Gene MdILL6 for regulating and controlling salt stress of apple and application of gene MdILL6

Abstract

The invention belongs to but is not limited to the technical field of molecular biology, and discloses an apple salt stress gene MdILL6 and application thereof, and the nucleotide sequence of the gene MdILL6 for regulating and controlling apple salt stress is shown as SEQ.ID.NO.1. The invention also discloses an application of the gene MdILL6 for regulating and controlling apple salt stress. The gene MdILL6 for regulating and controlling salt stress is separated and identified from apples for the first time. Tests find that overexpression of the MdILL6 in the apple shows that the salt tolerance of the plant is reduced, which indicates that the gene plays an important role in regulating and controlling the salt stress of the plant. Apple MdILL6 can regulate the reaction of plants under salt stress, has a key synergistic regulation effect in salt tolerance of fruit trees, and provides a new insight for the salt tolerance mechanism of apple plants.

Description

Technical Field

[0001] The present invention belongs to, but is not limited to, the field of molecular biology technologies, and particularly relates to an apple salt stress gene MdILL6 and its application. Background Art

[0002] Soil salinization is an abiotic factor that severely restricts plant growth and development. Globally, more than 800 million hectares of arable land are affected by salt. The consequences of salt stress are multifaceted, including nutrient deficiency, oxidative stress, and reduced biomass, all of which directly damage the yield and quality of agricultural products. Therefore, elucidating the molecular mechanism of apple salt tolerance will contribute to the cultivation and planting of salt-tolerant varieties, and planting salt-tolerant plants is a sustainable strategy for better utilization of saline-alkali land.

[0003] To cope with salt stress, plants have developed a series of complex and sophisticated internal mechanisms and adaptive strategies, such as changes in morphology, anatomical structure, water relations, photosynthesis, hormone levels, distribution of toxic ions, reactive oxygen species (ROS) scavenging, and other biochemical adaptations. The responses of plants to salt stress will have harmful effects on plants. Generally, the salt tolerance of plants is positively correlated with the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT). The transcriptional regulatory network also plays a role in regulating the biological processes of plants in response to salt stress.

[0004] The Arabidopsis ILL (IAA-Leucine Resistant1-like Hydrolase, ILL) family contains 7 genes (IAR3, ILL1, ILL2, ILL3, ILL5, ILL6, and ILR1), and some members have been shown to degrade auxin-amino acid conjugates, such as ILL1, ILL2, and IAR3. During fruit ripening, ILR1 is highly expressed and may play a role in fruit ripening by releasing active IAA. In addition, ILL6 is a primary candidate regulator of the jasmonic acid pathway, and its transcript can be induced by jasmonic acid but not by IAA. AtILL6 positively regulates the defense mediated by plant basal or resistance (R) genes and negatively regulates plant stem length. The expression level of AtILL6 can be induced by nitrosative stress (CySNO), and this stress damages the basal defense ability of plants. However, the exact mechanism by which MdILL6 regulates plant salt stress is still unclear. Summary of the Invention

[0005] Aiming at the problems existing in the prior art, the present invention provides a gene MdILL6 for regulating apple salt stress. A gene MdILL6 for regulating salt stress was identified and isolated from apples, and it was found that overexpression of MdILL6 in apples showed a significant reduction in salt tolerance after salt treatment.

[0006] The present invention is realized as follows. A gene MdILL6 for regulating apple salt stress has a nucleotide sequence as shown in SEQ.ID.NO.1.

[0007] Furthermore, for the gene MdILL6 for regulating apple salt stress, its amino acid sequence is as shown in SEQ.ID.NO.4.

[0008] Another object of the present invention is to provide a recombinant expression vector, which contains the gene MdILL6 for regulating apple salt stress.

[0009] Furthermore, a 1464bp fragment including the coding region of the MdILL6 gene is inserted into the expression vector pC2300; using Snapgene software, the restriction enzyme sites of the MdILL6 gene are analyzed, the plasmid DNA of the preserved pMD18-T-MdILL6 is subjected to a restriction enzyme reaction, and then ligated to the pC2300 vector to construct the correct recombinant pC2300-MdILL6.

