Application of ZmARF4 gene in construction of low-nitrogen-resistant corn
The ZmARF4 gene of corn was knocked out through the CRISPR/Cas9 system to construct low-nitrogen-resistant corn, which solved the problems of time and low efficiency of traditional breeding, and achieved the improvement of the nitrogen absorption rate and total nitrogen content of corn under low nitrogen conditions, enhancing the low-nitrogen resistance of corn.
Patent Information
- Application Number
- CN202410139653.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-01
- Publication Date
- 2025-08-01
AI Technical Summary
Traditional hybrid breeding takes a long time and the improvement effect on low-nitrogen resistance of corn is unclear. The prior art is difficult to effectively improve the nitrogen utilization efficiency of corn under low-nitrogen conditions.
The ZmARF4 gene in corn was knocked out through the CRISPR/Cas9 system to construct low-nitrogen-resistant corn. Gene editing was used for CRISPR/Cas9 kit to enhance corn root system development to improve nitrogen absorption capacity.
Under low nitrogen conditions, corn knocked out of the ZmARF4 gene showed a more developed root system, which increased the nitrogen absorption rate and total nitrogen content, and enhanced the corn's low nitrogen resistance.
Smart Images

Figure CN120400210A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of genetic engineering and molecular biology breeding. Specifically, the present application provides the application of the ZmARF4 gene in constructing low-nitrogen tolerant maize. Background Art
[0002] Maize is one of the three major food crops in the world. Nitrogen is essential for the growth and development of maize and is very important for increasing yields. In the past few decades, a large amount of nitrogen fertilizer has been applied to increase crop yields. However, only 30%-40% of the applied nitrogen fertilizer is absorbed and utilized by crops, and most of it is lost to the environment, causing very serious environmental pollution.
[0003] Nitrate is the main form of nitrogen source absorbed by terrestrial plants. Roots are the main organs for plants to absorb nitrate. The high plasticity of roots can improve the ability of plants to absorb water and nutrients such as nitrate. Plants regulate root architecture to respond to changes in external nitrate concentration to increase the absorption rate of nitrate. Therefore, root development is very important for improving nitrogen use efficiency.
[0004] Traditional cross-breeding not only has a long breeding period but also the mechanism of the target gene is not clear. Studying the molecular mechanism of maize's specific response to low-nitrogen stress in regulating root development and the major factors affecting its main physiological and biochemical processes can knock out relevant genes in wild-type maize plants and use corresponding experimental methods to detect whether the low-nitrogen tolerance of the transgenic plants has changed compared with the wild type, which can effectively explore high-quality gene resources related to low nitrogen, thus providing a certain theoretical basis for further improving the low-nitrogen tolerance of maize and new varieties with high nitrogen use efficiency. Summary of the Invention
[0005] On the one hand, the present application provides the application of the ZmARF4 gene in constructing low-nitrogen tolerant maize, that is, a method for constructing low-nitrogen tolerant maize.
[0006] Further, the construction of low-nitrogen tolerant maize is to knock out the ZmARF4 gene in maize.
[0007] Further, the construction of low-nitrogen tolerant maize is to knock out the ZmARF4 gene in maize ND101.
[0008] Further, the ZmARF4 gene sequence is as shown in SEQ ID NO.1.
[0009] Further, the knocking out of the ZmARF4 gene in maize is to use the CRISPR / Cas9 system to knock out the ZmARF4 gene in maize.
[0010] Furthermore, the gRNA sequence used for knocking out the ZmARF4 gene in maize using the CRISPR / Cas9 system is as shown in SEQ ID NO.2.
[0011] Furthermore, compared with maize without the ZmARF4 gene knocked out, the low-nitrogen tolerant maize has more developed roots, a higher nitrogen absorption rate, and a higher total nitrogen content under low-nitrogen conditions.
[0012] On the other hand, the present application provides a kit for constructing low-nitrogen tolerant maize, and the kit contains the CRISPR / Cas9 reagent used for knocking out the ZmARF4 gene in maize.
[0013] Furthermore, the gRNA sequence in the CRISPR / Cas9 reagent is as shown in SEQ ID NO.2.
