SNP (Single Nucleotide Polymorphism) molecular marker for assisting egg reselection and application thereof
By using SNP molecular marker g.180943087G>C, combined with genotype detection and editing technology, the problems of long cycle, high cost and low accuracy of egg rebranding in traditional breeding were solved, and early efficient breeding effects were achieved.
Patent Information
- Application Number
- CN202510204400.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-08-01
AI Technical Summary
In traditional breeding, egg re-selecting is limited by individual gender and age, and the breeding cycle is long, cost is high and accuracy is low.
The SNP molecular marker g.180943087G>C was used to detect the genotype of chickens, especially CC-type individuals, and perform early breeding, combined with PCR amplification and Sanger sequencing, and genotype detection was performed, and genotype was edited using gene editing technology to improve the egg weight of chicken flocks.
Significantly shortens the breeding cycle, reduces breeding costs, improves breeding accuracy, and can make selections in the chick stage to ensure breeding results.
Smart Images

Figure CN120400352A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular breeding, and in particular, to an SNP molecular marker for assisting in the selection and breeding of egg weight and its application. Background Art
[0002] Egg weight is an important factor affecting egg sales. High-end eggs not only require maintaining high standards in internal quality indicators such as yolk ratio, yolk color, nutrient content of eggs, taste and flavor of eggs, etc., but also require maintaining high uniformity within an ideal range in external qualities such as egg weight, egg shape, eggshell color, etc. Therefore, egg weight has become one of the important indicators for egg sorting in the production of high-end eggs. Egg weight is a quantitative trait affected by the synergistic effects of environment and genetic effects. The results of egg weight heritability show that genetic effects explain 68% - 79% of the phenotypic variation and are the main factors affecting egg weight. However, it is difficult to improve egg weight through breeding means in the traditional breeding system. The main reasons are that egg weight is a sex-limited trait with relatively late expression. On the one hand, roosters lack their own phenotypic records and cannot be directly selected. The selection of their egg weight can only be indirectly selected through the egg weight records of their full-sib sisters or mothers; on the other hand, although hens have their own phenotypic records, they also need to wait until after laying to obtain phenotypic records and make selections. Therefore, the traditional breeding cycle is long, the cost is high, and the accuracy is low.
[0003] Therefore, there is an urgent need for a breeding scheme to solve the problems in the prior art. Summary of the Invention
[0004] The main object of the present invention is to provide an SNP molecular marker for egg weight selection and breeding and its application, so as to at least solve the problems of long breeding cycle, high cost, and low accuracy in traditional egg weight selection restricted by individual gender and age.
[0005] To achieve the above object, the present invention provides an SNP molecular marker for assisting in the selection and breeding of egg weight. The SNP molecular marker is g.180943087G>C, and the SNP molecular marker is derived from the RDX gene;
[0006] The physical position of the SNP molecular marker in the chicken Galgal6.0 version reference genome is Chr1:180943087, its alleles are C and G, and the accession number in the NCBI dbSNP database is rs315113039;
[0007] The genotypes of the SNP molecular marker include CC genotype, CG genotype, and GG genotype. Among them, the relationship of egg weight of individuals with each genotype is: CC genotype > CG genotype, CG genotype > GG genotype.
[0008] The present invention also provides a method for selecting and breeding egg weight based on the SNP molecular markers described in the present application, including:
[0009] Detecting the genotype of the SNP molecular markers of the chicken individuals to be tested, and selecting the chicken individuals with the CC genotype to increase the average egg weight of the chicken flock.
[0010] Optionally, the selection and breeding method is implemented at the chick stage.
[0011] The present invention also provides a kit for detecting the genotype of the SNP molecular markers described in the present application, and the kit contains reagents for detecting the genotype of the SNP molecular markers.
[0012] The present invention also provides a method for detecting the genotype of the SNP molecular markers described in the present application, and the detection method includes any one of the following methods:
[0013] PCR amplification combined with Sanger sequencing and next-generation genome sequencing.