[0010] Another object of the present invention is to provide the application of the gene MdILL6 for regulating apple salt stress or the recombinant expression vector in regulating apple salt stress.

[0011] Furthermore, after overexpressing MdILL6 in apples, the salt tolerance of the plants is significantly reduced.

[0012] Furthermore, after overexpressing MdILL6, the height of the transgenic plants is significantly reduced.

[0013] Another object of the present invention is to provide a method for obtaining plants for regulating salt stress, including:

[0014] Total RNA is extracted from the leaves of 'Yanfu 6', reverse transcribed to obtain cDNA, the conserved amino acid sequence of the AtILL6 gene in Arabidopsis thaliana found according to NCBI is used for homologous sequence alignment to obtain the nucleotide sequence of the MdILL6 gene in apples, and primers are designed for conventional polymerase chain reaction (PCR).

[0015] Using the transgenic technology based on the principle of driving by a strong promoter (cauliflower mosaic virus 35S promoter), the overexpression vector of the MdILL6 gene is transferred into apple 'GL3' to obtain transgenic plants.

[0016] Furthermore, the primers include:

[0017] MdILL6-F: 5’ATGAATTTTAATCAAACCAAAACA3’

[0018] MdILL6-R: 5’AAATAACCCGTCTGTGGTC 3’。

[0019] Combined with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0020] First, the present invention for the first time isolated and identified a gene MdILL6 that regulates plant salt stress from apples. Experiments found that overexpression of MdILL6 in apples showed that the salt tolerance of the plants was lower than that of the wild type. The above evidence indicates the important role of this gene in regulating plant salt stress.

[0021] The MdILL6 of the present invention can directly promote the contents of hydrogen peroxide and MDA and the relative conductivity of plants, inhibit the contents of POD, SOD, CAT, proline and total chlorophyll, and thus regulate the resistance of plants. It can be applied to the analysis of the salt stress mechanism of fruit trees and the improvement of salt-tolerant varieties. The MdILL6 of apples can regulate the response of plants under salt stress, play a key co-regulatory role in the salt tolerance of fruit trees, and provide new insights into the salt tolerance mechanism of apple plants.

[0022] The present invention uses the transgenic technology based on the principle of driving by a strong promoter (cauliflower mosaic virus 35S promoter) to transfer the overexpression vector of the MdILL6 gene into apples, thereby obtaining transgenic plants. The MdILL6-overexpressing apples showed a phenotype in which the plant height and the average internode length were inhibited. This shows that MdILL6 plays an important role in the regulation of plant salt stress.

[0023] Second,

[0024] The present invention finally clarifies that MdILL6 affects the salt tolerance of plants by affecting the accumulation of hydrogen peroxide and physiological indexes under related stress. Based on the above molecular mechanism, it is beneficial to carry out research on the molecular mechanism of salt tolerance traits in apples. It is not only beneficial to explain the problem of plant salt stress regulation, but also can explore the regulatory network of plants under salt stress through molecular biology techniques, thereby providing theoretical guidance for the development and cultivation of salt-tolerant apple varieties.

[0025] The present invention for the first time isolated and identified an ILL family member MdILL6 from apples. This gene plays an important role in regulating plant salt stress; the MdILL6 of the present invention can directly regulate the salt tolerance of plants, and can be applied to the improvement of salt-tolerant varieties and the analysis of the internal molecular mechanism of salt stress; the present invention uses the transgenic technology based on the principle of driving by a strong promoter (cauliflower mosaic virus 35S promoter) to transfer the overexpression vector of the MdILL6 gene into apples, and the transgenic apples with overexpression of MdILL6 showed a phenotype with significantly reduced plant salt tolerance.