[0014] On the other hand, the present application provides the application of the above application or kit in the breeding of low-nitrogen tolerant maize. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 [[ID=I8]]Schematic diagram of the knockout methods for different ZmARF4 knockout lines (ZmARF4 rispr -1, ZmARF4 rispr -2, ZmARF4 rispr -3, ZmARF4 rispr -4 and ZmARF4 rispr -5);
[0016] Figure 2 Comparison diagram of plants under normal nitrogen (Normal-Nitrate, 4 mM, NN) treatment (left) and low-nitrogen (Low-Nitrate, 0.05 mM, LN) treatment (right);
[0017] Figure 3 Comparison diagram of roots under normal nitrogen (Normal-Nitrate, 4 mM, NN) treatment;
[0018] Figure 4 Comparison diagram of roots under low-nitrogen (Low-Nitrate, 0.05 mM, LN) treatment;
[0019] Figure 5 Comparison diagram of nitrogen absorption rate (Root 15 NO3 - influx) and total nitrogen content (Nitrogen content). DETAILED DESCRIPTION OF THE EMBODIMENTS
[0020] Example 1 Detection of CRISPR / Cas9 Materials for the ZmARF4 Gene
[0021] The coding region sequence of the ZmARF4 gene (numbered GRMZM2G034840 in the maize genome database) is shown in SEQ ID NO. 1 as follows:
[0022] ATGACGTCCTCGTACGAGAAGGCCACGTCGGGTGTCCTGAGGAACGCGGCGGCGCTGCTCGACGAAATGCAGCTCATGGG
[0023] AGAAACGCAGGGTGCCAAGAAGGTGATCAACTCCGAGCTGTGGCACGCGTGCGCGGGGCCGCTGGTCTGCTTGCCGCAGC
[0024] GGGGGAGCCTCGTCTACTACTTCCCCCAGGGGCACAGCGAGCAGGTTGCTGCTACCACTAAAAAGATACCCAACTCTCGC
[0025] ATCCCAAACTACCCGAGTCTCCCGTCGCAGCTGCTATGTCAAGTCCACAACATCACTTTGCATGCTGACAAAGAAACTGA
[0026] TGAGATTTATGCCCAGATGACCCTGCAACCAGTACACTCGGAAACTGATGTGTTCCCAATCCCAACGCTCGGTGCTTATA
[0027] CCAAAAGCAAGCACCCCAGTGAATATTTCTGCAAGAATTTGACTGCAAGTGATACAAGTACGCATGGTGGTTTCTCGGTG
[0028] CCACGGAGAGCTGCAGAGAAGCTGTTTCCGCAGTTGGATTATTCAATGCAGCCTCCTAATCAGGAGCTTATCGTTCGAGA
[0029] TCTGCATGATAACATGTGGACATTCCGTCACATTTATCGTGGCCAGCCAAAGCGACATCTTCTAACAACTGGATGGAGTC
[0030] TTTTTGTTGGTGCGAAACGGCTTAAAGCTGGTGACTCTGTCTTATTTATCAGGGATGAGAAGTCACAGCTCCTTGTGGGT
[0031] GTTAGGCGGGCCACCAGACAACAACCGGCTTTGTCATCATCCGTCCTGTCTACTGACAGTATGCACATTGGTGTTCTTGC
[0032] TGCTGCAGCTCATGCAGCATCAAGTGGTGGCTCGTTTACTGTTTACTACAATCCTCGGACAAGCCCGTCGCCATTTGTGA
[0033] TTCCTCTCGCAAGGTACAATATGGCCACATATCTGCAACCATCAGTTGGAATGAGATTCGCGATGATGTTTGAGACGGAG
[0034] GAGTCAAGCAAGCGCAGATGCACAGGTACAATTGTGGGAATTAGCGACTATGAACCGATGCGATGGCCAAACTCAAAATG
[0035] GCGCAACTTGCAGGTAGAATGGGATGAACATGGGTATGGAGAAAGACCTGAAAGAGTTAGTCTATGGGATATCGAAACTC
[0036] CAGAGAACATGGTTTTCTCTTCCCCATTGAATTCGAAAAGGCAATGTCTTCCTAGTTATGGAGTTTCTGGCCTACATGTG
[0037] TCATCAATTTCAAAGCCACAAGGAAGTCCTTTTGGTAACTTGCAGCACATGCCAGGGATCAGTTCAGACATTGCTTTGCT
[0038] GCTTCTCAATCAATCTGCCCAGAACCTCGGGAGTTCAATTGCTTGTCAACAATCATCATTTTCCAGCATTATTCAAAATG
[0039] CTAAGCAAAGCTATTTCCCTCCAACGACATTAGGTGCTTCCACTGGTTGGAATGAATCTCAGCAGCAGTTAAACGCCCTT
[0040] GGTATTCAAAAAGGTGATCAAGTAAGCTGTGATGTTCAGCCAGGTATTGATTCAATCACTGCACCGGAGATGAATGTTAA
[0041] ACCAAGAGTCCCAAGAAGCACGGATTCATACTCAAGTCAGAGCATTTCGGATCCAAACAGCAAGAGTGACCCTAAAACAA
