Fluorescent aptamer sensor for high-sensitivity detection of OTA and AFB1 and molecular logic gate construction method

Abstract

The invention discloses a fluorescent aptamer sensor for high-sensitivity detection of OTA and AFB1 and a molecular logic gate construction method, and provides a biosensing strategy based on non-competitive nucleic acid-ligand transduction and DNA enzyme coupling for high-sensitivity detection of two toxins of AFB1 and OTA. And the logic relationship between the two toxins is realized by utilizing an efficient non-competitive transduction platform for the first time. Besides, molecular logic gate intelligent detection between AFB1 and OTA is constructed based on the fluorescent aptamer sensor, high-sensitivity detection of aflatoxin B1 (AFB1) and / or ochratoxin A (OTA) is realized, the detection effect is stable, the detection precision is high, the detection limit is low, the detection time is short, and the fluorescent aptamer sensor has excellent practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of analytical detection, and particularly relates to a fluorescence aptamer sensor for highly sensitive detection of OTA and AFB1 and a method for constructing a molecular logic gate. Background Art

[0002] Mycotoxins are secondary metabolites produced by fungi such as Fusarium, Penicillium, and Aspergillus under suitable temperature and humidity conditions. Currently, common mycotoxins mainly include aflatoxin B1 (AFB1), ochratoxin A (OTA), deoxynivalenol (DON), zearalenone (ZEN), T-2 toxin (T-2), and fumonisin B1 (FB), etc. Most mycotoxins can inhibit the synthesis of proteins and related enzymes in animals, damage cell structures, and harm tissues and organs such as the liver, kidney, nerve, and hematopoiesis in animals. They have carcinogenic, teratogenic, mutagenic, reproductive disorder, and immunosuppressive effects. Moreover, mycotoxins are widely distributed, have small molecular weights, and their structures and chemical properties are generally uniform and stable, and they cannot be decomposed even by high-temperature cooking.

[0003] After agricultural products are contaminated with mycotoxins, multiple mycotoxins often coexist. Once these mycotoxins enter the human body through the food chain, they will seriously threaten human health. Therefore, it is particularly important to develop an intelligent method for detecting the content of mycotoxins in agricultural products.

[0004] In related technologies, the methods for detecting mycotoxins mainly include: high performance liquid chromatography (HPLC), thin layer chromatography (TLC), gas chromatography (GC), and liquid chromatography tandem mass spectrometry (LC-MS), etc. However, these methods all have relatively difficult-to-overcome defects. For example, they require large-scale instrument detection, resulting in high detection costs. Moreover, these detection methods are restricted by the instruments themselves, are relatively time-consuming, and cannot meet the requirements of intelligent and efficient detection.

[0005] In addition, there are biosensors for detecting mycotoxins constructed using nucleic acid aptamers and DNA enzymes. Most previous reports were based on competitive strategies, that is, the ligand needed to compete with an oligonucleotide chain that binds to the aptamer and is partially base-complementary to the aptamer. Once the ligand binds to the aptamer, the conformation of the aptamer will change, and the dissociation of the pre-formed aptamer duplex will release the complementary strand or expose the toehold for strand exchange reactions, thereby generating a detectable downstream signal. Although a large number of biosensors and bionanomaterials have been produced using this strategy of integrating ligands into strand displacement reactions, there are still some inevitable limitations in this design. First, the sequence design of the complementary strand to the aptamer requires careful optimization. If the number of bases complementary between the complementary strand and the aptamer is too large, a stable double strand will be generated, which will hinder the competition of the ligand. If the number of complementary bases is too small, an unstable double strand will be generated, resulting in a too high background. Therefore, it is difficult to control the balance between the conversion efficiency of the ligand and the oligonucleotide and signal leakage. Second, in order to partially cover the aptamer region, the sequence of the complementary strand must depend on the sequence of the aptamer strand, which will limit the flexibility of sequence design.

[0006] Therefore, there is an urgent need to develop a new method for intelligent detection of mycotoxins using molecular logic gates to obtain intelligent detection results, so as to effectively control the harm of mycotoxins. Summary of the Invention

[0007] Based on the above prior art, the present invention provides a fluorescence aptamer sensor for highly sensitive detection of OTA and AFB1 and a method for constructing a molecular logic gate. The present invention proposes a biosensing strategy based on non-competitive nucleic acid-ligand transduction and DNA enzyme coupling for highly sensitive detection of two toxins, AFB1 and OTA, and it is also the first to use its efficient non-competitive transduction platform to realize the logical relationship between the two toxins.

