCCCATGTTCTCCACCACAAGCTTCCTCACTAGCGATTTCC

[0076] GTGAAAAGAGTAGTACTAGGAGTAGGTGGATGAATCTCCTCTCCCAATTGGCCAAAACTGACTTGCATTTGATGCGATCC

[0077] ATACACCATAAGGAAATACGTCAAGTATCCAAATGGTGGAAAGACATGGGTTTGGCCAAGGAATTGAAGTTTGCAAGAGA

[0078] TCAGCCACTAAAATGGTACATGTGGTCCAAAGTGGCTCTCGTGGATCCAATTTTATCAGAGGAGAGGGTTGACCTCACCA

[0079] AGCCCACTTCACTCATCTACATTATAGATGACATTTATGATGTCATGGGAACTCTTGATGAACTCACTCTCTTCACTCAA

[0080] GCTGTCAACAGCTGGGAGTCCTCTGAGCAACTACCAGAGTACATGAAGAAATGCTTCGATGCTCTCAATCAAGTCACGAA

[0081] TGAAATCAGTCATAAGGTCACTGTCAAGCACGGGTGGAACCCGGTGGACTCTCTCCGAAAGACGTGGGCAGACTTGTGCA

[0082] ATGCTTTTCTGGTGGAAGCGAAATGGTTTTCTTCAGGGAGGTTACCAAATTCAGAGGAGTACTTGAAGAATGGGATAGTG

[0083] AGTTCAGGAGCACACGTTGTGTTAGTTCACATTTTCTTTCTCTTGGGTGAAAATATAACTGAGGAGACTGCAGATGTTGT

[0084] GGATTTGACTCCGAGCATCATTTCTTCCACAGCAACCATTCTTCGCCTTTGGGATGACTTGGGAAGTGCAAAAGATGAGA

[0085] ATCAGGATGGCCATGACGGATCCTTCATAGAATGTTACATGAGGGAGAAACCAAGTGTATCGGTTCAGACCGCAAGAGAA

[0086] CACGTCACTGAAATGATATCGGAGGCGTGGAAGCTCCTCAATCGGGAGTGCCTCTCACCACCATCTCCATTCGCTGCAAG

[0087] TTTCAGGAGGGCTTGTCTCAATCTTGCAAAGATGGTGCCCTTGATGTACAAGTATGATGAGAATCACTGTCTCCCTCTGG

[0088] TTGAGGAACACGTGAAGTCCTTGCTCATAAATGGAGATGTCTCTCCATAG

[0089] >SaTPS21(SEQ ID NO.3)