[0014] Optionally, when using PCR amplification combined with Sanger sequencing, the primer pair used for PCR amplification includes:
[0015] Forward strand: 5’-CTTACAGCCTTCCTCCTTAC-3’;
[0016] Reverse strand: 5’-AATAGCACAAATGCCAACAC-3’; <9000038>The primer pair is used to specifically amplify the DNA fragment containing the molecular marker.
[0018] The present invention also provides an application of the method for detecting the genotype of the SNP molecular markers described in the present application in the selection and breeding of egg weight.
[0019] The present invention also provides a gene editing method, which edits the genotype of the SNP molecular markers described in the present application by gene editing technology for the selection and breeding of egg weight.
[0020] An SNP molecular marker for assisting in the selection and breeding of egg weight and its application, the SNP molecular marker is g.180943087G>C, and the SNP molecular marker is derived from the RDX gene; the physical position of the SNP molecular marker in the chicken Galgal6.0 version reference genome is Chr1:180943087, its alleles are C and G, and its accession number in the NCBI dbSNP database is rs315113039; the genotypes of the SNP molecular marker include CC genotype, CG genotype and GG genotype, wherein, the relationship of egg weight of individuals with each genotype is: CC genotype is greater than CG genotype, and CG genotype is greater than GG genotype. Thus, a means of molecular assisted selection and breeding is provided for the selection and breeding of egg weight. Select hens and roosters with CC genotype to form a population, which can be used to select and breed to improve the egg weight of the chicken flock. The present invention is not restricted by the sex and age of individuals, and can be implemented when the chickens hatch, significantly shortening the breeding cycle and reducing the breeding cost. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The accompanying drawings forming a part of this application are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:
[0022] Figure 1 It is a schematic diagram of the results of Sanger sequencing detection of the genotype at the g.180943087G>C locus provided by this application;
[0023] Figure 2 It is a schematic diagram of the detection result of agarose gel electrophoresis of the PCR amplification product containing the g.180943087G>C locus. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0024] It should be noted that, without conflict, the embodiments in this application and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.
[0025] This application provides an SNP molecular marker for assisting in the selection and breeding of egg weight. The SNP molecular marker is g.180943087G>C, and the molecular marker is derived from the RDX gene; the physical position of the SNP molecular marker in the chicken Galgal6.0 version reference genome is Chr1:180943087, its alleles are C and G, and its accession number in the NCBI dbSNP database is rs315113039; the genotypes of the SNP molecular marker include CC genotype, CG genotype and GG genotype, wherein, the relationship of egg weight of individuals with each genotype is: CC genotype is greater than CG genotype, and CG genotype is greater than GG genotype.
[0026] Specifically, the Radixin protein is encoded by the RDX gene and is one of the members of the ERM (ezrin / radixin / moesin) family. Radixin is a linker protein that connects the cell membrane and the cytoskeleton. Radixin is involved in various important cellular life activities such as the morphological regulation of the cell membrane, cell migration, adhesion, cytokinesis, and signal transduction. Abnormal expression or function of Radixin will have a negative impact on follicle development, the exocrine function of hepatocytes, and the migration and differentiation of nerve cells, and is closely related to the occurrence of diseases such as deafness caused by cochlear cilia degeneration, cervical adenocarcinoma, and peripheral nerve injury induced by diabetes. In the previous genome-wide association study (GWAS) mapping of egg weight QTL, the present invention found that RDX is a candidate gene within the egg weight QTL located on chicken chromosome 1. After studying the association between RDX sequence variation and egg weight, the present invention found a single nucleotide polymorphism (SNP) variation (g.180943087G>C) that is significantly associated with egg weight within the RDX gene. In the chicken genome, there are tens of millions of molecular markers, but only a very small number of molecular markers that affect egg weight and constitute the molecular basis of egg weight regulation can be associated with egg weight. The present invention successfully screened out such a molecular marker g.180943087G>C based on previous research. The CC genotype of g.180943087G>C is associated with