[0008] In addition, the present invention constructs an intelligent detection of a molecular logic gate between AFB1 and OTA based on a fluorescence aptamer sensor, realizing the highly sensitive detection of aflatoxin B1 (AFB1) and / or ochratoxin A (OTA), with stable detection effect, high detection accuracy, low detection limit, short detection time, and excellent practical application value.

[0009] The technical solution adopted to achieve the above object of the present invention is as follows:

[0010] A detection reagent for highly sensitive detection of OTA and AFB1, comprising a probe set composed of at least one of an invasive strand probe AFB1-OR for recognition, an invasive strand probe OTA-OR for recognition, an invasive strand probe AFB1-AND for recognition, an invasive strand probe OTA-AND for recognition, an invasive strand probe AFB1-ortho for recognition, and an invasive strand probe OTA-ortho for recognition;

[0011] The nucleotide sequence of the invasive strand probe AFB1-OR is:

[0012] GAGTCAACCTTCGTGTTGTCTCTCTGTGTCTCGTTGAGTGAGTCAGCGATTAAA, as shown in SEQ ID NO.1;

[0013] The nucleotide sequence of the invasive strand probe OTA-OR is:

[0014] GAGTCAACCTTGTCGGGTGTGGGTGGCGTAAAGGGAGCACTTGAGTGAGTCAGCGATTA, as shown in SEQ IDNO.2;

[0015] The nucleotide sequence of the invasive strand probe AFB1-AND is:

[0016] ACACCCATGTTGTCAGAGGTTCGTGTTGTCTCTCTGTGTCTCGTTCTACATTC, as shown in SEQ ID NO.3;

[0017] The nucleotide sequence of the invasive strand probe OTA-AND is:

[0018] AGTCAACCTTGTCGGGTGTGGGTGGCGTAAAGGGAGCACTTGAGTGAGTCAGCGATTA, as shown in SEQ IDNO.4;

[0019] The nucleotide sequence of the invasive strand probe AFB1-ortho is:

[0020] CTTACATCTTCGTGTTGTCTCTCTGTGTCTCGTTGAGTGAGTCAGCGATTAA, as shown in SEQ ID NO.5;

[0021] The nucleotide sequence of the invasive strand probe OTA-ortho is:

[0022] TGTGATAGCTTGTCGGGTGTGGGTGGCGTAAAGGGAGCACTTGGTCACTACAGCGATTA, as shown in SEQ IDNO.6.

[0023] A fluorescent aptamer sensor for highly sensitive detection of OTA and AFB1 comprises the detection reagent, complementary single-stranded bp-1, complementary single-stranded bp-2, complementary single-stranded bp-3, complementary single-stranded bp-4, deoxyribozyme DNAzyme-1, deoxyribozyme DNAzyme-2, substrate chain-1, and substrate chain-2, wherein the complementary single-stranded bp-1 and the complementary single-stranded bp-3 respectively form a duplex by base pairing with the deoxyribozyme DNAzyme-1, the complementary single-stranded bp-1 and the complementary single-stranded bp-2 simultaneously form a triplex by base pairing with both sides of the deoxyribozyme DNAzyme-1, and the complementary single-stranded bp-4 forms a duplex by base pairing with the deoxyribozyme DNAzyme-2.

[0024] The nucleotide sequence of DNAzyme-1 is:

[0025] AGTGAGTCAGCGATTAACCAGGTTACACCCATGTTGTCAGAG, as shown in SEQ ID NO. 7;

[0026] The nucleotide sequence of DNAzyme-2 is:

[0027] GTCACTACAGCGATTAACCAGGTTACACCCATGTCAGTTCTG, as shown in SEQ ID NO. 8;

[0028] The nucleotide sequence of single-stranded bp-1 is:

[0029] GTTAATCGCTGACTCACTCTTGGTTGACTC, as shown in SEQ ID NO.9;

[0030] The nucleotide sequence of single-stranded bp-2 is:

[0031] GAATGTAGTTCCTCTGACAACATGGGTGT, as shown in SEQ ID NO. 10;

[0032] The nucleotide sequence of single-stranded bp-3 is:

[0033] GTTAATCGCTGACTCACTCTTGATGTAAG, as shown in SEQ ID NO. 11;

