40S ribosomal protein SA molecular marker and application thereof in prawn multi-trait selection

By screening the SNP sites marked by 40S ribosomal protein SA molecular in South American white shrimp, the lack of disease resistance and stress resistance in breeding was solved, efficient and accurate breeding effects were achieved, and new varieties with disease resistance and strong stress resistance were selected.

CN120400367APending Publication Date: 2025-08-01NAT AQUATIC TECH PROMOTION STATION +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510670628.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

The prior art lacks single nucleotide polymorphism (SNP) molecular markers related to disease resistance and stress resistance traits in South American white shrimp, resulting in slow breeding and inefficient breeding.

Method used

The 40S ribosomal protein SA molecular marker was developed, and SNP sites related to traits such as Vibrio parahaemolyticus, cold-resistant, and nitroso-resistant were screened, and the genotype was determined using PCR amplification and sequencing technology to be used for breeding of South American white shrimps.

Benefits of technology

It provides efficient and accurate breeding methods, and selects and breeds new varieties of South American white shrimp that are stable and have strong stress resistance, improving breeding efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120400367A_ABST
    Figure CN120400367A_ABST
Patent Text Reader

Abstract

The invention discloses a 40S ribosomal protein SA molecular marker, the nucleotide sequence of the 40S ribosomal protein SA molecular marker is shown as a sequence 1 in a sequence table, and the basic group on the 175th site is C or T. The molecular marker is applied to breeding of penaeus vannamei boone, specifically, genome DNA of muscular tissue of penaeus vannamei boone to be detected is extracted, the genome DNA is used as a template for PCR amplification and purification of a PCR amplification product, then the obtained product is sequenced, the genotype of the 175th site in the molecular marker is determined, and the molecular marker is used for breeding of penaeus vannamei boone. Therefore, genotype individuals with advantages are selected for breeding the penaeus vannamei boone, and research and application of disease-resistant and stress-resistant breeding of the penaeus vannamei boone are promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a 40S ribosomal protein SA molecular marker and its application in multi-trait selection of penaeid shrimps. Background Art

[0002] Litopenaeus vannamei, also known as Pacific white shrimp ( Penaeus vannamei ) is one of the aquatic economic animals with the highest aquaculture production in China. However, with the continuous increase in aquaculture density and feed feeding intensity, as well as the increasingly deteriorating aquaculture environment and continuous degradation of germplasm resources, the immunity and stress resistance of penaeid shrimps have significantly decreased, diseases occur frequently, which seriously restricts the sustainable development of the penaeid shrimp aquaculture industry. Therefore, cultivating new strains of Litopenaeus vannamei with advantages in disease resistance and stress resistance has become the key way to solve the current aquaculture dilemma.

[0003] Ribosomal protein SA (RPSA) is a multifunctional protein widely distributed in cells. Its functions include participating in ribosome biosynthesis and translation, cell migration and growth, cytoskeleton remodeling, and interaction with histones. In addition, studies have found that RPSA plays an important role in the resistance of crustaceans to pathogen infection, and it can serve as a receptor for viruses. After its silencing, the load of WSSV in the hemolymph of Cherax quadricarinatus can be significantly reduced. At the same time, RPSA plays an important role in the homeostasis of hemocytes in Litopenaeus vannamei. After its silencing, the number of peripheral hemocytes will be significantly reduced. Therefore, RPSA has a certain correlation with the traits of disease resistance and stress resistance of penaeid shrimps.

[0004] Single Nucleotide Polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level, which has the advantages of high coverage, good genetic stability, and convenient genotyping. At present, it has been widely used in the association analysis of economic traits and genetic variation of crustaceans, and has become an important tool to accelerate the breeding process. SNP can significantly affect the susceptibility or resistance of the host to biological or abiotic stresses through various mechanisms such as regulating gene transcription efficiency, translation process, and protein structure. Given the significant correlation between SNP and disease resistance and stress resistance traits, it has been widely used in the disease resistance and stress resistance breeding of aquatic animals. However, there is still a lack of development and application of SNP molecular markers related to stress resistance and disease resistance traits in Litopenaeus vannamei. Summary of the Invention

[0005] In response to the above-mentioned shortcomings, the present invention discloses a 40S ribosomal protein SA molecular marker and its application in the selection of multiple traits of shrimp. Based on the ribosomal protein SA gene (40S ribosomal protein SA) of white shrimp, SNP sites related to multiple traits such as resistance to Vibrio parahaemolyticus, cold resistance, and nitrite resistance were screened and obtained, and used as functional markers to provide further scientific basis and technical support for the breeding-related work of white shrimp.

