Improved pichia pastoris gene editing single plasmid and method for improving gene editing efficiency of pichia pastoris

Abstract

The present application relates to the field of agricultural biotechnology, and in particular to an improved Pichia pastoris gene editing single plasmid and a method for improving Pichia pastoris gene editing efficiency thereof.According to the technical scheme of the present application, the polycistronic strategy is beneficial to reducing the size of the plasmid, thereby improving the transformation efficiency; by adjusting zeocin and rad52 the order, the expression amount of Rad52 is increased during gene editing to improve the homologous recombination efficiency, and the Rad52 plasmid form is expressed in Pichia pastoris. During gene editing, the plasmid is introduced into Pichia pastoris cells for expression, promotes the proteins of gene editing and homologous recombination, and improves the gene editing efficiency; after the gene editing is completed, the plasmid is eliminated, the expression level of Rad52 returns to the normal level to maintain the stability of the cells, thereby maintaining the stability of the cell performance.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural biotechnology, and in particular to an improved Pichia pastoris gene editing single plasmid and a method for improving Pichia pastoris gene editing efficiency. BACKGROUND

[0002] CN116286941A discloses a Pichia pastoris gene editing method based on the CRISPR / Cas12a system, which significantly improves the single gene editing efficiency of Pichia pastoris to 70%, and accelerates the modification process of Pichia pastoris. Using a single plasmid or multiple plasmids for simultaneous editing of multiple genes is an effective strategy to further improve the strain modification process, but the editing efficiency of each gene needs to be very high (close to 100%). Obviously, it is urgent to improve the gene editing efficiency of Pichia pastoris.

[0003] Compared with traditional model organisms such as Saccharomyces cerevisiae, the key protein Rad52 of homologous recombination in Pichia pastoris has lower activity, which leads to more dependence on non-homologous end joining (NHEJ) than homologous recombination (HR) for double-strand break (DSB) repair. Therefore, when performing precise gene editing on Pichia pastoris, the expression level of Rad52 in the cell can be increased to improve the efficiency of homologous recombination, and thus the precision and efficiency of gene editing. Cai et al. found that the plasmid containing the expression unit failed to screen the transformants when transforming Pichia pastoris cells, which may be due to the existence of multiple copies of the plasmid in the cells, resulting in a high content of Rad52 in the cells and toxicity to the cells. Although the expression unit is integrated into the chromosome, the recombination efficiency can be improved (Nucleic Acids Research, 2021, 49: 7791-7805), however, in normal Pichia pastoris cells, the expression level of Rad52 is precisely regulated; the artificially designed expression unit is integrated into the chromosome, which may increase the content of Rad52 in the cell, and may trigger homologous recombination between genes with similar sequences on the chromosome, resulting in unstable cell performance. RAD52 RAD52 The expression unit is integrated into the chromosome, which can improve the recombination efficiency (Nucleic Acids Research, 2021, 49: 7791-7805), however, in normal Pichia pastoris cells, the expression level of Rad52 is precisely regulated; the artificially designed expression unit is integrated into the chromosome, which may increase the content of Rad52 in the cell, and may trigger homologous recombination between genes with similar sequences on the chromosome, resulting in unstable cell performance. RAD52 The expression unit is integrated into the chromosome, which can improve the recombination efficiency (Nucleic Acids Research, 2021, 49: 7791-7805), however, in normal Pichia pastoris cells, the expression level of Rad52 is precisely regulated; the artificially designed expression unit is integrated into the chromosome, which may increase the content of Rad52 in the cell, and may trigger homologous recombination between genes with similar sequences on the chromosome, resulting in unstable cell performance. SUMMARY

[0004] The purpose of the present application is to provide an improved Pichia pastoris gene editing single plasmid.

[0005] Another purpose of the present application is to provide a method for improving the gene editing efficiency of Pichia pastoris.