[0034] The nucleotide sequence of single-stranded bp-4 is:

[0035] GTTAATCGCTGTAGTGACCTTGCTATCACA, as shown in SEQ ID NO. 12;

[0036] The nucleotide sequence of substrate strand-1 is:

[0037] CTCTGACATrAGGACTCACT, as shown in SEQ ID NO.13;

[0038] The nucleotide sequence of substrate strand - 2 is:

[0039] CAGAACTGTrAGGTAGTGAC, as shown in SEQ ID NO.14;

[0040] In the nucleotide sequences of substrate strand - 1 and substrate strand - 2, rA represents an RNA base, and the others are DNA bases;

[0041] The substrate strand - 1 is respectively modified with a fluorescent group R1 and a quenching group Q, and the substrate strand - 2 is respectively modified with a fluorescent group R2 and a quenching group Q.

[0042] Furthermore, the fluorescent group R1 and the quenching group Q are modified at both ends of the substrate strand - 1, and the fluorescent group R2 and the quenching group Q are modified at both ends of the substrate strand - 2.

[0043] Furthermore, the fluorescent group R1 is FAM, the quenching group Q is BHQ1, and the fluorescent group R2 is ROX.

[0044] A method for constructing a logic gate for highly sensitive detection of OTA and AFB1 includes the following steps:

[0045] S1. Heat the deoxyribozyme - cDNA, double - strand or triple - strand to 92 - 95 °C, and then cool it to room temperature to form a double - strand structure or a triple - strand structure;

[0046] S2. Incubate the test sample, the double - strand structure or triple - strand structure, the probe set and the substrate strand at 23 - 27 °C for 120 min, and detect the fluorescence signal.

[0047] Furthermore, the detection system of the "OR" molecular logic gate is:

[0048] Component Final Concentration OTA in the test sample 0.1 - 1 μM AFB1 in the test sample 0.1 - 1 μM Invasive strand probe AFB1 - OR 50 - 100 nM Invasive strand probe OTA - OR 50 - 100 nM Duplex - 1 formed by bp - 1 and DNAzyme - 1 50 - 150 nM <![CDATA[Substrate chain - 1 - R1]]> 100 - 300 nM Tric - HCl 10 - 30 mM NaCl 50 - 150 mM <![CDATA[MgCl2]]> 10 - 30 mM EDTA 0.1 - 1 mM <![CDATA[ddH2O]]> Make up to 100 μL

[0049] The intelligent detection principle of the "OR" molecular logic gate is:

[0050] At first, the deoxyribozyme is blocked by its complementary single - strand bp - 1 part to form a deoxyribozyme - cDNA double - strand (double - strand structure), resulting in the loss of its enzyme activity. As Figure 1 shown, when the test sample contains ochratoxin A (OTA), the invasive - strand probe OTA - OR will bind to OTA to form an invasive strand, and the invasive strand will undergo a strand displacement reaction with the deoxyribozyme - cDNA double - strand - 1, releasing a large amount of deoxyribozyme DNAzyme - 1, in Mg2+ In the presence of

[0051] When the test sample contains aflatoxin B1 (AFB1), the recognition invasion strand probe AFB1-OR will bind to AFB1 to form an invasion strand. The invasion strand undergoes a strand displacement reaction with the deoxyribozyme-cDNA duplex-1, releasing a large amount of deoxyribozyme DNAzyme-1. In the presence of Mg 2+ In the presence of

[0052] Therefore, for the "OR" molecular logic gate, the intelligent detection results for toxins are as follows:

[0053] When strong fluorescence is detected, it indicates that any one of the situations (a) - (c) exists in the test sample:

[0054] (a) The test sample contains OTA;

[0055] (b) The test sample contains AFB1;

[0056] (c) The test sample contains both OTA and AFB1.

[0057] When strong fluorescence is not detected, it indicates that situation (d) exists in the test sample:

[0058] (d) The test sample does not contain the mycotoxins OTA and AFB1.