[0006] The present invention is achieved by adopting the following technical solutions: A 40S ribosomal protein SA molecular marker, the nucleic acid sequence of which is shown in Sequence 1 in the sequence listing, wherein the base at position 175 is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous. The molecular marker is associated with traits such as resistance to Vibrio parahaemolyticus, cold tolerance, and nitrite-nitrogen tolerance in whiteleg shrimp.

[0007] The application of the 40S ribosomal protein SA molecular marker in the multi-trait selection of shrimp is to use the molecular marker for the breeding of whiteleg shrimp (Penaeus vannamei), specifically by extracting genomic DNA from muscle tissue of the tested whiteleg shrimp, then using the genomic DNA as a template for PCR amplification and purifying the PCR amplification product, and then sequencing the obtained product to determine the genotype of the 175th site in the molecular marker; When the genotype at position 175 is the TT genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp for resistance to Vibrio parahaemolyticus and / or breeding of whiteleg shrimp for cold tolerance; When the genotype at position 175 is CT, the individual is selected as a reserve parent for breeding of whiteleg shrimp for the nitrite-tolerance trait.

[0008] Furthermore, a primer combination for molecular markers related to disease resistance and stress resistance traits of whiteleg shrimp is used in the PCR amplification, and the primer combination includes the following primers: primer F: GGATGCTGAAGAGCAAGAGA (as shown in sequence 2 in the sequence listing); primer R: TTACCAGTTGGGTCCATCAG (as shown in sequence 3 in the sequence listing).

[0009] Furthermore, the PCR amplification system includes the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template.

[0010] Furthermore, the reaction procedure of the PCR amplification includes the following steps: S1. Pre-denature at 95°C for 5 min; S2. Denature at 95°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 30 s, and perform 34 cycles; S3. Extend at 72°C for 5 min.

[0011] The beneficial effects of this technical solution compared with the prior art are as follows: The present invention provides a molecular marker closely related to multiple traits such as Vibrio parahaemolyticus resistance, cold tolerance, and nitrite nitrogen tolerance of Litopenaeus vannamei, namely the 40S ribosomal protein SA molecular marker, which can be applied to the breeding of new Litopenaeus vannamei varieties resistant to Vibrio parahaemolyticus, and is conducive to promoting the research and application of disease-resistant and stress-resistant breeding of Litopenaeus vannamei. By using the method of the present invention to breed Litopenaeus vannamei with multiple traits such as Vibrio parahaemolyticus resistance, cold tolerance, and nitrite nitrogen tolerance, the genotypes of the selected individuals are stable and do not undergo genetic differentiation, and the breeding efficiency and accuracy are high, providing a good basis for the research on the breeding and improvement of Litopenaeus vannamei varieties. Description of the Drawings

[0012] Figure 1 [[ID=1,9]]is a partial fragment sequence (from the 170th to the 180th position) of the product obtained after PCR amplification in Example 2, which shows the CC, CT, and TT peak maps at the 175th position. Detailed Embodiments

[0013] The present invention is further illustrated by the following examples, which shall not be construed as limiting the present invention. For the specific experimental conditions and methods not specified in the following examples, the technical means adopted are usually conventional means well known to those skilled in the art.