large egg weight. g.180943087G>C is a way of expressing genomic SNP variation in genetics. "g." indicates the genomic level. The uniqueness of the identity of this marker can be defined by its physical position on the chicken chromosome and the dbSNP accession number. "180943087" is the physical position of this egg weight-associated SNP on chromosome 1 of the chicken Galgal6.0 reference genome. G>C represents the two alleles of this SNP, where G is the wild-type allele present in the reference genome and C is the mutant allele. The accession number of g.180943087G>C in the NCBI dbSNP database is rs315113039. Figure 1 is a schematic diagram of the genotype at the g.180943087G>C locus of the molecular marker detected by Sanger sequencing, as Figure 1As shown, the genotypes of the g.180943087G>C locus include the CC genotype, the GG genotype, and the CG genotype. Through the correlation analysis between the genotype and egg weight, it is found that the C base at the g.180943087G>C locus is the allele associated with large egg weight, and it has an obvious additive effect, that is, the eggs of individuals with the CC genotype are the largest, those of the CG genotype are in the middle, and those of the GG genotype are the smallest. Clarifying the relationship between the molecular marker locus genotype and egg weight provides an effective selection marker for chicken molecular breeding. Breeders can use any gene detection technology to quickly and accurately screen out individuals with the target genotype, form a breeding core group, accelerate the breeding process of increasing egg weight, and shorten the breeding cycle. By developing molecular markers significantly associated with egg weight, the future egg weight performance can be judged based on the genotype of the markers, thus shortening the breeding cycle and saving breeding costs. In addition, molecular breeding is not restricted by gender, and the genetic contribution of roosters to egg weight can also be predicted based on the genotype, thereby improving the accuracy of breeding selection.
[0027] Provide an egg weight selection method based on the above SNP molecular marker, including:
[0028] Detect the genotype of the molecular marker g.180943087G>C of the chicken to be tested, and select and retain the chicken individuals with the CC genotype to increase the average egg weight of the chicken flock.
[0029] Specifically, among the genotypes of the molecular marker g.180943087G>C, the egg weight of chicken individuals with the CC genotype is the largest, that of individuals with the GG genotype is the smallest, and that of individuals with the CG genotype is between the CC genotype and the GG genotype. At the g.180943087G>C molecular marker locus of chickens, the CC genotype has a positive correlation with the egg weight trait of chickens. That is to say, chicken individuals with the CC genotype are genetically more inclined to produce heavier eggs. During breeding, by selecting and retaining CC-type roosters and hens as breeding chickens and forming a family for breeding, the egg weight of the chicken flock will be selected towards the direction of large egg weight. The egg weight molecular breeding method in this application only needs to detect the genotype of the chicken to be tested, and then select and retain CC-type roosters and hens for mating, and the average egg weight of the chicken flock can be increased from the breeding perspective. Since the selection is made based on the prior knowledge of the correlation between the CC type and large egg weight, only by detecting whether the genotype of the individual to be tested is the CC type can the future egg weight phenotype of the individual be predicted, without relying on the phenotypic value of the individual. Therefore, this method is not restricted by the gender and age of the individual, and plays a good complementary role in traditional phenotypic or breeding value selection.
[0030] In a possible implementation manner, the selection method is implemented at the chick stage.
[0031] Specifically, selection and breeding at the chick stage can identify individuals with potential excellent traits as early as possible based on the genotype of the g.180943087G>C locus. Compared with screening at a certain stage of chicken growth, such as the laying period, early screening can avoid excessive feeding costs, such as feed and breeding space, on individuals that do not meet the breeding objectives, thus saving breeding costs. In addition, although genotype detection can also be carried out during the embryonic period, the detection technology is difficult and causes great harm to the embryo, resulting in a low survival rate.
[0032] The present application also provides a kit for detecting the genotype of the above SNP molecular marker, and the kit contains reagents for detecting the genotype of the molecular marker g.180943087G>C.