[0006] ​The improved Pichia pastoris gene-editing single plasmid according to the present invention comprises, from the transcriptional replication origin to downstream: an autonomously replicating sequence stably inherited in Pichia pastoris cells, a promoter for initiating crRNA and gRNA transcription, and a polycistronic element, wherein the polycistronic element includes a promoter for initiating polycistronic expression and a gene encoding the restriction enzyme Cas12a. cas12a Resistance markers for positive selection of transformants, and the gene encoding Rad52. rad52, Terminator, wherein the endonuclease Cas12a encoding gene cas12a, The resistance marker for the positive selection of the transformants 、 The coding gene of Rad52 rad52 They are linked via a 2A peptide-encoding gene, wherein the endonuclease Cas12a-encoding gene... cas12a The nucleotide sequence of the gene encoding the 2A peptide, which is associated with the resistance marker for forward selection of the transformants, is shown in SEQ ID NO:1. The resistance marker for forward selection of the transformants is associated with the gene encoding Rad52. rad52 The nucleotide sequence of the gene encoding the 2A peptide is shown in SEQ ID NO:2, which is the gene encoding Rad52. rad52 The nucleotide sequence is shown in SEQ ID NO:3.

[0007] cas12a and zeocin The gene encoding the interstitial 2A peptide is SEQ ID NO:1.

[0008] SEQ ID NO:1:

[0009] GAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCA.

[0010] zeocin and rad52 The gene encoding the interstitial 2A peptide is SEQ ID NO:2.

[0011] SEQ ID NO:2:

[0012] GCTACAAACTTCTCCTTGCTGAAGCAAGCAGGAGATGTAGAGGAGAATCCAGGACCC.

[0013] The sequence of rad52 is shown in SEQ ID NO:3.

[0014] SEQ ID NO:3:

[0015]

[0016] According to the improved Pichia pastoris gene editing single plasmid of the present application, the resistance marker for forward screening of the transformant is a resistance gene to the antibiotic Zeocin zeocin.

[0017] According to the improved Pichia pastoris gene editing single plasmid of the present application, the endonuclease Cas12a coding gene cas12a is optimized according to the Pichia pastoris codon bias Francisella novicida The Cas12a coding gene cas12a, has a nucleotide sequence as shown in SEQ ID NO: 4.

[0018] cas12a.

[0019] SEQ ID NO: 4:

[0020]

[0021] The plasmid according to the specific embodiment of the present application comprises different functional elements for realizing high-efficiency editing of Pichia pastoris genes: an autonomous replication sequence ARS which can be stably inherited in Pichia pastoris cells, an endonuclease Cas12a coding gene cas12a , a gene for presenting antibiotic Zeocin resistance of transformants zeocin , a Rad52 coding gene of a protein for improving homologous recombination efficiency rad52 , cas12a, zeocin, rad52 The multi-cistronic structure is constructed by connecting the genes through a 2A peptide coding gene, and the expression of the three genes is regulated by a promoter P GAP and a terminator T cyc1 .

[0022] The method for improving gene editing efficiency of Pichia pastoris according to the present application comprises the following steps:

[0023] Amplifying left and right homologous sequences of a target gene to be edited;

[0024] Fusing the left and right homologous sequences of the target gene to be edited with the above-mentioned single plasmid for Pichia pastoris gene editing;

[0025] Transferring the fused plasmid into Pichia pastoris, and performing transformant screening on a culture medium with sorbitol and rhamnose as carbon sources to obtain positive transformants.

[0026] The method for improving gene editing efficiency of Pichia pastoris according to the present application, wherein the formula of the culture medium with sorbitol and rhamnose as carbon sources is: yeast powder 5 g / L, peptone 10 g / L, rhamnose 20 g / L; or yeast powder 5 g / L, peptone 10 g / L, sorbitol 20 g / L.

[0027] beneficial technical effects

[0028] According to the technical solution of the present application, the multi-cistronic strategy is conducive to reducing the size of the plasmid and further improving the transformation efficiency; by adjusting zeocin and rad52 the order, the expression amount of Rad52 is increased during gene editing to improve the homologous recombination efficiency, and the Rad52 plasmid form is realized to express in Pichia pastoris. When gene editing is performed, the plasmid is introduced into Pichia pastoris cells to express the proteins for promoting gene editing and homologous recombination, and the gene editing efficiency is improved; after the gene editing is completed, the plasmid is eliminated, and the expression level of Rad52 returns to the normal level to maintain the stability of the cells, so that the performance stability of the cells is maintained.

