Specific primers for identifying vibrio parahaemolyticus kut2 type strain and fluorescent PCR detection method

Abstract

The present application relates to the technical field of molecular diagnosis, and discloses specific primers and a fluorescent PCR detection method for identifying Vibrio parahaemolyticus KUT2 type strains, and provides primers KUT2-F / R and a TaqMan probe for identifying Vibrio parahaemolyticus KUT2 type strains, and establishes a fluorescent PCR method (TaqMan probe method). The present application can quickly identify the main Vibrio parahaemolyticus KUT type prevailing in diarrhea patients in China, expand the Vibrio parahaemolyticus serotyping system, and provide a more accurate tool for epidemiological investigation and tracing. The present application has reached the level of the fluorescent PCR technology in terms of amplification efficiency, sensitivity and specificity, thereby realizing efficient and specific detection of KUT strains, and can judge whether the strain is the main KUT type prevailing in China within 1 hour, and fully meets the actual use detection requirements.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular diagnosis, in particular to a specific primer and a fluorescent PCR detection method for identifying Vibrio parahaemolyticus KUT2 strain. Background Art

[0002] Vibrio parahaemolyticus ( Vibrio parahaemolyticus V. parahaemolyticus (V. parahaemolyticus) is a Gram-negative, halophilic bacterium widely found in marine and estuarine environments. It is a major foodborne pathogen, primarily causing gastroenteritis in humans. Serotyping, as an important typing method, is crucial in epidemiological investigations of V. parahaemolyticus. Identification of the strain's O antigen (lipopolysaccharide) and K antigen (capsular polysaccharide) allows for differentiation of different serotypes, thereby tracing the source and transmission of the disease and identifying high-risk strains. To date, 13 O antigens and 71 K antigens have been identified. Certain serotypes, such as O3:K6 and its variants, have caused large-scale outbreaks worldwide.

[0003] K typing is an important part of the serological typing of Vibrio parahaemolyticus. However, some strains cannot be K typed due to the lack of specific K antigen or loss of K antigen expression, and are called K type untypeable (KUT) strains. The prevalence of KUT strains in different regions varies significantly. In the Black Sea region of Turkey, O4:KUT, O2:KUT and O3:KUT have all been found, and there are trh -The dominant clone of positive strains. In Bangladesh, O1:KUT and O3:KUT are among the dominant serotypes. In India, OUT:KUT and O1:KUT are common serotypes among strains isolated from oysters. In Thailand, studies of clinical samples and oyster isolates found that O3:K6 was the most common serotype, followed by OUT:KUT and O4:K9. From 2018 to 2022, the detection rate of Vibrio parahaemolyticus in diarrheal cases in a certain region in northern my country was 6.83%, of which the O4:KUT serotype accounted for 10.34%. In the southeastern coastal areas of China, the prevalence of O4:KUT even exceeded that of O3:K6 in some years. These findings emphasize the importance of continuous monitoring of KUT strains to keep abreast of their epidemic trends and potential risks.

[0004] The pathogenicity of Vibrio parahaemolyticus is primarily related to the toxins it produces, such as thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH). Studies have shown that some KUT strains carry genes encoding TDH and TRH, increasing their pathogenicity. Therefore, KUT strains remain important in clinical infection and epidemiological investigations.

[0005] Strains identified as KUT by serum agglutination are currently distinguished and analyzed for their phylogenetic relationship by molecular typing methods such as pulsed-field gel electrophoresis (PFGE), multilocus variable number of tandem repeat analysis (MLVA), etc. Whole genome sequence and multilocus sequence typing (MLST) data are also often used to construct phylogenetic trees, revealing the evolutionary status of KUT strains in the entire Vibrio parahaemolyticus population and analyzing their phylogenetic relationship with other strains. During the monitoring of diarrhea pathogens, we found a group of KUT strains from diarrhea samples. Through whole genome sequence analysis, a maximum likelihood tree was constructed based on sNP in the non-repetitive and non-recombinant region of the whole genome, and it was found that these strains formed several branches that were independent of each other and had a relatively long genetic distance. The two main branches were named KUT1 and KUT2. KUT1 type strains are distributed in provinces such as Guangdong, Zhejiang, Shanghai, Jiangsu, Shandong, Beijing and Liaoning, and KUT2 type strains are distributed in provinces such as Guangdong, Zhejiang, Shanghai, Shandong, Beijing and Liaoning. However, given the lack of effective K antiserum, rapid identification of KUT strains remains difficult, and the development of an efficient molecular identification technique is particularly critical. SUMMARY

[0006] The purpose of the present application is to provide specific primers and fluorescent PCR detection methods for identifying Vibrio parahaemolyticus KUT2 type strains.