[0059] Furthermore, the detection system of the "AND" molecular logic gate is as follows:

[0060]

[0061]

[0062] The intelligent detection principle of the "AND" molecular logic gate is as follows:

[0063] As Figure 2 shown, since two sequences bp-1 and bp-3 are introduced at both ends of the deoxyribozyme, a deoxyribozyme-cDNA triple helix (triple-stranded structure) is formed. When the test sample only contains ochratoxin A (OTA), the recognition invasion strand probe OTA-OR will bind to OTA to form an invasion strand. The invasion strand undergoes a strand displacement reaction with the deoxyribozyme-cDNA triple helix, but only one single strand can be displaced, and the other single strand still combines with the deoxyribozyme, maintaining the inactivated state of the deoxyribozyme.

[0064] When the test sample contains only aflatoxin B1 (AFB1), the invasive strand probe AFB1-OR will bind to AFB1 to form an invasive strand. The invasive strand undergoes a strand displacement reaction with the deoxyribozyme-cDNA triple helix. However, only one single strand can be displaced, and the other single strand remains complexed with the deoxyribozyme, maintaining the inactivated state of the deoxyribozyme.

[0065] Only when the test sample contains both ochratoxin A (OTA) and aflatoxin B1 (AFB1) simultaneously, two invasive strands are formed. The two invasive strands undergo a strand displacement reaction with the deoxyribozyme-cDNA triple helix structure, displacing both single strands simultaneously, and only then can a large amount of deoxyribozyme DNAzyme-1 be released. In the presence of Mg 2+ the double-modified substrate strand-1-R1 will be cleaved into two fragments by the released deoxyribozyme DNAzyme-1, generating an amplified fluorescence signal.

[0066] Therefore, for the "AND" molecular logic gate, the intelligent detection results for toxins are as follows:

[0067] When strong fluorescence is detected, it indicates the presence of situation (e) in the test sample;

[0068] (e) The test sample contains both OTA and AFB1.

[0069] When strong fluorescence is not detected, it indicates the presence of situations (f) to (h) in the test sample:

[0070] (f) The test sample contains only AFB1;

[0071] (g) The test sample contains only OTA;

[0072] (h) The test sample contains neither OTA nor AFB1.

[0073] Furthermore, the detection system of the "ortho" molecular logic gate is as follows:

[0074]

[0075]

[0076] The intelligent detection principle of the "ortho" molecular logic gate is as follows:

[0077] As Figure 3As shown, when the test sample contains only ochratoxin A (OTA), the recognition invasion chain probe OTA-OR binds to OTA to form an invasion chain. The invasion chain undergoes a strand displacement reaction with the deoxyribozyme-cDNA duplex-2, releasing a large amount of deoxyribozyme DNAzyme-1. In the presence of Mg 2+ , the double-modified substrate strand-1-R1 will be cleaved into two fragments by the released deoxyribozyme DNAzyme-1, generating an R1 fluorescence signal.

[0078] When the test sample contains only aflatoxin B1 (AFB1), the recognition invasion chain probe AFB1-OR binds to AFB1 to form an invasion chain. The invasion chain undergoes a strand displacement reaction with the deoxyribozyme-cDNA duplex-3, releasing a large amount of deoxyribozyme DNAzyme-2. In the presence of Mg 2+ , the double-modified substrate strand-2-R2 will be cleaved into two fragments by the released deoxyribozyme DNAzyme-2, generating an R2 fluorescence signal.

[0079] Therefore, for the "ortho" molecular logic gate, the intelligent detection results for toxins are as follows:

[0080] When strong fluorescence is detected, it indicates that any one of the situations (i) to (k) exists in the test sample:

[0081] (i) If it is the fluorescence signal of FAM, the test sample contains only AFB1;

[0082] (j) If it is the fluorescence signal of ROX, the test sample contains only OTA;

[0083] (k) If both fluorescence signals exist, the test sample contains both OTA and AFB1;

[0084] When strong fluorescence is not detected, it indicates that the situation (l) exists in the test sample:

[0085] (l) The test sample does not contain the mycotoxins OTA and AFB1.

[0086] Furthermore, the test sample is food, such as corn flour and milk, etc.

[0087] Compared with the prior art, the beneficial effects and advantages of the present invention are as follows:

[0088] 1. The present invention mainly constructs a general fluorescence aptamer sensor based on a non-competitive transduction platform and a DNA enzyme that couples with magnesium ion-dependent efficient cleavage of RNA, realizing the high-sensitivity detection of aflatoxin B1 (AFB1) and ochratoxin A (OTA).