[0029] In summary, this invention integrates gene editing and homologous recombination-related elements into a plasmid. Through plasmid introduction and elimination, it achieves dynamic expression of gene editing elements (Cas12a, crRNA, gRNA) and the homologous recombination-promoting element Rad52, improving the precision and efficiency of gene editing while maintaining the stability of the strain's genetic makeup and performance. Furthermore, through culture medium optimization, using SYPR medium with rhamnose as the carbon source, highly efficient editing of the target gene was achieved. Attached Figure Description

[0030] Figure 1 Schematic diagram of plasmid pPICC06;

[0031] Figure 2 Schematic diagram of plasmid pPICC07;

[0032] Figure 3 The transformation results of different plasmids are shown, where A: plasmid pPICC07, B: plasmid pPICC06;

[0033] Figure 4 Displaying different transformations his4 and yps1 Knockout strain validation, where A: strains screened on YPD medium. his4 Knockout transformant, B: Selected on YPD medium yps1 Knockout transformants, selected on C: SYPD medium his4 Knockout transformants, D: selected on SYPD medium yps1 Knockout transformants, M: DNA Marker, 1-6: transformants, 7: originating strain;

[0034] Figure 5 This demonstrates the validation of gene knockout in transformants screened on different culture media. Detailed Implementation

[0035] The strains and culture media used in the following examples:

[0036] Pichia pastoris GS115 ( Pichia pastoris GS115);

[0037] YPD medium (g / L): yeast extract 10, peptone 20, glucose 20;

[0038] YPR medium (g / L): yeast extract 10, peptone 20, rhamnose 20;

[0039] YPS medium (g / L): yeast extract 10, peptone 20, sorbitol 20;

[0040] The amounts of yeast extract and peptone in the SYPD, SYPR, and SYPS culture media were 50% of those in the YPD, YPR, and YPS culture media, respectively.

[0041] The concentration of the antibiotic Zeocin in the culture medium during transformation was 100 μg / L, and the corresponding culture media were YPDZ, YPZR, YPSZ, SYPDZ, SYPRZ and SYPSZ, respectively.

[0042] Example 1: Construction of gene editing plasmid pPICC06

[0043] 1.1 cas12a , zeocin and rad52 Polycistronic construction

[0044] Optimization of sources based on Pichia pastoris codon preference Francisella novicida The Cas12a encoding gene cas12a The optimization included adding the coding sequence for the nuclear localization signal at 5' and adding the coding sequence for the nuclear localization signal and the T2A peptide at 3'.

[0045] The antibiotic resistance gene for Zeocin was amplified from plasmid pGAPzA using primers zeo-F and zeo-R. zeocin, zeocin The T7 promoter was added at 5' and the coding sequence for the P2A peptide was added at 3'.

[0046] zeo-F: 5'-GGTAATACGACTCACTATAGGAAGGAGAGGAACACCATGGCCAAGTTGACCAGTGC-5' (SEQ ID NO: 5);

[0047] zeo-R5'-GGGTCCTGGATTCTCCTCTACATCTCCTGCTTGCTTCAGCAAGGAGAAGTTTGTAGCGCCAGAACCGTCCTGCTCCTCGGCCAC-3' (SEQ ID NO: 6).

[0048] The Rad52 coding gene was amplified from the Pichia pastoris genome using primers rad52-F: 5'-ATGTCTTTCGATGACGCTGAGC-3' (SEQ ID NO:7) and rad52-R: 5'-TCAATTCGAAGCTGGAGAGTTTT-3' (SEQ ID NO:8). rad52 .

[0049] Amplification of the promoter P of the glyceraldehyde-3-phosphate dehydrogenase gene from the Pichia pastoris chromosome. GAPand the terminator T of the cytochrome C1 gene amplified from the chromosome of Saccharomyces cerevisiae cyc1 .

[0050] The above DNA fragment P was obtained by overlap-PCR. GAP , cas12a , zeocin , rad52 and T cyc1 To perform fusion, thereby obtaining the product generated by promoter P GAP and Termination T cyc1 Regulation cas12a , zeocin and rad52 The expressed polycistronic DNA fragment 1. The proteins encoded by the elements in DNA fragment 1 are responsible for chromosome cutting, transformant selection, and homologous recombination during gene editing.