[0007] To achieve the purpose of the present application, in a first aspect, the present application provides specific primers for identifying Vibrio parahaemolyticus KUT2 type strains, comprising: primers KUT2-F and KUT2-R for identifying Vibrio parahaemolyticus KUT2 type strains;

[0008] The primer sequences are as follows (5'-3'):

[0009] KUT2-F: GGTTGTGTTACTGATGACCTTAA;

[0010] KUT2-R: GGCTTAGATAAATTACTGACTCTATAATTG.

[0011] In a second aspect, the present application provides a probe for use with the primers, wherein the probe for use with the primers KUT2-F and KUT2-R is KUT1-P.

[0012] The probe sequence is as follows (5'-3'): F-TCTACAATTCCTCCTGCCAACTTCATC-Q;

[0013] Wherein F is a fluorescent group and Q is a quenching group.

[0014] Preferably, F is HEX and Q is BHQ1.

[0015] In a third aspect, the present application provides a detection reagent or kit containing the primer and / or the probe.

[0016] In a fourth aspect, the present application provides a fluorescent PCR detection method for Vibrio parahaemolyticus KUT2 type strain (for non-disease diagnosis purposes), which utilizes the primer and the probe, or utilizes the detection reagent or kit containing the primer and the probe to perform fluorescent PCR detection on a sample to be tested.

[0017] Preferably, the PCR reaction system is: 2x PCR Premix 10 μL, primer mixture 0.4 μL, probe 0.4 μL, pure water 7.2 μL, and DNA template 2 μL.

[0018] In the primer mixture, the concentration of the primers KUT2-F and KUT2-R is 10 mM.

[0019] The concentration of the probe is 10 mM.

[0020] The PCR reaction conditions are: 90-95℃ for 30-120s; 90-95℃ for 5-30s, 56-60℃ for 10-60s, 20-40 cycles; and the fluorescence signal is collected at the end of each cycle.

[0021] Preferably, the PCR reaction conditions are: 95℃ for 1 min; 95℃ for 10s, 60℃ for 30s, 40 cycles; and the fluorescence signal is collected at 60℃.

[0022] Further, according to the amplification result, if Cq≤35, it is determined to be positive, i.e., the sample to be tested contains Vibrio parahaemolyticus KUT2 type strain; and if Cq>35, it is determined to be negative, i.e., the sample to be tested does not contain Vibrio parahaemolyticus KUT2 type strain.

[0023] By means of the above technical solution, the present application has at least the following advantages and beneficial effects:

[0024] The present application can quickly identify the main Vibrio parahaemolyticus KUT type prevalent among diarrhea patients in China, expand the serotyping system of Vibrio parahaemolyticus, and provide a more accurate tool for epidemiological investigation and tracing. The technology adopted by the present application has reached the level of fluorescent PCR technology in terms of amplification efficiency, sensitivity and specificity, and can fully meet the actual use detection requirements.

[0025] The application focuses on KUT type which has important public health significance, and provides technical support for diarrhea disease monitoring and tracing. The KUT2 type strains used in the method are isolated from diarrhea patients in China and widely distributed in China. The application is applied to diarrhea pathogen detection and tracing investigation, and can provide key basis for early diagnosis, early warning and outbreak response, and is helpful to control the spread of the corresponding infection and protect the health and safety of the public.

[0026] The application uses fluorescent PCR method (TaqMan probe method) to realize efficient and specific detection of KUT2 type strains, and can judge whether the strain is the main KUT type prevailing in China within 1 hour. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 The amplification curve and standard curve of the KUT1 type positive reference strain ICDC-VP1716 genomic nucleic acid in the preferred embodiment of the application are shown in the figure. The slope is -3.3876, and the amplification efficiency E=10 -1 / slope -1: 97.33%.

[0028] Figure 2 The amplification curve and standard curve of the KUT2 type positive reference strain ICDC-VP1272 genomic nucleic acid in the preferred embodiment of the application are shown in the figure. The slope is -3.3028, and the amplification efficiency E=10 -1 / slope -1: 100.80%. DETAILED DESCRIPTION

[0029] At present, by molecular typing and constructing phylogenetic tree, the genetic relationship of KUT strains can be identified and analyzed to a certain extent, and higher resolution detection can be realized. However, these methods are usually complicated and require high professional skills and experimental conditions.

[0030] Compared with fluorescent PCR, the sensitivity of ordinary PCR is lower, and the amplification product needs to be detected by electrophoresis, which is complicated and easy to cause pollution of the amplification product to the detection environment.