[0089] 2. The non-competitive ligand-nucleic acid transduction mode of the present invention can simply achieve the "OR" and "AND" logical relationships between two toxins, and its anti-interference ability is verified through orthogonal experiments. At the same time, it is proved that this sensor is a multi-output biosensor, which can complete the detection of all combinations of two ligands through one experiment.

[0090] 3. The detection limits of the fluorescence aptamer sensor of the present invention for AFB1 and OTA are 0.26 nM and 0.17 nM respectively, with high sensitivity and specificity. The specificity test shows that other toxins have little interference in the detection of AFB1 and OTA.

[0091] 4. The fluorescence aptamer sensor of the present invention has been successfully applied to the detection of AFB1 and OTA in corn flour and milk, and the recovery rates are good.

[0092] 5. The aptamer sensor of the invention has the characteristics of being portable, simple and inexpensive, and can be used as an alternative tool for rapid on-site analysis of multiple mycotoxins. Description of the Drawings

[0093] Figure 1 Schematic diagram of the intelligent detection principle of the "OR" molecular logic gate for OTA and AFB1.

[0094] Figure 2 Schematic diagram of the intelligent detection principle of the "AND" molecular logic gate for OTA and AFB1.

[0095] Figure 3 Schematic diagram of the intelligent detection principle of the "ortho" molecular logic gate for OTA and AFB1.

[0096] Figure 4 Actual detection result diagram of the intelligent detection method using the "OR" molecular logic gate in Example 1.

[0097] Figure 5 Actual detection result diagram of the intelligent detection method using the "AND" molecular logic gate in Example 2.

[0098] Figure 6 Actual detection result diagram of the intelligent detection method using the "ortho" molecular logic gate in Example 3.

[0099] Figure 7 Fluorescence spectrum diagram of sample solutions with different AFB1 concentrations.

[0100] Figure 8 Standard curve diagram of the logarithm of different AFB1 concentrations and the corresponding fluorescence signal intensities.

[0101] Figure 9Fluorescence spectra of sample solutions with different OTA concentrations.

[0102] Figure 10 Standard curve of the logarithm of different OTA concentrations versus the corresponding fluorescence signal intensity.

[0103] Figure 11 Specific experimental results for AFB1 toxin detection.

[0104] Figure 12 Specific experimental results for OTA detection. Detailed implementation mode

[0105] The present invention will be described in detail below in conjunction with specific embodiments.

[0106] Example 1

[0107] Use the "OR" molecular logic gate to detect the test sample. The specific detection method is

[0108] 1. Heat deoxyribozyme DNAzyme-1 and complementary single-strand bp-1 in Tris-HCl buffer (pH 7.4, 100 mM NaCl, 5 mM MgCl2, 20 mM Tric-HCl, 1 mM EDTA) to 95 °C for 5 min, and then cool to room temperature to obtain duplex-1 formed by bp-1 and DNAzyme-1.

[0109] 2. Add the test sample, duplex-1, recognition invasion strand probe AFB1-OR, recognition invasion strand probe OTA-OR, and substrate strand-1-FAM (quenching group is BHQ2) to Tris-HCl buffer, and add ddH2O to make up to 100 μL to form a detection system. Incubate the detection system at 25 ± 2 °C for 120 min, and detect the FAM fluorescence signal.

[0110] The detection system of the "OR" molecular logic gate is shown in Table 1:

[0111] Table 1

[0112] Component Final Content OTA in test sample A 0.5 μM AFB1 in test sample B 0.5 μM Invasive strand probe AFB1 - OR 70 nM Invasive strand probe OTA - OR 70 nM Duplex - 1 formed by bp - 1 and DNAzyme - 1 100 nM Substrate strand - 1 - FAM 200 nM Tric - HCl 20 mM Nacl 100 mM <![CDATA[MgCl2]]> 20 mM EDTA 0.5 mM <![CDATA[ddH2O]]> Make up to 100 μL

[0113] Add different mycotoxin samples respectively to verify the intelligent detection of the above "OR" molecular logic gate. In this example, use the OTA mycotoxin solution as test sample A, use the AFB1 mycotoxin solution as test sample B, and perform the intelligent detection method of the "OR" molecular logic gate on test sample A and / or test sample B. Set the detection wavelength to 480 nm.

[0114] Input of different test samples and output of fluorescence results are as Figure 4As shown in Table 1, where 0 and 1 are both in binary notation, 1 indicates presence (which can represent addition or fluorescence based on different situations), and 0 indicates absence (which can represent non - addition or no fluorescence based on different situations).