[0051] 1.2 Cloning and Assembly of Other Functional Components

[0052] Using plasmid pET28a as a template and ori-F: 5'-ATCAGCACTGCGATCGCAACATGTGAGCAAAAGGCCAG-3' (SEQ ID NO:9) and ori-R: 5'-GGCGCGCCATGACCAAAATC-3' (SEQ ID NO:10) as primers, PCR amplification was performed to obtain the DNA fragment ori that replicates in E. coli. The autonomously replicable DNA sequence panARS in Pichia pastoris was synthesized (Liachko et al., 2014, FEMS Yeast Res., 14: 364–367). The promoter P for crDNA and gDNA transcription was amplified from the Pichia pastoris chromosome using primers Pser-F: 5'-AAGTATCACAGTTGGATTAATTAGATATGA-3' (SEQ ID NO:11) and Pser-R: 5'-AAGACATTTCTACAAAAAGTTTAAACGCGTCACAGACAGGATTCGAA-3' (SEQ ID NO:12). ser The DNA fragments ori and p were analyzed using overlap-PCR. ser Fusing with panARS yields DNA fragment 2. The proteins encoded by the elements in DNA fragment 2 enable extrachromosomal replication of plasmid pPICC06 and plasmids derived from pPICC06 in *E. coli* and *Pichia pastoris* cells (ori and panARS), as well as crDNA and gDNA transcription (P...). ser ).

[0053] 1.3 Plasmid Construction

[0054] DNA fragments 1 and 2 are assembled by applying seamless cloning to obtain a shuttle plasmid pPICC06 that can replicate in E. coli and Pichia pastoris Figure 1 The promoter P ser The transcription of crDNA and gDNA that guides Cas12a to cut the specified site of the chromosome is initiated by the promoter P GAP For regulating the expression of each gene in the polycistron, cas12a The encoded protein can cut the specific site on the chromosome guided by gRNA, and the resistance gene zeocin For screening of E. coli and Pichia pastoris transformants, rad52 The encoded protein can improve the efficiency of homologous recombination, and the replication element ori and panARS can realize the replication of the plasmid in E. coli and Pichia pastoris.

[0055] The polycistron strategy is used to realize cas12a , zeocin and rad52 share a promoter and a terminator, and the size of the plasmid pPICC06 is ~ 8.2 kb after adding the new functional element rad52 (~ 1.2 kb), which is ~ 1.3 kb smaller than the prior art disclosed Pichia pastoris gene editing single plasmid pPICC02, which is more conducive to subsequent plasmid construction and improves the transformation efficiency of Pichia pastoris.

[0056] When constructing a gene editing plasmid, only the cDNA, gDNA and homologous arms of the gene to be edited need to be introduced between P ser and P GAP .

[0057] Example 2: Construction of gene editing plasmid pPICC07

[0058] According to the literature reports, the improvement of homologous efficiency in Pichia pastoris requires the regulation of appropriate expression of Rad52, and the expression level is crucial. When the expression level is low, the recombination efficiency is low, and when the expression level is too high, it will be toxic to the host.

[0059] In the present application, 2A is used as a connecting peptide, and the expression level of the protein downstream of 2A will gradually decrease with the increase of the number of 2A. In the plasmid pPICC06 rad52 located after the second 2A peptide tag, the expression level of Rad52 will be lower than that of the first two proteins in the polycistron. In order to improve the expression level of Rad52, the positions of rad52 and zeocin are replaced to improve the expression level of Rad52, and the plasmid pPICC07 is constructed Figure 2 .

[0060] In plasmids pPICC06 and pPICC07 rad52 and zeocin The two plasmids, located at different positions within the polycistronic molecule, result in different Rad52 expression levels after being introduced into Pichia pastoris cells. Specifically, the Rad52 expression level in Pichia pastoris cells containing plasmid pPICC06 is lower than that in strains containing plasmid pPICC07, and Pichia pastoris cells also exhibit different phenotypes due to differences in Rad52 content.

[0061] Experimental results showed that plasmid pPICC07 produced very few colonies when transformed into Pichia pastoris, and the colonies were very small; plasmid pPICC06 produced more colonies when transformed into Pichia pastoris, and the colony morphology was normal. Figure 3 The reason for this is speculated to be that the high level of Rad52 in Pichia pastoris cells containing plasmid pPICC07 has a significant negative impact on the cells.

[0062] his4 and yps1

[0063] 3.1 his4 and yps1 Construction of knockout plasmids

[0064] To test the gene editing efficiency of plasmid pPICC06, a gene knockout plasmid based on pPICC06 was constructed.

[0065] Genes knocked out of Pichia pastoris chromosomes were amplified using primers his4-LF and his4-LR. his4 The left homologous sequence was amplified using primers his4-RF and his4-RR to knock out the gene on the Pichia pastoris chromosome. his4 The right homologous sequence. After fusing the left and right homologous sequences using overlap-PCR, the fused DNA fragment was cloned into an endonuclease-modified DNA fragment using seamless cloning. Pme The plasmid pPICC06 was treated with I to construct a system for knocking out... his4 The plasmid pPICC06 / his4.