[0026] Technical problems to be solved: The problem of controlling the salt tolerance of apples: Soil salinity is a critical abiotic stress that severely limits plant growth and development. Elucidating the molecular mechanism of apple salt resistance in this invention will greatly promote the breeding and cultivation of salt-tolerant varieties and effectively regulate the physiological responses of apples under salt stress. Efficiency and stability of genetic transformation: The problems of poor genetic stability and low expression efficiency in traditional genetic engineering methods. The method used in this invention can effectively ensure the stable expression of genes in target plants, thereby achieving long-lasting biological effects.

[0027] Technological progress:

[0028] 1) Improved the efficiency of cultivating salt-resistant varieties: By analyzing the salt tolerance mechanism, it has greatly promoted the efficiency of gene editing breeding and significantly improved the theoretical basis for cultivating salt-tolerant varieties.

[0029] 2) Improved the quality and yield of fruit tree fruits: The improvement of the salt tolerance of fruit trees promotes the increase in the photosynthesis efficiency of fruit trees, affects the yield and quality of fruit trees, and thus significantly enhances the commercial value of fruit trees.

[0030] 3) Expanded the cultivation areas of apples: The application of salt-tolerant varieties has greatly improved the cultivation area of apples, enhanced the cultivation scope of apples, can improve the application efficiency of saline-alkali land, increase the land utilization rate, and indirectly increase the yield of fruit trees.

[0031] These advantages not only greatly improve the salt tolerance of plants but also contribute to environmental protection and the sustainable development of agriculture. Description of the drawings

[0032] Figure 1 It is the cloning of the MdILL6 gene provided by the embodiment of this invention.

[0033] Figure 2 It is the expression level of MdILL6 provided by the embodiment of this invention under NaCl conditions.

[0034] Figure 3 It is the detection of transgenic materials at the DNA and transcriptional levels provided by the embodiment of this invention.

[0035] Figure 4 It is the growth status diagram of MdILL6 transgenic apples under NaCl treatment provided by the embodiment of this invention.

[0036] Figure 5 It is the DAB and NBT staining of MdILL6 transgenic apples under NaCl treatment provided by the embodiment of this invention.

[0037] Figure 6It is the contents of H2O2, MDA, relative conductivity, POD, SOD, CAT, proline and total chlorophyll of the MdILL6 transgenic apple provided by the embodiment of the present invention under NaCl treatment. Detailed implementation manners

[0038] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0039] The embodiment of the present invention provides a gene MdILL6 for regulating apple salt stress, isolates and clones a DNA fragment of the complete coding region of MdILL6 from apples, and names it MdILL6. Its nucleotide sequence is as shown in SEQ.ID.NO.1.

[0040] The embodiment of the present invention provides a recombinant expression vector, which contains the gene MdILL6 for regulating apple salt stress.

[0041] The embodiment of the present invention provides the application of the gene MdILL6 for regulating apple salt stress or the recombinant expression vector in regulating apple salt stress.

[0042] Furthermore, after overexpressing MdILL6 in apples, the salt tolerance of the plants decreases.

[0043] Furthermore, after overexpressing MdILL6, the height of the transgenic plants is significantly reduced, indicating that the MdILL6 gene plays an important role in regulating salt stress.

[0044] The embodiment of the present invention provides a method for obtaining transgenic plants for regulating apple salt stress, including:

[0045] Extract total RNA from the leaves of 'Yanfu 6', reverse transcribe to obtain cDNA, obtain the nucleotide sequence of the MdILL6 gene in apples according to the conserved amino acid sequence of the AtILL6 gene in Arabidopsis found in NCBI and perform a homologous sequence alignment, and design primers for conventional polymerase chain reaction (Polymerase Chain Reaction, PCR).

[0046] Using the transgenic technology based on the principle of driving by a strong promoter (cauliflower mosaic virus 35S promoter), transfer the overexpression vector of the MdILL6 gene into apple 'GL3' to obtain transgenic plants.