[0115] Table 2

[0116]

[0117] From Figure 4 As can be seen from Table 2, taking a specific detection wavelength as the threshold (480 nm), the (0, 1), (1, 0), and (1, 1) groups can show fluorescence signals, and the detection results are consistent with the actual input situation of the detection samples, indicating that the above - mentioned "OR" molecular logic gate intelligent detection method is accurate and reliable.

[0118] Example 2

[0119] Use the "AND" molecular logic gate to detect the detection sample. The specific detection method is

[0120] 1. Heat deoxyribozyme DNAzyme - 1, complementary single - strands bp - 1 and bp - 3 in Tris - HCl buffer (pH 7.4, 100 mM NaCl, 5 mM MgCl2, 20 mM Tric - HCl, 1 mM EDTA) to 95 °C for 5 min, and then cool to room temperature to obtain the triple - helix formed by bp - 1 and bp - 3 with DNAzyme - 1.

[0121] 2. Add the detection sample, the triple - helix, the recognition invasion - strand probe AFB1 - AND, the recognition invasion - strand probe OTA - AND, and the substrate strand - 1 - FAM into Tris - HCl buffer, and add ddH2O to make up to 100 μL to form a detection system. Incubate the detection system at 25 ± 2 °C for 120 min and detect the FAM fluorescence signal.

[0122] The detection system of the "AND" molecular logic gate is shown in Table 3:

[0123] Table 3

[0124]

[0125]

[0126] Add different mycotoxin samples respectively to verify the above - mentioned "AND" molecular logic gate intelligent detection. In this example, use the OTA mycotoxin solution as detection sample A, use the AFB1 mycotoxin solution as detection sample B, and perform the "AND" molecular logic gate intelligent detection method on detection sample A and / or detection sample B, with the detection wavelength set at 480 nm.

[0127] The input of different test samples and the output of fluorescence results are as Figure 5 shown in Table 4, where both 0 and 1 are in binary notation. 1 indicates presence (which can represent addition or fluorescence based on different situations), and 0 indicates absence (which can represent non - addition or no fluorescence based on different situations).

[0128] Table 4

[0129]

[0130] From Figure 5 Table 4, it can be found that taking a specific detection wavelength as the threshold (480 nm), the (1,1) group can show a fluorescence signal, and the detection result is consistent with the actual input of the test sample, indicating that the above - mentioned "AND" molecular logic gate intelligent detection method is accurate and reliable.

[0131] Example 3

[0132] Use the "ortho" molecular logic gate to detect the test sample. The specific detection method is

[0133] 1. Heat the deoxyribozyme DNAzyme - 1 and the complementary single - strand bp - 3 in Tris - HCl buffer (pH 7.4, 100 mM NaCl, 5 mM MgCl2, 20 mM Tric - HCl, 1 mM EDTA) to 95 °C for 5 min, and then cool to room temperature to obtain duplex - 2 formed by bp - 3 and DNAzyme - 1.

[0134] 2. Heat the deoxyribozyme DNAzyme - 2 and the complementary single - strand bp - 4 in Tris - HCl buffer (pH 7.4, 100 mM NaCl, 5 mM MgCl2, 20 mM Tric - HCl, 1 mM EDTA) to 95 °C for 5 min, and then cool to room temperature to obtain duplex - 3 formed by bp - 4 and DNAzyme - 1.

[0135] 3. Add the test sample, duplex - 2, duplex - 3, the recognition invading - strand probe AFB1 - AND, the recognition invading - strand probe OTA - AND, substrate strand - 1 - FAM, and substrate strand - 2 - ROX (the quenching group is BHQ2) into Tris - HCl buffer, and add ddH2O to make up to 100 μL to form a detection system. Incubate the detection system at 25 ± 2 °C for 120 min, and detect the FAM fluorescence signal and / or ROX fluorescence signal.