[0042] AAACGCGAAGGAGCAAGAAGAGCTCGTCTCACAAAACCATTTCGGATAAATCTGAGATTTCTTCAGTACCTTCTCAGATC
[0043] TGTGACAAGCAAAGGCATGGTTCAGAACCAACATCGGCAGACTTTGAAGCAGAACAAGCTACCTGTGGGAACAATGAGGA
[0044] TTCATCTGGTGCACTCACACGTGGTGATTTTGCTGGAGAGCTACAAGTTCAGCAGGTTGAACAAGATGGTCTACTTCCAC
[0045] CACCGAAGTTAGAGTCATCAAAGTCACCTGATGGAGGGAAGTCCGTCAGCTCGTTCCCAAACCAAGGGTGTTTCTCACAG
[0046] TTCTTTGAGGGTCTGGATTGGATGATCCCGCCTTCCTGCTACCAAGACTCCAATGGCATCCATTCAGTTACCACATCGGA
[0047] TAGCATCTTTAATCCGTCTGAAGGTATACCACCTTCCACAATGAACGCGGACGGCATGGACGCGTTCCAAACCTCTTGCC
[0048] TTTCCGAGTGCTTTCCTAATTCCATCCAAGAATTCATCAGCAGTCCAGATATAAACACACTGACATTTATGTCGCCTGAG
[0049] ATGCAACATCTGGATGCCCAACACGACGGCAGCAACTTGCAGAGCACGTCCAACTCCTATGTGCAGATGAGCTTCTCGGA
[0050] GGAGAGCCAGAGTGCATCCTTAAGTGGCCTACACATGGAAGCTGTCCATATCAACAGCTCCTGCCTTCAACCACTGGCGA
[0051] CAGGGAGCTTTGATGCAGGGACGTTCTCAAAACTATCAAACATAAAAGAATGCCAGGCCTTGCCTCTGCAGGAGATTCAC
[0052] AACAGCTCCATGGGAACACCTTCGTGCAGTATGGATGCGGCGGCGGTCGAGTACTGTATGGATCGAAGTGTGAAGCCACT
[0053] GAAACCACCGGTCCGGACATATACAAAGGTTCAAAAGTTAGGATCAGTTGGAAGATCTATCGACGTTACACGGTTTAGAG
[0054] ACTACCATGAGTTGAGGTCAGCCATTGCCTGCATGTTTGGACTACAGGGGAAACTGGAACACCCTGGCAGTTCAGACTGG
[0055] AAGCTTGTTTATGTCGACTACGAGAACGATGTTCTCCTCGTTGGAGACGACCCGTGGGAGGAGTTCATCAACTGTGTGAG
[0056] ATGCATTCGGATCCTGGCGCCTTCGGAAGTACAGCAGATGAGCGAGAATGGCGTGCATGTCTTGAACGACTGCATGCAAA
[0057] TGGCTTAG
[0058] The gRNA target of ZmARFx was found on the sixth exon in the data management system of the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University. The gRNA sequence is GGTATAAGCACCGAGCGTT (SEQ ID NO.2). Primers were designed to identify homozygosity. The primers used were:
[0059] ZmARF4-F1 GTTCCTAATGTTTGGGGGGGTAC (SEQ ID NO.3);
[0060] ZmARF4-F2 GCCTGTAAGTTTCAGAGTTTGGCCTC (SEQ ID NO.4);
[0061] ZmARF4-R CCTGATAAATAAGACAGAGTCACCAGC (SEQ ID NO.5).
[0062] PCR amplification was performed using primers ZmARF4-F1 and ZmARF4-R, and sequencing was performed using primer ZmARF4-F2.
[0063] Using the ND101 material, knockout mutants of ZmARF4, namely ZmARF4 rispr -1, ZmARF4 rispr -2, ZmARF4 rispr -3, ZmARF4 rispr -4 and ZmARF4 rispr -5 (as specifically shown in Figure 1 ).
[0064] Example 2 Phenotypic Observation and Low Nitrogen Tolerance Detection of ZmARF4 Knockout Mutants
[0065] First, wild-type maize and ZmARF4 rispr -1, ZmARF4 rispr -2, ZmARF4 rispr -3, ZmARF4 rispr [[ID=4I]]-4 and ZmARF4 rispr -5 lines were germinated on filter paper. After two days of germination, the root length of the maize seedlings reached 2 cm, and then they were rolled up with filter paper and treated with high and low nitrogen nutrient solutions (4 mM, 0.05 mM). The hydroponic seedlings were divided into normal nitrogen and low nitrogen treatments. After 10 days, the phenotypes were observed and the NO3 - concentration in maize was detected and the nitrate absorption rate was measured.