[0047] The embodiment of the present invention provides a method for identifying and isolating a gene MdILL6 for regulating salt stress from apples, specifically including the following steps:

[0048] 1. Extraction of RNA from the leaves of ‘Yanfu No. 6’. The total RNA of the leaves of ‘Golden Delicious’ was extracted using the CTAB method, which mainly included the following steps:

[0049] 1) Take 1 g of the leaves of the one-year-old seedlings of ‘Yanfu No. 6’ 60 days after germination, grind them with liquid nitrogen, and transfer them to a pre-cooled 2 ml centrifuge tube.

[0050] 2) Quickly add 900 μL of extraction buffer (CTAB 2% w / v, PVP 2% w / v, Tris-HCl 100 mmol / L, EDTA 25 mmol / L, NaCl 2.0 mol / L, spermidine 0.5 g / L, mercaptoethanol 2% w / v, made up to volume with RNase-free double-distilled water), vortex and mix well, and incubate in a water bath at 65 °C for 3 minutes.

[0051] 3) Add an equal volume of nucleic acid extraction solution (chloroform:isoamyl alcohol = 24:1) as in the previous step, vortex and mix well.

[0052] 4) Centrifuge the sample in the above centrifuge tube at 4 °C and 10000 rpm for 10 minutes.

[0053] 5) Carefully aspirate the supernatant into a new centrifuge tube, repeat adding the nucleic acid extraction solution (chloroform:isoamyl alcohol = 24:1), and perform repeated extraction on the supernatant.

[0054] 6) Centrifuge the sample in the centrifuge tube at 4 °C and 10000 rpm for 10 minutes.

[0055] 7) Transfer the obtained supernatant into a new centrifuge tube, add 1 / 5 volume of 12 mol / L LiCl, and place it in a refrigerator at 4 °C overnight.

[0056] 8) Centrifuge the sample that has been standing overnight at 4 °C and 10000 rpm for 20 minutes, pour out the supernatant, and invert the centrifuge tube on a paper towel to remove the excess solution.

[0057] 9) Add 500 mL of SSTE (NaCl 1 mol / L, SDS 0.5%, Tris-HCl 10 mmol / L, EDTA 1 mmol / L) to the centrifuge tube, repeatedly pipette to dissolve the precipitate, and then add 500 μL of nucleic acid extraction solution (chloroform:isoamyl alcohol = 24:1) to each tube and vortex and mix well.

[0058] 10) Centrifuge the sample in the previous step at 4 °C and 10000 rpm for 10 minutes.

[0059] 11) Precipitate the supernatant into a new centrifuge tube, add 2 volumes of pre-cooled (-20 °C pre-cooled) absolute ethanol, invert and mix well, and place it at -80 °C for more than 30 minutes.

[0060] 12) Centrifuge the sample from the previous step at 4°C and 10,000 rpm for 20 minutes, and pour off the supernatant.

[0061] 13) Air-dry the precipitate in the fume hood (for about 5 - 10 minutes).

[0062] 14) Add approximately 80 μL of DEPC water to each tube to dissolve the RNA.

[0063] 2. Reverse transcribe the total RNA to obtain cDNA

[0064] Use a commercially available reverse transcription kit for reverse transcription of the total RNA to obtain the reverse-transcribed cDNA.

[0065] 3. Amplification of the full-length sequence of MdILL6

[0066] Design primers (MdILL6-F / MdILL6-R) and perform PCR amplification using the above reverse-transcribed cDNA as a template.

[0067] MdILL6-F: 5’ATGAATTTTAATCAAACCAAAACA3’ (SEQ.ID.NO.2)

[0068] MdILL6-R: 5’AAATAACCCGTCTGTGGTC 3’ (SEQ.ID.NO.3)

[0069] PCR amplification system: The total volume is 50 μL, including 1 μL of cDNA template, 1 μL of each cloning primer, 25 μL of Prime STARMax Premix (2×), and 22 μL of ddH2O.