[0033] Specifically, there are various reagents for detecting the genotype of the molecular marker g.180943087G>C. For example, first, there are reagents for extracting chicken genomic DNA, because the prerequisite for detecting the genotype is to obtain the genomic DNA of the chicken. Common DNA extraction reagents include proteinase K, lysis buffer, etc., which can break the cell structure and release DNA. Secondly, there are reagents for amplifying the DNA fragment where the g.180943087G>C locus is located, such as primers required for PCR reaction, Taq DNA polymerase, dNTP (deoxynucleoside triphosphate), etc. The primers are designed according to the DNA sequences upstream and downstream of this locus and can specifically bind to the target DNA region. Under the action of Taq DNA polymerase, a DNA fragment containing the target locus is amplified using dNTP as the raw material. In addition, when using the restriction fragment length polymorphism method for detection, there are also restriction endonucleases for distinguishing different genotypes. DNA fragments of different genotypes will produce fragments of different lengths after being cut by restriction endonucleases, and these fragments can be distinguished by methods such as electrophoresis, thereby determining the gene.
[0034] The present application also provides a detection method for detecting the genotype of the above SNP molecular marker, and the detection method includes any one of the following methods:
[0035] PCR amplification combined with Sanger sequencing method and next-generation genomic sequencing method.
[0036] Specifically, in the detection method exemplified in this application, among them, next-generation sequencing (NGS), also known as high-throughput sequencing. This application only lists the above several detection methods and does not limit the specific detection method. In other embodiments, methods such as digestion + electrophoresis, SNP chip, Taqman probe method, and MassARRAY time-of-flight mass spectrometry can also be used to detect the genotype of the g.180943087G>C locus. Other DNA fragments containing the g.180943087G>C locus obtained by using the above other genotype detection techniques for egg weight breeding are all within the protection scope of the present invention.
[0037] When using the PCR amplification combined with Sanger sequencing method, the specific operations include:
[0038] (1) Determine the PCR amplification system
[0039] PCR amplification, namely polymerase chain reaction (PCR) amplification, is a molecular biology technique for rapidly amplifying specific DNA fragments in vitro. The basic principle of PCR amplification is similar to the natural replication process of DNA. It utilizes the characteristics of DNA denaturing and unwinding at high temperature, primer binding to the template at low temperature, and DNA polymerase extending to synthesize new strands at an appropriate temperature. By controlling the temperature change, DNA is replicated repeatedly, so as to obtain a large number of specific DNA fragments in a short time. In this application, the PCR system is 20 μL, which consists of 10 μL of 2×Taq PCR StarMix (Dye) (purchased from Kangrun Bio-Genstar, product number: A012), 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 1 μL of the DNA template (50 ng) of the sample to be tested, and 8 μL of ddH2O. After collecting the anticoagulated blood sample to be tested, the DNA of the sample to be tested can be obtained by extracting with any commercial blood sample DNA isolation kit. Among them, the forward primer and the reverse primer determine the amplification region by complementary binding to a specific region of the DNA template of the sample to be tested, provide a 3'-OH end for DNA polymerase to start synthesizing new strands, and ensure that the PCR amplification is only targeted at the target DNA fragment with its specificity, providing an accurate sample for subsequent detection. The specific region refers to the DNA sequence segment containing the molecular marker g.180943087G>C locus.
[0040] (2) Set the PCR amplification conditions
[0041] The PCR amplification conditions are denaturation at 95°C for 3 min, (denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 20 sec) × 33 cycles, and extension at 72°C for 5 min.
[0042] (3) Perform electrophoresis detection of the amplification products
[0043] The PCR amplification products can be detected by electrophoresis on a 2% agarose gel (containing 0.01% nucleic acid dye). The electrophoresis detection conditions are 100 V for 40 min, and the results are recorded by taking pictures with a gel imaging system. If the PCR amplification products show a single band at the expected position as Figure 2 shown, then the PCR is a specific amplification and Sanger sequencing can be performed.