[0066] his4-LF: 5'-ATCCTGTCTGTGACGC GAATTTCTACTGTTGTAGAT CCAGAGGAACTTATGCAATT G TTTTTTTGTTTTTTATGTCTGCCACAGTTCAGCAGAAAG-3' (SEQ ID NO:13) (The underlined part of the primer is the crDNA sequence and the italic part is the gDNA sequence);

[0067] his4-LR: 5'-CAGAATTGCAGTTTAAACTGTTGAAGTTAATGACTTGAAGTCGGACAGTGAG -3' (SEQ ID NO: 14);

[0068] his4-RF: 5'- TTCAACAGTTTAAACTGCAATTCTGGCACGATTCGATAGATCTAACCGGCA -3' (SEQ ID NO: 15);

[0069] his4-RR: 5'- CCAAGACATTTCTACAAAAAAGACTCGAGAACTTCCGTGC -3' (SEQ ID NO: 16).

[0070] The left homology sequence of the gene yps1 on the chromosome of Pichia pastoris was amplified by primers ypsl-LF and ypsl-LR, and the right homology sequence of the gene yps1 on the chromosome of Pichia pastoris was amplified by primers ypsl-RF and ypsl-RR. The left homology sequence and the right homology sequence were fused by Overlap-PCR, and the fused DNA fragment was cloned into the plasmid pPICC06 treated by endonuclease Pme I, thereby constructing the plasmid pPICC06 / yps 1 for knocking out yps1 the gene ypsl.

[0071] yps1-LF: 5'-ATCCTGTCTGTGACGC GAATTTCTACTGTTGTAGAT CAAGGGAGATTTGCTGCATT A TTTTTTTGTTTTTTATGTCTTGATGTGCTAGACTGCCTGA-3' (SEQ ID NO: 17) (the underlined part in the primer is a crDNA sequence and the italic part is a gDNA sequence);

[0072] yps1-LR: 5'- CAGAATTGCAGTTTAAACTGTTGAAGTTAATGATCTGGCTGAGCGGAAAGT-3' (SEQ ID NO: 18);

[0073] yps1-RF: 5'- TTCAACAGTTTAAACTGCAATTCTGGCACCTACATTGGATAGGCTTCAACA -3' (SEQ ID NO: 19);

[0074] yps1-RR: 5'- CCAAGACATTTCTACAAAAACCTGAGCGGGACTTTGAG-3' (SEQ ID NO: 20).

[0075] 3.2 his4 and yps1 knockout

[0076] The plasmids pPICC06 / his4 and pPICC06 / yps1 were introduced into Pichia pastoris GS115 competent cells, respectively. After incubation of the cells, they were spread on YPDZ medium containing 100 μg / mL Zeocin and cultured at 30 °C for 48-72 h. The primers his4-VF: 5'- CGACTCTGAAACATTACCAGGAAC-3' (SEQ ID NO: 21) and his4-VR: 5'- CCAGCAGTTCGGTCTTCTGTTC-3' (SEQ ID NO: 22) were used to verify by PCR whether the transformants were his4 knockout strains.

[0077] The primers Yps1-VF: 5'- AACCGATGAAACACCCAGAGA-3' (SEQ ID NO: 23) and yps1-VR: 5'- CTGTACTGGGTCAACCTGTTCTGA-3' (SEQ ID NO: 24) were used to verify by PCR whether the transformants were yps1 knockout strains.

[0078] The PCR product size of the starting strain was ~ 4.0 kb, his4 The PCR product size of the knockout strain was ~ 1.6 kb; the PCR product size of the starting strain was ~ 3.2 kb, yps1 The PCR product size of the knockout strain was ~ 1.3 kb. By PCR verification, the PCR products of most transformants screened by YPDZ appeared bands of the corresponding size of gene knockout ( Figure 4 Figs. A and B in the middle), but at the same time, the corresponding PCR product bands of the starting strain appeared ( Figure 4 Figs. C and D in the middle). The experimental results showed that the constructed gene editing plasmid had the function of gene editing and could achieve the gene editing of the target gene; on the other hand, the unedited band was also amplified during PCR, indicating the existence of unedited strains. From the above results, it can be inferred that the colonies formed on the screening medium were formed by both the gene edited and unedited strains.