[0090] ATGGGGACGGCCGCAAAAGTTGCAACCATCTCTTCTCCGATGAATTCACCGGCGGCTCCCACCATTGCCACTCGTCTATG

[0091] GCGGATGACCTTCGTCCCCTCACAACAACACCGCTCATGCGCACCTATTTGCATGTCGTTGCCATTGCGGTTAAAGCCAC

[0092] TCGTAGAAAGCCATGACTCCGTCCTCACACCCCTTCCTCCTACTCACTCGGTCAATGGAAGCACCGTCAGGAGGGAACAA

[0093] CTGTATGAAAAGGCACTGTGTGAACTGAATGAAGCATCTGATGATCCTACGGCCGCCTTGATGACGATCGACACGATCCA

[0094] ACGGCTGGGGATCGGGTACCATTTCGAGGAAGACATCAGTGTCCTATTGCAACGGTTCTCGGAGGGGAGAGATGGTGACG

[0095] ATCTCTTCCTCACCTCGCTGCGTTTCCGGCTACTCAGGCAGCATGGCCGACAAGCCTCTCAAGATGTGTTTCATAAATTT

[0096] GTGGATAAGAATGGGCAATTCAAGGAAACCCTAAACAAAGACGTATGGGGCACATTGAGCTTGTACGAGGCCTCGAGCTT

[0097] AAGAGCAGAACACGAAGAGATACTGTCACAAGCCCTGCGTTTCTCAAAAGCGGCTCTCTCGCAATCAATGCCTTCTATGG

[0098] ACCAACAAGCTCGCCGATGCATCGCCGGAGCATTGGAGACTCCAAGACACTTGAGGACGCCGCGGTTAGAAGCGAGACAC

[0099] TACATCGATGAGTATGGCAAGGATAGCCGCCGTAATCCTACCCTTCTCGGCATGGCAAAGTTAGATTTCAACATGGTTCA

[0100] GTTACTCCATAGAAGTGAGTTGGCTGAGGTATCAAGGTGGTGGAAGGAGCTGGGTCTTGTTGAAAAGCTCAGCTTTGCAA

[0101] GAGATCGGCCCATGGAGTGCTACTTATGGACGGTTGGGATTTTTCCAGAACCGTATAACTCTCACTGCCGTATTGAGTTG

[0102] ACCAAAGTTATTGCTATTCTACTGGTCATTGATGACATCTTTGATTCTTATGGGTCCTTGGATGAACTTATCCTCTTCAA

[0103] TGATGCAATTAAAAGATGGGACCTTGGTGCAATGGAACAATTGCCAGAGTACATGAAGATATGTTACACAGCTTTGTATA

[0104] ACACAACTGGAAGTGTTGCCGACAAAGTCTTCCAAGAACATGGCTTGGGTATGGATATCACACAACACCTAAAACAAACG

[0105] TGGATGGACCTGTTTGAAGCTTTTCTAGCGGAAGCGAAATGGTTCAACAGTGGTTATGTGGCCACGATGGATGAATACCT

[0106] AGAAAATGGTGTGACCACCGGAGGAACATACATGGCCTTGGTACACACTTTCTTCCTCTTGGGGAAACTTGTGACTCAAG

[0107] AAACTGTGGCATTGTTGATGGATCCCTATCCCCAACTCTTCTCATGCTCCGGAAAAATCCTCCGACTTTGGGACGATTTA

[0108] GGAACCGCAAGGGAGGAGGAAGAAAGAGGAGACGTTGCTTCGAGCATGGAGTGTTACAGAAGGGAGAATGACATTTCATC

[0109] AGAGAGTGAGGGGAGGGAAGCTATAAGGAAGCTCATCAACACCGTATGGATACAACTCAATGCCCAACTCATTGCTCCAA

[0110] ATGGACTCCCCCTTTCCACCGTCAATGCTTCCTTGAACCTCTCAAGAACTTCACAACTCATTTATCAGCATGGGGATGACGAATAG。

Claims

1. The transcription factor SaMYC2, which regulates the santalene synthase gene, is characterized by, The nucleotide sequence is shown in SEQ ID NO.

1.

2. The use of the transcription factor SaMYC2 of claim 1 in catalyzing and promoting the production of α-santalene, α-bergamerene, epi-β-santalene and / or β-santalene in sandalwood embryogenic callus.

3. A method for transient expression of sandalwood callus tissue, characterized in that, The method involves inserting the target gene into an expression vector, transforming it into Agrobacterium, infecting the embryogenic callus tissue of sandalwood with Agrobacterium-mediated transformation, and then selecting positive materials. The target gene is the transcription factor SaMYC2 as described in claim 1.

4. The method according to claim 3, characterized in that, The method for preparing the embryogenic callus tissue of sandalwood is as follows: Sandalwood stem segments were used as explants and cultured on embryogenic callus induction medium. The induction medium was MS basal medium supplemented with 1-2 mg / L 2,4-D and 0.2-0.5 mg / L TDZ. Embryogenic callus was cultured on subculture medium to obtain sandalwood embryogenic callus; the embryogenic callus was then subcultured to obtain vigorous embryogenic callus, which served as a transformation recipient. The subculture medium consisted of MS basal medium supplemented with 0.2-0.5 mg / L 2,4-D and 0.1-0.2 mg / L TDZ. Embryogenic callus was inoculated in Agrobacterium tumefaciens infection solution containing the target gene, and then transferred to a co-culture medium for dark culture to obtain transient transformation material. The co-culture medium consisted of MS basal medium, 20-30 g / L sucrose, 1.5-2 g / L plant gel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, and 40-100 mg / L acetylsyringone. After dark culture, the transiently transformed material was washed with sterile water and then inoculated onto MS basal medium containing 20-30 g / L sucrose, 1.5-2 g / L plant gel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, 50-200 mg / L termethin, and 0.05-0.1 mg / L BASTA. The medium was then cultured normally, and positive materials were obtained through screening.

Images