[0044] (4) Detect the g.180943087G>C genotype by Sanger sequencing
[0045] The g.180943087G>C genotype can be detected by Sanger sequencing. Sanger sequencing can be commissioned to any sequencing company. The length of the sequenced fragment is 530 bp, and the sequence information is shown in Sequence 1.
[0046] In a possible implementation, when using PCR amplification combined with Sanger sequencing, the primer pair used for the PCR amplification includes:
[0047] Forward strand: 5’-CTTACAGCCTTCCTCCTTAC-3’;
[0048] Reverse strand: 5’-AATAGCACAAATGCCAACAC-3’; The primer pair is used to specifically amplify the DNA fragment containing the molecular marker.
[0049] Specifically, in the genomic DNA of chickens, the forward primer and the reverse primer each seek a sequence region with complementary bases to bind to. The forward primer seeks to bind to a sequence segment complementary to "5’-CTTACAGCCTTCCTCCTTAC-3’" in the chicken genomic DNA, and the reverse primer seeks to bind to a sequence segment complementary to "5’-AATAGCACAAATGCCAACAC-3’". The DNA region covered between these two binding sites is the target region to be amplified, and this region contains the molecular marker g.180943087G>C locus. This delimits the scope of PCR amplification, ensuring that only the DNA fragment containing the target molecular marker is amplified. When the primer binds to the template DNA, it provides a 3'-OH end for DNA polymerase (such as Taq DNA polymerase). DNA polymerase can recognize this end and, using dNTP (deoxynucleoside triphosphate) as a raw material, synthesize a new DNA strand starting from the 3'-OH end of the primer according to the base complementary pairing principle. For example, after the forward primer binds, DNA polymerase uses the DNA strand complementary to the forward primer as a template and extends to synthesize a new strand starting from the 3'-OH end of the forward primer; the same applies to the reverse primer. Since the base sequences of these two primers are specifically designed and can only bind complementarily to a specific region in the chicken genomic DNA that contains the target molecular marker locus and not to other regions, it is ensured that only the target DNA fragment is amplified during PCR amplification, while other irrelevant DNA fragments are not amplified, thus providing a reliable sample for accurately detecting the genotype of the g.180943087G>C locus subsequently.
[0050] The present application also provides an application of the above method for detecting the genotype of the SNP molecular marker in the breeding of egg weight.
[0051] The present application also provides a gene editing method for the SNP molecular marker, which edits the genotype of the said SNP molecular marker in the chicken genome by gene editing technology for the breeding of egg weight.
[0052] Specifically, editing the genotype of the molecular marker g.180943087G>C in the chicken genome means using gene editing technology, such as CRISPR / Cas9, to change the base composition of this SNP locus in the chicken genome, causing the genotype to change among GG, CG, and CC, and making the CC genotype, which is related to the egg weight advantage, more frequently appear in the chicken population to breed a chicken variety with better egg weight.
[0053] SEQ ID No.1 is the sequence of the PCR amplification fragment containing the g.180943087G>C locus. The underlined parts are the primer-binding parts of the forward and reverse strands respectively, and the double-underlined part marks the molecular marker g.180943087C>G associated with egg weight. The physical position of g.180943087G>C in the chicken Galgal6.0 reference genome is Chr1:180943087, and its accession number in the NCBI dbSNP database is rs315113039. The CC genotype of g.180943087G>C is associated with large egg weight in chickens.
[0054] SEQ ID No.1:
[0055] CTTACAGCCTTCCTCCTTAC AAAATGAAGAAAATCTCCTTTTCTTAATTTTTATTTTTGATTTATACTGTAATGGTCTACTTGCGTTATCTTCATTTGGGAAAAATGAGTGTATCATTTCTTCCCTGAGAGAAATGGATGCTTTTATGCACAAGAAACAGTTGTGAAGCTTAAAGATCATGTTAGCTTTTTCTTTGTTTGCATGAAGTTTCAAATTTGGCTGGCATTGACAGTTTAAATTACAGCTTTGGAGTTTCTTGAACAAATTTTTCTTCTCAAAATGCTAAAGGCTTTCAGTACTGAAAGATGTCTAATGTCACCTTTTTTTTTTAAAGAACTTGTAGCATTGAGGGAGCTATCTTAATTCTAACCTCAGTGGAGTATTTTATAAATGCTGGAAAGGAGGTTACTTTCTAGAAACCTGTAGATTCTG G TAGTGGATAACTTTAGCTGCTTGTTATTGTTACCTACTGAAAAGGACATTTTGTACGTGTAGAACACCTGTTTATCT GTGTTGGCATTTGTGCTATT
[0056] SEQ ID No.2 and SEQ ID No.3 are primer pairs for genotyping the g.180943087G>C genotype. Among them, SEQ ID No.2 is the forward strand and SEQ ID No.3 is the reverse strand.