[0031] Fluorescent PCR is one of the most commonly used nucleic acid detection methods, which has many advantages: high sensitivity, can detect very low concentration of nucleic acid; good specificity, accurately identifies target sequences; simple operation, saves time for detection; closed system reduces product diffusion and reduces pollution risk; the results are intuitive, presented in curves or numerical values, which are easy to quickly interpret. These characteristics make it widely used in many fields. The application applies fluorescent PCR method to the detection of specific genes of main KUT type of Vibrio parahaemolyticus, which can quickly identify related KUT strains.

[0032] The application adopts the following technical solutions:

[0033] The present application provides a fluorescent PCR method for detecting Vibrio parahaemolyticus KUT type. Through whole genome sequence analysis, we found that the KUT type Vibrio parahaemolyticus prevalent in diarrhea patients in multiple provinces in China is mainly KUT1 and KUT2 type. Through in-depth analysis of the K antigen gene cluster sequence of the strain, we screened out specific genes in KUT type strains that are conserved and significantly different from other K type strains wzy (the target sequence for detecting KUT1 type strain is located at 16451-17770 bp of NCBI No. MT898055.1 (Vibrio parahaemolyticus strain VP410 capsule biosythesis gene cluster, complete sequence); the target sequence for detecting KUT2 type strain is located at 14957-16459 bp of NCBI No. MT898406.1 (Vibrio parahaemolyticus strain VP412 capsule biosythesis gene cluster, complete sequence)), and accordingly designed primers (KUT1-F / R, KUT2-F / R) and probes (KUT1-P, KUT2-P) capable of recognizing KUT type, thereby realizing efficient and specific detection of KUT1 type and KUT2 type strains by fluorescent PCR method. Vibrio parahaemolyticus Vibrio parahaemolyticus The following examples are used to illustrate the present application, but are not used to limit the scope of the present application. If not specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art, and the raw materials used are commercially available goods.

[0034] The following examples are used to illustrate the present application, but are not used to limit the scope of the present application. If not specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art, and the raw materials used are commercially available goods.

[0035] Example 1 Development of specific primers for identifying Vibrio parahaemolyticus KUT1 and KUT2 type strains

[0036] (1) Primer and probe design

[0037] We designed specific primers and probes for KUT1 and KUT2 type strains according to the KUT1 and KUT2 type strain wzy ​The gene sequence was designed with four groups of primers and probes (Table 1 and Table 2), wherein the first group and the second group of probes were labeled with Minor Groove Binder (MGB) at the 3' end, and the third group and the fourth group of probes were labeled with quenching group BHQ1 at the 3' end. The amplification effect of the four groups of primers and probes was preliminarily verified by taking the serial dilutions of the nucleic acid of the positive strain as the template. The results showed that the amplification efficiency of the two groups containing the MGB-labeled probes was 75%-90%, and even if the annealing temperature was reduced to 56℃, the amplification efficiency could not reach more than 90%; the amplification efficiency of the two groups containing the BHQ1-labeled probes was 90%-110%, but the fluorescence signal intensity at the plateau was different. According to the standards of high fluorescence signal intensity, typical "S" shape of amplification curve and amplification efficiency of 90%-110%, the third group of primers and probes for KUT1 (Table 3) and the fourth group of primers and probes for KUT2 (Table 4) were finally selected for strain detection.

[0038] Table 1 Sequences of the four groups of primers and probes for KUT1 are as follows:

[0039]

[0040] Table 2 Sequences of the four groups of primers and probes for KUT2 are as follows:

[0041]

[0042] Table 3 Selected primers and probes for KUT1

[0043]

[0044] The length of the KUT1-F / R amplification product is 102 bp.

[0045] Table 4 Selected primers and probes for KUT2

[0046]

[0047] The length of the KUT2-F / R amplification product is 134 bp.

[0048] (2) Reaction system (Table 5)

[0049] Table 5 Reaction system

[0050]

[0051] (3) Amplification conditions

[0052] 95℃ 1min; 95℃ 10s, 60℃ 30s, cycle 40 times, and detect fluorescence at the annealing stage (60℃).

[0053] (4) Result interpretation

[0054] Cq≤35 is determined as positive.

[0055] Example 2 Amplification efficiency investigation

[0056] The positive reference strains ICDC-VP1716 (KUT1 type, National Pathogenic Microorganism Resource Library No. NPRC(S)01.0025) and ICDC-VP1272 (KUT2 type, National Pathogenic Microorganism Resource Library No. NPRC(S)01.0019) were extracted from fresh culture on ordinary nutrient agar to obtain genomic nucleic acid, and 10-fold serial dilutions were performed with deionized water. 10 -3 copies / µL, and the target gene fragment concentration of ICDC-VP1716 was 2.35×10 -3 copies / µL. 4 copies / µL. 4