[0014] Example 1: The screening process of the molecular marker related to the Vibrio parahaemolyticus resistance trait of Litopenaeus vannamei based on 40S ribosomal protein SA of the present invention is as follows: (1) 245 Litopenaeus vannamei with a body weight of about 20 g were collected from the Litopenaeus vannamei breeding farm in Fangchenggang City, Guangxi Zhuang Autonomous Region. After 5 days of temporary cultivation, 100 μL of Vibrio parahaemolyticus with a concentration of 7×10 6 cfu / mL was injected into the Litopenaeus vannamei individuals; in order to exclude the death caused by the injection factor, the dead individuals were recorded starting from 6 hours after the challenge, and 60 Litopenaeus vannamei that died first and 60 Litopenaeus vannamei that still survived after 96 hours were respectively selected as samples of the Vibrio parahaemolyticus-sensitive group and the Vibrio parahaemolyticus-tolerant group of Litopenaeus vannamei; (2)Randomly select 5 Litopenaeus vannamei in the Vibrio parahaemolyticus - sensitive group and the Vibrio parahaemolyticus - tolerant group respectively, extract muscle tissues and extract genomic DNA using the conventional phenol - chloroform extraction method. Store the obtained genomic DNA at - 20 °C for future use; (3)Design a primer pair according to the 40S ribosomal protein SA gene sequence of Litopenaeus vannamei (accession number: NW_02086 * 9274.1). The primer pair includes primer F: GGATGCTGAAGAGCAAGAGA and primer R: TTACCAGTTGGGTCCATCAG; Use genomic DNA as a template and configure a PCR amplification system with the above - mentioned primer pair. It specifically includes the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template; At the same time, set the reaction procedure for PCR amplification, which includes the following steps: S1. Pre - denature at 95 °C for 5 min; S2. Denature at 95 °C for 30 s, anneal at 60 °C for 30 s, extend at 72 °C for 30 s, and perform 34 cycles; S3. Extend at 72 °C for 5 min; (4)Perform PCR amplification on the genomic DNA obtained in step (2) according to the content described in step (3). Use the obtained amplification product as a molecular marker related to the disease - resistance and stress - resistance traits of Litopenaeus vannamei. After detection by 1% agarose gel electrophoresis and purification and sequencing, use DNAstar software to perform alignment analysis on the sequencing results, including nucleotide sequence alignment and peak map analysis. Screen out the relevant SNPs locus to obtain the 175th locus, denoted as D. 7954, and the base at this locus is C or T; (5)Detect and genotype the Litopenaeus vannamei in the Vibrio parahaemolyticus - sensitive group and the Vibrio parahaemolyticus - tolerant group according to the methods described in steps (2) - (4). Analyze the D.7954 locus in the samples of the Vibrio parahaemolyticus - sensitive group and the Vibrio parahaemolyticus - tolerant group, calculate the genotype frequency and allele frequency, and perform a chi - square analysis for independence test. The specific results are shown in Table 1.

[0015] According to the analysis of Table 1, the genotype polymorphism of D. 7954 has a significant impact on the Vibrio parahaemolyticus - resistance trait of Litopenaeus vannamei: among them, the TT - genotype individuals have better Vibrio parahaemolyticus - resistance performance than the CT - genotype. TT - type individuals can be selected as reserve parents for breeding Litopenaeus vannamei varieties with Vibrio parahaemolyticus - resistance traits.

[0016] Table 1 Genotype and Allele Frequency Distribution (Vibrio parahaemolyticus Resistance Trait)

[0017] Example 2: The screening process of the molecular marker related to the cold tolerance trait of 40S ribosomal protein SA in Litopenaeus vannamei of the present invention is as follows: (1) 245 Litopenaeus vannamei with a body weight of about 20 grams were collected from the Litopenaeus vannamei breeding farm in Fangchenggang City, Guangxi Zhuang Autonomous Region. After 2 days of temporary cultivation, a cold tolerance experiment was carried out with 9.5 - 10.5 °C as the stress condition. The first 45 shrimps that died were used as the low-temperature sensitive group, and the last 45 surviving shrimps were used as the low-temperature tolerant group; (2) The low-temperature sensitive group and the low-temperature tolerant group obtained in step (1) were used as samples. The genomic DNA of the muscle tissue of Litopenaeus vannamei was extracted by the ammonium acetate / isopropanol method. The quality and integrity of the extracted DNA were detected by a ultra-micro ultraviolet spectrophotometer and agarose gel electrophoresis. The obtained genomic DNA was stored at -20 °C for later use; (3) PCR amplification was carried out according to the method described in step (3) of Example 1. The PCR amplification products were detected by 1% agarose gel electrophoresis and then purified and sequenced. The sequencing results were analyzed by DNAstar software, including nucleotide sequence alignment and peak map analysis. The genotype at the 175th site (D. 7954) was examined, the genotype frequency and allele frequency were calculated, and chi-square analysis was used for independence test. The specific results are shown in Table 2.

[0018] According to the analysis of Table 2, the genotype polymorphism of D. 7954 has a significant effect on the cold tolerance trait of Litopenaeus vannamei: The anti-Vibrio parahaemolyticus performance of the TT genotype individuals of D. 7954 is better than that of the CC and CT genotypes. TT genotype individuals can be selected as the reserve parents for the breeding of cold tolerance traits in Litopenaeus vannamei.