[0057] SEQ ID No.2: 5’-CTTACAGCCTTCCTCCTTAC-3’
[0058] SEQ ID No.3: 5’-AATAGCACAAATGCCAACAC-3’
[0059] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels unless otherwise specified.
[0060] Example 1: Association between g.180943087G>C and egg weight at 42 weeks of age in chickens
[0061] To illustrate that the association between g.180943087G>C and egg weight is a unique genetic trait of this mutation, in addition to g.180943087G>C, the present invention also analyzed the association between three other mutations (g.180941918G>T (rs737630161), g.180942969G>A (rs741027479) and g.180947745A>G (rs315999531)) within the RDX gene and egg weight. g.180941918G>T, g.180942969G>A and g.180943087G>C are located within the first intron of the RDX gene, and g.180947745A>G is located within the second intron.
[0062] 1. Test samples and breeding conditions
[0063] The samples used in this study (n = 352) were randomly selected from the 7th generation hens of the breeding core flock of Lueyang Black-bone chicken egg line. All individuals were hatched in the same batch, raised in the same chicken house, and kept in individual cages. The brooding temperature in the first week was 33 - 35 °C, and then decreased by 2 - 3 °C every week. The brooding was stopped in the fourth week. The lighting time in the first week was 22 h, and then decreased by 1 - 1.5 h every week. They were transferred to the laying hen house at 60 days old and kept in individual cages. Commercial complete feed (Haidar) was used for feeding at each stage, and they had free access to food and water. The egg line was raised in the Longhao Chicken Breeding Center in Lueyang County from July 2022 to July 2023.
[0064] 2. Egg weight measurement
[0065] At 42 weeks of age, 3 consecutive eggs laid by each hen were collected, and the egg weight was measured with a balance. The average value was taken as the representative value of the egg weight of this sample at 42 weeks of age for association analysis.
[0066] 3. DNA extraction
[0067] Blood samples were collected from the wing vein of the samples (n = 352) for measuring egg weight and anticoagulated with ACD (ACD: blood = 1:4). Genomic DNA was extracted using a blood genomic non-column extraction kit (ComWin Biotech, catalog number: CW0544M) according to the kit instructions. The obtained DNA was detected for integrity by 1% agarose gel electrophoresis, and the concentration of DNA was measured using a NanoDrop 2000 (Thermo) spectrophotometer, and the concentration of DNA was adjusted to 50 ng / μL for standby.
[0068] 4. Genotype detection method
[0069] In this example, 4 SNP genotypes were detected by the second-generation genomic sequencing method. After library construction was completed for the DNA of each sample, whole-genome sequencing was performed using the BGI platform PE150 protocol with a sequencing depth of 6×. Fastp (Version, 0.23.4) was used to remove the adapters and low-quality bases from the raw data, and Burrows-Wheeler Aligner (BWA, v.0.7.17) was used to map and align the clean reads to the reference genome Gallus gallus 6.0. Samtools v.1.9 was used to convert the mapping results to the bam format, and GATK v.4.4.0.0 was used to complete SNP calling, filtering, and annotation.
[0070] 5. Data statistical analysis
[0071] One-way ANOVA was used to test the association between 4 SNP genotypes and egg weight, and Duncan's multiple comparison method was used to test the significant differences between genotypes, with a significance level of 0.05. Both one-way ANOVA and multiple comparisons were completed using the ANOVA program in SAS University Edition software.