[0057] 10 -1 ~10 -6 dilutions were used as templates, and 3 holes were repeated for each dilution. The standard curve was established with the logarithmic value of the target gene fragment copy number as the abscissa and the fluorescence PCR cycle threshold value (Ct value) as the ordinate. The amplification efficiency of the detection system was calculated according to the slope of the straight line. The results showed that the amplification efficiencies of KUT1 and KUT2 detection systems were 97.33% and 100.80%, respectively, which met the general requirements. The KUT1 and KUT2 amplification curves and standard curves are shown in Figure 1 and Figure 2

[0058] Example 3 Detection limit investigation

[0059] The 10 -6 dilutions of the genomic nucleic acid of the positive reference strain were serially diluted by 2-fold. Six dilutions from 1:1 to 1:32 were used as templates for fluorescence PCR detection, with 8 holes repeated for each dilution. The lowest concentration that was positive in 8 tests was the lowest detection limit (LOD) of the reaction. As shown in Tables 6 and 7, the LOD of this method for KUT1 type strains was 11.78 copies / reaction, and for KUT2 type strains was 9.63 copies / reaction.

[0060] Table 6 Lowest detection limit (LOD) for detection of genomic nucleic acid of positive reference strain ICDC-VP1716

[0061] ​​

[0062] Ct: cycle threshold of the fluorescent PCR reaction.

[0063] Table 7 Minimum detection limit (LOD) of the genomic nucleic acid detection of the positive reference strain ICDC-VP127

[0064]

[0065] Ct: cycle threshold of the fluorescent PCR reaction.

[0066] Example 4 Specificity investigation

[0067] To verify the specificity of the method, a total of 151 strains were selected for the experiment. These strains include 10 strains of Vibrio parahaemolyticus identified as KUT1 type based on genomic sequence, 9 strains of Vibrio parahaemolyticus identified as KUT2 type, 99 strains of Vibrio parahaemolyticus of other known serotypes, and 12 strains of other pathogenic Vibrio (6 strains of Vibrio cholerae, 2 strains of Vibrio fluvialis and Vibrio vulnificus, 1 strain of Vibrio mimicus and Vibrio alginolyticus). In addition, 6 strains of Salmonella (2 strains of Salmonella typhi, Salmonella typhimurium and Salmonella enteritidis, respectively), 5 strains of diarrheal E. coli (1 strain of E. coli enterohemorrhagic, enterotoxigenic, enteroinvasive, enteropathogenic and enteropathogenic, respectively), 2 strains of Shigella, Plesiomonas shigelloides, Clostridium perfringens, respectively, and 1 strain of Citrobacter freundii, Listeria monocytogenes, Staphylococcus aureus, Edwardsiella tarda, respectively. The results showed that only Vibrio parahaemolyticus identified as KUT1 type or KUT2 type based on genomic sequence showed positive in the corresponding detection, and other strains showed negative. This method showed 100% specificity.

[0068] Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application claimed.

Claims

1. Specific primers and probes for identifying Vibrio parahaemolyticus KUT2 strains, characterized in that: include: Primers KUT2-F and KUT2-R for identifying V. parahaemolyticus KUT2 strains; The primer sequences 5'-3' are as follows: KUT2-F: GGTTGTGTTACTGATGACCTTAA KUT2-R: GGCTTAGATAAATTACTGACTCTATAATTG; The probe used in conjunction with the primers KUT2-F and KUT2-R is KUT2-P; The probe sequences were as follows 5′-3′: F-TCTACAATTCCTCCTGCCAACTTCATC-Q; Among them, F is the fluorescent group HEX and Q is the quenching group BHQ1.

2. A detection reagent or kit comprising the primers and probes according to claim 1.

3. A fluorescent PCR detection method for Vibrio parahaemolyticus KUT2 strain, characterized in that: Performing fluorescent PCR detection on a sample to be tested using the primers and probes described in claim 1, or using a detection reagent or kit containing the primers and probes; The method is not for disease diagnosis purposes.

4. The method according to claim 3, characterized in that The PCR reaction system was as follows: 2× PCR Premix 10 μL, primer mixture 0.4 μL, probe 0.4 μL, purified water 7.2 μL, and DNA template 2 μL; In the primer mixture, the concentrations of primers KUT2-F and KUT2-R were both 10 mM; The concentration of the probe was 10 mM.

5. The method according to claim 4, characterized in that The PCR reaction conditions were as follows: 90–95°C for 30–120 s; 90–95°C for 5–30 s, 56–60°C for 10–60 s, for 20–40 cycles; and fluorescence signals were collected at the end of each cycle.

6. The method according to any one of claims 3 to 5, characterized in that: The amplification results were judged as follows: if Cq≤35, it was judged as positive, that is, the sample to be tested contained Vibrio parahaemolyticus KUT2 strain; if Cq>35, it was judged as negative, that is, the sample to be tested did not contain Vibrio parahaemolyticus KUT2 strain.

Images