[0019] Table 2 Genotype and Allele Frequency Distribution (Cold Tolerance Trait)

[0020] Example 3: The screening process of the molecular marker related to the nitrite nitrogen tolerance trait of 40S ribosomal protein SA in Litopenaeus vannamei of the present invention is as follows: (1)245 white shrimps with a body weight of about 10 grams were collected from a white shrimp breeding farm in Fangchenggang City, Guangxi Zhuang Autonomous Region. After 3 days of temporary cultivation, plastic round barrels with a volume of 1000 L were filled with 500 L of aquaculture water, and analytical pure sodium nitrite was added to make the concentration of the experimental water 757.18 mg / L. Then, 30 white shrimps were put into each barrel for the nitrite nitrogen stress experiment. During the whole experiment, the pool water was kept aerated, the pH value was maintained at 8.2 ± 0.3, the temperature was maintained at 27 ± 0.5 °C, the salinity was maintained at 30.0‰, and the dissolved oxygen was maintained at 7 - 8 mg / L. No feed was fed during the experiment to maintain the nitrite nitrogen experimental concentration. Fresh water was changed every 24 hours during the experiment, and the concentration of sodium nitrite was readjusted to 757.18 mg / L. When the white shrimps turned over and did not swim away quickly or showed no obvious reaction when touched with a wooden stick and still remained in the overturned position, they were considered dead. After 3 hours of stress, the dead individuals were recorded. 55 white shrimps that died between 3 - 12 h and 57 white shrimps that were still alive after 96 hours were selected as the nitrite nitrogen sensitive group and the nitrite nitrogen tolerant group, respectively; (2)The low - temperature sensitive group and the low - temperature tolerant group obtained in step (1) were used as samples. The genomic DNA of the muscle tissue of white shrimps was extracted by the ammonium acetate / isopropanol method. The quality and integrity of the extracted DNA were detected by a ultra - micro ultraviolet spectrophotometer and agarose gel electrophoresis. The obtained genomic DNA was stored at - 20 °C for later use; (3)PCR amplification was carried out according to the method described in step (3) of Example 1. The PCR amplification products were detected by 1% agarose gel electrophoresis, purified and sequenced. Then, the DNAstar software was used to compare and analyze the sequencing results, including nucleotide sequence alignment and peak map analysis. The genotype at the 175th site (D. 7954) was examined, and the genotype frequency and allele frequency were calculated. Chi - square analysis was used for independence test. The specific results are shown in Table 3.

[0021] According to the analysis in Table 3, the genotype polymorphism of D. 7954 has a significant effect on the nitrite nitrogen tolerance trait of white shrimps: The CT genotype individuals of D. 7954 have better Vibrio parahaemolyticus resistance performance than the CC and TT genotypes. CT - type individuals can be selected as the reserve parents for breeding white shrimp varieties with nitrite nitrogen tolerance traits.

[0022] Table 3 Distribution of genotype and allele frequencies (nitrite nitrogen tolerance trait)

[0023] In addition, it should be understood that although this specification is described in terms of embodiments, not every embodiment contains only an independent technical solution. This narrative manner of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A 40S ribosomal protein SA molecular marker, characterized in that: The nucleic acid sequence of the molecular marker is as shown in Sequence 1 in the sequence listing, wherein the base at the 175th position is C or T.

2. Use of the 40S ribosomal protein SA molecular marker according to claim 1 in multi-trait selection of penaeid shrimp, characterized in that: The molecular marker is used for the breeding of Litopenaeus vannamei. Specifically, genomic DNA of the muscle tissue of the Litopenaeus vannamei to be tested is extracted, and then the genomic DNA is used as a template for PCR amplification and purification of the PCR amplification product. Then, the obtained product is sequenced to determine the genotype of the 175th position in the molecular marker. When the genotype of the 175th position is the TT genotype, select this individual as a candidate parent for the variety breeding of Litopenaeus vannamei with Vibrio parahaemolyticus resistance trait and / or the variety breeding of Litopenaeus vannamei with cold tolerance trait. When the genotype of the 175th position is the CT genotype, select this individual as a candidate parent for the variety breeding of Litopenaeus vannamei with nitrite nitrogen tolerance trait.

3. The application according to claim 2, wherein: In the PCR amplification, a primer combination for molecular markers related to disease resistance and stress resistance traits of Litopenaeus vannamei is used. The primer combination includes the following primers: Primer F: GGATGCTGAAGAGCAAGAGA; Primer R: TTACCAGTTGGGTCCATCAG.

4. The application according to claim 3, characterized in that: The amplification system of the PCR amplification includes the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of Primer F, 0.5 μL of Primer R, 14.4 μL of ddH2O, 2.0 μL of template.

5. The application according to claim 2, wherein: The reaction procedure of the PCR amplification includes the following steps: S1. Pre-denature at 95 °C for 5 min. [[ID= ​