[0072] 6. Results
[0073] The present invention established the association between 4 SNP genotypes within the RDX gene and the egg weight of chickens at 42 weeks of age. As shown in Table 1, only g.180943087C>G was significantly associated with egg weight. The C allele of g.180943087C>G was the dominant allele associated with large egg weight and showed an obvious additive effect, that is, the CC genotype had the largest egg weight, CG was in the middle, and GG was the smallest.
[0074] Table 1 Comparison results of egg weight at 42 weeks of age among 4 SNP genotypes within the RDX gene
[0075]
[0076] 1 Different mean superscripts indicate significant differences between groups.
[0077] Example 2. Analysis of the effect of molecular-assisted breeding for egg weight
[0078] In Example 1, the present invention found that g.180943087C>G is a molecular marker significantly associated with chicken egg weight. Among them, the CC genotype of g.180943087C>G is associated with large egg weight. In order to verify whether the selection based on g.180943087C>G can effectively improve the breeding effect and whether it is superior to traditional phenotypic selection, when the 7th generation of chickens was replaced, g.180943087C>G was used as a molecular marker for egg weight-assisted breeding, and half-sib families of CC type and GG type were respectively established; according to the egg weight ranking, hens with large egg weight were selected and phenotypic selection was implemented. The implementation effect of molecular-assisted breeding was studied by comparing the egg weights of the offspring selected by molecular and phenotypic methods.
[0079] 1. Molecular selection family establishment plan
[0080] Randomly select 210 hens and 60 roosters from the 7th generation of the laying line of Lueyang black-bone chickens. Detect the genotypes of g.180943087C>G in these samples by the PCR amplification + Sanger sequencing genotype detection method proposed in the invention content. According to the genotype detection results, select 3 healthy roosters and 30 healthy hens with normal reproductive ability of the CC type, and match them according to the ratio of male:female = 1:10 to form 3 half-sib families for molecular breeding of large egg weight. Select 3 roosters and 30 hens of the GG type, and match them according to the ratio of male:female = 1:10 to establish 3 half-sib families of the small egg weight type.
[0081] 2. Phenotypic selection family establishment plan
[0082] According to the measurement results of the egg weight at 42 weeks of age (n = 352) of the 7th generation of the breeding core group of the laying line, rank the egg weights from large to small, and select the top 30 hens with large egg weight records for breeding. Then randomly select 3 healthy roosters with a body weight between 2.5 and 2.8 kg, good sexual reflexes, and qualified semen quality from the half-sib families where the 30 selected hens come from, and match them according to the ratio of male:female = 1:10 to establish 3 half-sib families of the phenotypic selection type.
[0083] 3. Incubation of the pedigree and egg weight measurement of the 8th generation
[0084] The families established by the above two selection and mating schemes were all raised in single cages, and the pedigrees were recorded. Before formal breeding, the sexual reflex of the roosters was trained by the back massage method. After 1 week, semen was formally collected and artificially inseminated. According to the breeding plan, each hen was inseminated for 3 consecutive days and then the hatching eggs were collected. The hatching egg collection period was 10 days, and the hens were inseminated again on the 5th day. The wing numbers of the roosters and hens were marked on the surface of the eggs with a pencil. On the 11th day, all the collected hatching eggs were put into the incubator for hatching, and the eggs were transferred to the hatching trays on the 19th day. The hatching tray frames were partitioned into small grids by plastic baffles, and the hatching eggs of each full-sib family were placed in each small grid. Chicks hatched after 21 days, and wing numbers were put on the chicks and the pedigrees were registered. At 32 weeks of age in the eighth generation, 3 eggs were collected from each chicken to measure the egg weight.