[0070] PCR amplification program: Pre-denature at 95°C for 2 minutes; the cycling parameters are denaturation at 95°C for 2 minutes, annealing at 56°C for 30 seconds, extension at 72°C for 1 minute, for 35 cycles; fully extend at 72°C for 10 minutes.

[0071] After the PCR reaction is completed, recover the PCR product. The fragment size is approximately 1464 bp. Ligate the recovered product to the pMD-18T vector to obtain the pMD-18T-MdILL6 plasmid. Sequence it (Sangon Biotech Co., Ltd.). The results show that the nucleotide sequence of the MdILL6 gene is as shown in SEQ.ID.NO.1; its amino acid sequence is as shown in SEQ.ID.NO.4. For the correctly sequenced monoclonal, extract the plasmid DNA of pMD18-T-MdILL6 by the alkaline method and store it at -20°C for subsequent functional verification experiments.

[0072] SEQ.ID.NO.1:

[0073]

[0074] MNFNQTKTKLIYTNSILIISIFVLGSIISPAETTPSGDHSHPFFELDDCCPSCKASPEARKNLSLQALTSPPTSPPSSPPQSCEVWTEACSVAVLSLAKRPENVEWLKTVRRRIHEHPELAFEEFETSRLVRDELDRLDIGYRYPLAKTGIRAWIGTGGPPFVAVRADMDALPIQEAVEWEHKSKVAGKMHACGHDAHVTMLIGAAKILKNREHLLKGTVILLFQPAEEAGNGAKQMIGDDALEDVEAIFAAHVSHEHPTGVIGSRPGPLLAGCGFFRAVISGTTGSTDPVLAAATAVISLQGIVSRESNPLDSQVVSVTAFNGGDDLGMIPNTVVLGGTFRAFSNTNFYRILQRIEEVIVEQASVYRCSATVDFFENQNTIYPPTVNDEKMHEHVSKVAIDLLGPTNFRVVPPMMGAEDFSFYSEVIPAGFFYIGIRNETLGSTHTGHSPYFFIDEDVLPIGAATHATIAERYLNERSRVTTDGLF

[0075] 4. Construction of the MdILL6 gene vector: A 1464-bp fragment containing the coding region of the MdILL6 gene was inserted into the expression vector pC2300. Using Snapgene software, the restriction enzyme sites of the MdILL6 gene were analyzed. The plasmid DNA of pMD18-T-MdILL6 stored was subjected to a restriction enzyme reaction and ligated to the pC2300 vector to construct the correct recombinant pC2300-MdILL6. The constructed recombinant pC2300-MdILL6 was used to transform the competent cells of Agrobacterium tumefaciens EHA105, and positive colonies were picked for PCR identification. The monoclonal of the recombinant pC2300-MdILL6 with correct PCR was used for the subsequent transformation of apples.

[0076] 5. Obtaining transgenic apples:

[0077] 1) Prepare wild-type 'GL3' leaves for infection. Subculture wild-type 'GL3' every 3 - 4 weeks in solid MS basal medium supplemented with 0.2 mg / L 6-BA and 0.2 mg / L IBA, and culture it at 21°C under the conditions of 16-hour light and 8-hour darkness.

[0078] 2) Pick a single colony of Agrobacterium and inoculate it into 1 mL of YEP liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin. Incubate at 28°C with shaking at 200 rpm until the OD600 reaches 0.6 - 0.8. Take 500 μL of the bacterial solution and add it to 50 mL of YEP liquid medium (containing 50 mg / L kanamycin, 50 mg / L rifampicin, and 100 μmol / L acetosyringone). Incubate at 28°C with shaking at 200 rpm until the OD600 reaches 0.6 - 0.8, which takes about 5 hours. Then centrifuge to collect the bacterial cells and suspend them in an infection solution containing 20 g / L sucrose and 0.03 - 0.05% SiIweet for later use.