[0136] The detection system of the "ortho" molecular logic gate is shown in Table 5:

[0137] Table 5

[0138] Component Final Content OTA in test sample A 0.5 μM AFB1 in test sample B 0.5 μM Invasive strand probe AFB1 - ortho 60 nM Invasive strand probe OTA - ortho 80 nM Duplex - 2 formed by bp - 3 and DNAzyme - 1 60 nM Duplex - 3 formed by bp - 4 and DNAzyme - 2 80 nM Substrate strand - 1 - FAM 150 nM Substrate strand - 2 - ROX 150 nM Tric - HCl 20 mM Nacl 100 mM MgCl2 20 mM EDTA 0.5 mM ddH2O Make up to 100 μL

[0139] Different mycotoxin samples were added separately to verify the intelligent detection of the above-mentioned "ortho" molecular logic gate. In this example, the OTA mycotoxin solution was used as detection sample A, the AFB1 mycotoxin solution was used as detection sample B, and the intelligent detection method of the "ortho" molecular logic gate was performed on detection sample A and / or detection sample B. For the fluorophore FMA, the detection wavelength was set to 480 nm, and for the fluorophore ROX, the detection wavelength was set to 575 nm.

[0140] The input of different detection samples and the output results of fluorescence are as Figure 6 shown in Table 6. Among them, both 0 and 1 are in binary notation. 1 represents presence (which can represent addition or fluorescence based on different situations), and 0 represents absence (which can represent non-addition or no fluorescence based on different situations). A represents mycotoxin sample A, and B represents mycotoxin sample B.

[0141] Table 6

[0142]

[0143] From Figure 6 Table 6, it can be found that with specific detection wavelengths as thresholds (480 nm, 575 nm), the (0,1), (1,0), and (1,1) groups can show fluorescence signals, and the detection results are consistent with the actual input situations of the detection samples, indicating that the above-mentioned intelligent detection method of the "ortho" molecular logic gate is accurate and reliable.

[0144] Experiment 1. Recovery experiment of the fluorescence aptamer sensor of the present invention

[0145] To further verify the effectiveness of the intelligent detection method of the "ortho" molecular logic gate, OTA and AFB1 standards were added to corn flour or milk respectively to prepare spiked samples for recovery experiments.

[0146] Test method:

[0147] 1. Weigh the corn flour accurately (1 g), add the methanol / water solution (methanol / water is 40:60, v / v, 5 mL) to the corn flour, vortex it vigorously for 15 minutes, let it stand for 20 minutes, then filter the supernatant through a disposable syringe filter (0.22 μm), collect the supernatant and dilute it with Tris-HCl buffer (20 mM Tris-HCl, 100 mM NaCl, 0.5 mM EDTA, 20 mM MgCl2) (1:6, v:v) to obtain a dilution for further experiments. Add three AFB1 solutions with known concentrations to the dilution respectively to prepare corn flour sample solutions with three different AFB1 spiked amounts (1 nM, 10 nM, 100 nM), and detect them using the "ortho" molecular logic gate intelligent detection method in Example 3 to detect the content of AFB1.

[0148] 2. Treat the OTA standard according to the method in step 1.

[0149] 3. Centrifuge the milk at 10,000 rpm for 10 min to remove interfering substances such as fat, then filter it through a sterile Millipore membrane (0.22 μm), and collect the filtrate. Subsequently, dilute the filtrate 10-fold with Tris-HCl buffer (20 mM Tris-HCl, 100 mM NaCl, 0.5 mM EDTA, 20 mM MgCl2) to obtain a dilution for further experiments to reduce the matrix effect. Add three AFB1 solutions with known concentrations to the dilution respectively to prepare milk powder sample solutions with three different AFB1 spiked amounts (1 nM, 10 nM, 100 nM), and detect them using the "ortho" molecular logic gate intelligent detection method in Example 3 to detect the content of AFB1.

[0150] 4. Treat the OTA standard according to the method in step 3.

[0151] Test method:

[0152] The detection results of each spiked corn flour sample solution and each spiked milk powder sample solution are shown in Table 7 below:

[0153]

[0154] As can be seen from Table 7, for the corn flour sample solution, the spiked recovery rate of OTA is between 101% - 104%, and the spiked recovery rate of AFB1 is between 103% - 104%; for the milk powder sample solution, the spiked recovery rate of OTA is between 93% - 99%, and the spiked recovery rate of AFB1 is between 95% - 101%. This shows that the "ortho" molecular logic gate intelligent detection method in this application has high accuracy and high precision.

[0155] Experiment 2: Detection Limit Test of the Fluorescent Aptamer Sensor of the Present Invention

[0156] Experimental Method:

[0157] Detection Limit Detection Steps for FAB1:

[0158] 1. Add the substrate strand - 1 - FAM, the invasive strand probe AFB1 - OR, and the duplex - 1 formed by bp - 1 and DNAzyme - 1 into the Tris - HCl buffer solution, mix evenly to obtain a mixed solution. In the mixed solution, the concentration of the substrate strand - 1 - FAM is 150 nM, the concentration of the invasive strand probe AFB1 - OR is 150 nM, and the concentration of the duplex - 1 is 100 nM.