[0085] 4. Comparison of the effects of molecular breeding and phenotypic breeding
[0086] As shown in Table 2, a total of 28 eighth-generation hens were obtained from 3 CC-type half-sib families. The average egg weight was not only significantly higher than that of the small-egg recombination group, but also higher than that of the phenotypic selection group. The average egg weight of the eighth-generation hen population was 54.3±4.7 g. Compared with the population mean, by selecting in the direction of large egg weight based on the CC type, after 1 generation, the average egg weight could be increased by 4.9 g. By selecting in the direction of small egg weight based on the GG type, the decrease in egg weight was not obvious, and the egg weight only decreased by 1.9 g. The above results show that C is indeed a mutant gene that promotes egg weight, but G is not an allele that has a negative impact on egg weight, and the effect of G on egg weight is more neutral. By selecting in the direction of large egg weight based on the phenotype, after 1 generation, the egg weight only increased by 2.4 g, which was significantly lower than 4.9 g of molecular breeding. This example proves that the molecular-assisted breeding method for egg weight proposed by the present invention is not only effective in selecting for large egg weight, but also superior to the traditional phenotypic breeding method.
[0087] Table 2 Comparison of the effects of molecular selection and phenotypic selection on egg weight breeding
[0088]
[0089] 1 Means with different letters indicate significant differences in the means between groups (P<0.05)
[0090] The present invention discloses an SNP molecular marker for assisting in the breeding of egg weight and its application. g.180943087G>C is a sequence variation located in the first intron of the RDX gene. The g.180943087G>C mutation site contains two alleles, C and G, which can form three genotypes: CC, CG, and GG. Among them, the CC genotype is associated with large egg weight. The DNA fragment containing the g.180943087G>C site is amplified by PCR, and the genotype of the sample to be tested can be determined by Sanger sequencing. Selecting hens and roosters with the CC genotype to form a population can breed and improve the egg weight of the chicken flock. Compared with the traditional phenotypic selection method, the present invention is not restricted by the gender and age of individuals, can be implemented when the chickens hatch, significantly shortens the breeding cycle, reduces the breeding cost, and accelerates the breeding process of egg weight.
[0091] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the core inventive content of the present invention shall be included within the protection scope of the present invention.
Claims
1. An SNP molecular marker for assisting in the breeding of egg weight, characterized in that, The SNP molecular marker is g.180943087G>C, and the SNP molecular marker is derived from the RDX gene; The physical position of the SNP molecular marker in the chicken Galgal6.0 reference genome is Chr1:180943087, its alleles are C and G, and its accession number in the NCBI dbSNP database is rs315113039; The genotypes of the SNP molecular marker include CC genotype, CG genotype and GG genotype. Among them, the relationship of egg weight of individuals with each genotype is: CC genotype > CG genotype, CG genotype > GG genotype.
2. A method for breeding egg weight based on the SNP molecular marker described in claim 1, characterized in that, Including: Detect the genotype of the SNP molecular marker of the chicken to be tested, and select the chicken individuals with the CC genotype to increase the average egg weight of the chicken flock.
3. The method for selecting and breeding eggs according to claim 2, characterized in that The breeding method is implemented at the chick stage.
4. A kit for detecting the genotype of the SNP molecular marker described in claim 1, characterized in that, The kit contains reagents for detecting the genotype of the SNP molecular marker.
5. A method for detecting the genotype of the SNP molecular marker according to claim 1, characterized in that, The detection method includes any one of the following methods: PCR amplification combined with Sanger sequencing method and next-generation genome sequencing method.
6. The detection method according to claim 5, characterized in that, When using the PCR amplification combined with Sanger sequencing method, the primer pair used for PCR amplification includes: Forward strand: 5’-CTTACAGCCTTCCTCCTTAC-3’; Reverse strand: 5’-AATAGCACAAATGCCAACAC-3’; The primer pair is used to specifically amplify the DNA fragment containing the molecular marker.
7. Application of the detection method of the SNP molecular marker genotype described in claim 5 in the breeding of egg weight.
8. A gene editing method, characterized in that, Edit through gene editing technology The genotype of the SNP molecular marker described in claim 1 is used for the breeding of egg weight.