[0079] The transformants were screened by different culture media (SYPDZ), and the gene editing was further determined. The experimental results showed that the gene editing of the strains was almost consistent with that screened by YPDZFigure 4 (Figures C and D in the middle).

[0080] 3.3 Culture medium optimization

[0081] The presence of both gene-edited and non-gene-edited strains in the colony suggests that the low expression level of the Cas12a restriction enzyme after the gene-editing plasmid was introduced into Pichia pastoris cells may have prevented effective chromosome cutting before cell division. Consequently, some daughter cells after division were gene-edited while others were not.

[0082] Using Pichia pastoris carbon sources (rhamnose and sorbitol), which have lower utilization efficiency than glucose, as the carbon source for the transformant screening medium, Pichia pastoris grew slowly in these carbon sources. Experimental results showed that when sorbitol and rhamnose were used as carbon sources for transformant screening, all randomly selected transformants exhibited gene knockout, and the intensity of the corresponding PCR bands without gene editing was significantly reduced. Figure 5 (See Figures A and C in the original text). Especially when screening transformants using media with a rhamnose or sorbitol concentration of 1% (SYPS and SYPR), the proportion of PCR bands showing only gene editing was significantly increased. Figure 5 (Figures B and D in the middle).

[0083] It is worth noting that SYPR and SYPS were used to screen transformants. yps1 The knockout efficiency was 100% and the transformants were single gene knockout strains. Figure 5 (D diagram in the image); screening transformants using SYPR and SYPS. his4 The knockout efficiency was also 100%, but unedited strains still existed. Figure 5 (See Figure B in the diagram), which is related to the gDNA used.

[0084] Overall, using rhamnose and sorbitol as carbon sources to screen transformants significantly increased the proportion of obtaining single gene-edited strains. Specifically, *Pichia pastoris* showed a higher growth rate with rhamnose as the carbon source than with sorbitol; therefore, rhamnose is the preferred carbon source, as it not only improves the screening efficiency of target strains but also shortens the experimental cycle.

Claims

1. An improved Pichia gene editing single plasmid, characterized in that, The Pichia pastoris gene editing single plasmid, from the transcriptional replication origin to downstream, comprises, in sequence: an autonomously replicating sequence stably inherited in Pichia pastoris cells, a promoter to initiate crRNA or gRNA transcription, and a polycistronic element, wherein the polycistronic element comprises, in sequence, a promoter to initiate polycistronic expression and a gene encoding the restriction enzyme Cas12a. cas12a Resistance markers for positive selection of transformants, and the gene encoding Rad52. rad52, Terminator, wherein the endonuclease Cas12a encoding gene cas12a, The resistance marker for the positive selection of the transformants 、 The coding gene of Rad52 rad52 They are linked by a 2A peptide-encoding gene, wherein the endonuclease Cas12a-encoding gene cas12a The nucleotide sequence of the gene encoding the 2A peptide, which is associated with the resistance marker for forward selection of the transformants, is shown in SEQ ID NO:

1. The resistance marker for forward selection of the transformants is associated with the gene encoding Rad52. rad52 The nucleotide sequence of the gene encoding the 2A peptide is shown in SEQ ID NO:2, which is the gene encoding Rad52. rad52 The nucleotide sequence is shown in SEQ ID NO:

3.

2. The improved Pichia gene editing single plasmid of claim 1, wherein, The resistance marker of the transformant forward screening is the resistance gene of the antibiotic Zeocin.

3. A method for improving gene editing efficiency of Pichia pastoris, characterized in that, The method comprises the following steps: amplifying the left and right homologous sequences of the target edited gene and the DNA sequence corresponding to the crRNA or gRNA; fusing the left and right homologous sequences of the target edited gene with the improved Pichia pastoris gene editing single plasmid in claim 1; transferring the fused plasmid and the obtained DNA sequence corresponding to the crRNA or gRNA into Pichia pastoris, and performing transformant screening on a culture medium with sorbitol or rhamnose as the carbon source, to obtain a positive transformant. 4.The method for improving gene editing efficiency of Pichia pastoris according to claim 3, characterized in that, The formula of the culture medium with sorbitol or rhamnose as the carbon source is: yeast powder 5 g / L, peptone 10 g / L, rhamnose 20 g / L; or yeast powder 5 g / L, peptone 10 g / L, sorbitol 20 g / L.

Images