[0079] 3) Obtain transgenic apple plants using the Agrobacterium-mediated transformation system and perform apple transformation by the leaf disc method. Take newly expanded leaves of 'GL3'. Place the detached leaves into the bacterial solution and make 3 - 4 transverse cuts across the leaf veins with a scalpel in the bacterial solution. Immerse the cut leaves in the bacterial solution for 8 - 10 minutes. After the immersion, place the leaves on sterilized filter paper to absorb the excess bacterial solution. Place the leaves on a co-culture medium without antibiotics (4.43 g / L MS, 30 g / L sucrose, 8 g / L agar powder, 2 mg / L thidiazuron, 0.5 mg / L naphthaleneacetic acid) to ensure full contact between the leaves and the medium. Co-culture in the dark at 21°C in an incubator for three days. After three days, wash the bacteria with cephalosporin solution (500 mg / L) and transfer them to a differentiation medium (4.43 g / L MS, 30 g / L sucrose, 8 g / L agar powder, 2 mg / L thidiazuron, 0.5 mg / L naphthaleneacetic acid, 250 mg / L cephalosporin, 50 mg / L kanamycin) until shoots grow. Take the adventitious apple buds differentiated from the leaves, extract DNA and RNA for identification respectively, and transfer the identified apple seedlings to a rooting medium for propagation for subsequent experiments.

[0080] 6. Salt treatment of transgenic materials. Grow wild-type plants 'GL3' and transgenic apple materials on an MS medium containing 0.2 mg / L 6 - BA and 0.2 mg / L IBA under long-day conditions, and then transfer them to an MS medium containing 1 mg / L IBA for rooting. After rooting, transfer the genotype plants to an MS medium supplemented with 200 mM / L NaCl. After 15 days of treatment, measure the physiological indices and collect the leaves for further analysis.

[0081] As described above, this is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A gene MdILL6 for regulating apple salt stress, characterized in that, Its nucleotide sequence is shown in SEQ.ID.NO.

1.

2. The gene MdILL6 for regulating apple salt stress according to claim 1, wherein Its amino acid sequence is shown in SEQ.ID.NO.

4.

3. A recombinant expression vector, characterized in that, It contains the gene MdILL6 that regulates apple salt stress described in claim 1.

4. The recombinant expression vector according to claim 3, characterized in that, Insert the 1464bp fragment including the coding region of the MdILL6 gene into the expression vector pC2300; use Snapgene software to analyze the restriction enzyme sites of the MdILL6 gene, perform a restriction enzyme reaction on the plasmid DNA of the preserved pMD18-T-MdILL6, and ligate it to the pC2300 vector to construct the correct recombinant pC2300-MdILL6.

5. The application of the gene MdILL6 that regulates apple salt stress described in claim 1 or the recombinant expression vector described in claim 3 in regulating apple salt stress.

6. The application according to claim 5, characterized in that, After overexpressing MdILL6 in apples, the salt tolerance of the plants is significantly reduced.

7. The application according to claim 5, characterized in that After overexpressing MdILL6, the height of the transgenic plants is significantly reduced.

8. A method for obtaining a plant that regulates salt stress, characterized in that, Including: Extract total RNA from the leaves of 'Yanfu 6', reverse transcribe to obtain cDNA, obtain the nucleotide sequence of the MdILL6 gene in apples by performing a homologous sequence alignment based on the conserved amino acid sequence of the AtILL6 gene in Arabidopsis found in NCBI, and design primers for conventional polymerase chain reaction; Using the transgenic technology based on the principle of strong promoter drive, transfer the overexpression vector of the gene MdILL6 described in claim 1 into apple 'GL3' to obtain transgenic plants.

9. The method for obtaining a plant for regulating salt stress according to claim 8, characterized in that, The primers include: MdILL6-F: 5’ATGAATTTTAATCAAACCAAAACA3’ MdILL6-R: 5’AAATAACCCGTCTGTGGTC 3’ 10. The method for obtaining a plant for regulating salt stress according to claim 8, characterized in that, The promoter is the cauliflower mosaic virus 35S promoter.

Images