[0066] Detection of maize NO3 - concentration:
[0067] a. Quick-freeze the corn material in liquid nitrogen, grind it into powder, and store it in liquid nitrogen or in a -80 °C refrigerator;
[0068] b. Add 10 mL of ultrapure water to a 15 mL centrifuge tube, weigh 0.3 g of the powder using an analytical balance, record the corresponding mass m, and weigh 3 replicates for each sample;
[0069] c. Boil the weighed samples in boiling water for 20 min, cool to room temperature, and then place them in a -80 °C refrigerator;
[0070] d. Take the samples out of the refrigerator to thaw, centrifuge at 4500×g for 5 min, filter through a 0.22 μm filter membrane into a centrifuge tube, and detect the NO3 content in the samples by high performance liquid chromatography; - content.
[0071] e. Calculate the experimental results.
[0072] Absorption rate of nitrate:
[0073] Use the isotope 15 NO3 - to replace normal NO3 - , and the specific experimental method is as follows:
[0074] a. Prepare the plant materials and grow the corn materials in NN and LN nutrient solutions for 10 days;
[0075] b. Preparation of the nutrient solution containing 15 NO3 - : Weigh 1.66 g of 15NO3 with an abundance of 99.2% 15 NO3 - and dissolve it in 5 L of ultrapure water to prepare an NN nutrient solution containing 4 mM 15NO3 - ; Weigh 0.021 g of 15NO3 with an abundance of 99.2% - and dissolve it in 5 L of ultrapure water to prepare an LN nutrient solution containing 0.05 mM 15 NO3 - ;
[0076] c. Preparation of the CaSO4 solution: Weigh 0.086 g of CaSO4 powder and dissolve it in 5 L of deionized water to prepare a 0.01 mM CaSO4 solution;
[0077] d. 15 NO3 - absorption: Take out the seedlings with consistent growth from the normal nutrient solution and place them in a 0.01 mM CaSO4 solution for 1 min, then immerse them in the solution containing 15In the nutrient solution containing NO3-, treat for 5 min, then transfer it to the 0.01 mM CaSO4 solution and treat for 1 min. Wipe the surface solution dry, quickly separate the aboveground part from the underground part, put them into kraft paper bags, dry at 105 °C for 30 min, and then dry at 75 °C for 3 days;
[0078] e. Grind the dried sample into powder, weigh about 2 mg and record the dry weight, put it into a tin foil cup, wrap the tin foil cup into a small square piece, and measure it using an isotope mass spectrometer;
[0079] f. Calculate 15 the N absorption rate and total nitrogen content, and analyze the experimental results.
[0080] There was no significant difference between the mutant material and the wild-type material under normal nitrogen treatment. However, under low nitrogen treatment, the roots of the mutant were more developed ( Figures 2 - 4 ). At the same time, measure and statistics the nitrogen absorption rate (Root 15 NO3 - influx) and total nitrogen content (Nitrogen content) of the materials ( Figure 5 ). Thus, it can be seen that after knocking out the maize transcription factor ZmARF4, the nitrogen absorption rate and total nitrogen content of maize can be significantly improved, indicating that the plant's tolerance to low nitrogen environment is enhanced.
Claims
1. Application of the ZmARF4 gene in constructing low-nitrogen tolerant maize.
2. The application according to claim 1, wherein constructing the low-nitrogen tolerant maize is knocking out the ZmARF4 gene in maize.
3. The application according to claim 2, wherein constructing the low-nitrogen tolerant maize is knocking out the ZmARF4 gene in maize ND101.
4. The application according to claim 2, wherein the ZmARF4 gene sequence is as shown in SEQ ID NO.
1.
5. The application according to claim 2, wherein knocking out the ZmARF4 gene in maize is knocking out the ZmARF4 gene in maize using the CRISPR / Cas9 system.
6. The application according to claim 5, wherein the gRNA sequence used for knocking out the ZmARF4 gene in maize using the CRISPR / Cas9 system is as shown in SEQ ID NO.
2.
7. The application according to any one of claims 1-6, wherein compared with maize without knocking out the ZmARF4 gene, the low-nitrogen tolerant maize has more developed roots, a higher nitrogen absorption rate and a higher total nitrogen content under low-nitrogen conditions.
8. A kit for constructing low-nitrogen tolerant maize, characterized in that, The kit contains the CRISPR / Cas9 reagent used for knocking out the ZmARF4 gene in maize.
9. The kit according to claim 9, wherein the gRNA sequence in the CRISPR / Cas9 reagent is as shown in SEQ ID NO.
2.
10. The application according to any one of claims 1-7, or the application of the kit according to claim 8 or 9 in low-nitrogen tolerant maize breeding.
Citation Information
Cited By
ZmARF6 protein for regulating and controlling plant nitrogen absorption, biological material, application and method for improving plant traits
CN120866347A