[0159] 2. Add AFB1 solutions with different concentrations into the mixed solution to obtain sample solutions with AFB1 concentrations of 0, 0.5, 1, 2, 5, 10, 20, 50, 100, and 200 nM respectively.

[0160] 3. After incubating each sample solution in a centrifuge tube at room temperature for 2 hours, record the fluorescence spectra of each sample solution in the range of 500 nm to 550 nm, and the excitation wavelength λex is 480 nm.

[0161] Detection Limit Detection Steps for OTA:

[0162] 1. Add the substrate strand - 1 - FAM, the invasive strand probe OTA - OR, and the duplex - 1 formed by bp - 1 and DNAzyme - 1 into the Tris - HCl buffer solution, mix evenly to obtain a mixed solution. In the mixed solution, the concentration of the substrate strand - 1 - FAM is 150 nM, the concentration of the invasive strand probe OTA - OR is 150 nM, and the concentration of the duplex - 1 is 100 nM.

[0163] 2. Add OTA solutions with different concentrations into the mixed solution to obtain sample solutions with OTA concentrations of 0, 0.1, 0.5, 1, 2, 5, 10, 20, 50, 100, 200, 500 respectively.

[0164] 3. After incubating each sample solution in a centrifuge tube at room temperature for 2 hours, record the fluorescence spectra of each sample solution in the range of 500 nm to 550 nm, and the excitation wavelength λex is 480 nm.

[0165] Experimental Results:

[0166] Detection Limit Detection Results for FAB1:

[0167] The fluorescence spectra of the sample solutions with different AFB1 concentrations are as Figure 7 shown, and from Figure 7It can be seen that as the concentration of AFB1 increases, the FAM fluorescence signal continuously enhances.

[0168] Taking the logarithm values of the concentrations of each AFB1 as the abscissa and the FAM fluorescence signal intensities corresponding to the concentrations of each AFB1 as the ordinate, plotting according to the data detected from the sample solutions corresponding to the concentrations of each AFB1, and obtaining a standard curve after fitting, thus obtaining the functional relationship of the standard curve, as Figure 8 shown.

[0169] The detection limit of AFB1 is calculated according to formula (1):

[0170]

[0171] In the formula, δ is the standard deviation of the measured blank value, S is the slope of the standard curve, which is calculated according to formula (1), and the detection limit of AFB1 is 0.26 nM.

[0172] Detection result of the detection limit of OTA:

[0173] The fluorescence spectrograms of the sample solutions with different OTA concentrations are as Figure 9 shown, and it can be seen from Figure 9 that as the concentration of OTA increases, the FAM fluorescence signal continuously enhances.

[0174] Taking the logarithm values of the concentrations of each OTA as the abscissa and the FAM fluorescence signal intensities corresponding to the concentrations of each OTA as the ordinate, plotting according to the data detected from the sample solutions corresponding to the concentrations of each OTA, and obtaining a standard curve after fitting, thus obtaining the functional relationship of the standard curve, as Figure 10 shown.

[0175] Similarly, according to the detection limit calculation formula of OTA, it can be calculated that the detection limit of OTA is 0.17 nM. Experiment 3. Specificity experiment of the fluorescence aptamer sensor of the present invention

[0176] In order to systematically evaluate the high selectivity detection ability of the signal - amplified fluorescence aptamer sensor for FAB1 and OTA, 5 key mycotoxins were selected as interfering substances for detection in this experiment. The interfering mycotoxins for evaluating the detection selectivity of AFB1 include AFB2, AFG1, AFG2, ZEN, and OTA. The interfering mycotoxins for evaluating the selectivity of OTA include AFB1, OTB, OTC, ZEN, and AFM1.

[0177] Experimental method:

[0178] Specific detection steps of AFB1:

[0179] 1. Add the duplex-1 formed by the substrate strand-1-FAM, the invasive strand probe AFB1-OR, and bp-1 to DNAzyme-1 into Tris-HCl buffer, mix well to obtain a mixed solution A. In the mixed solution A, the concentration of the substrate strand-1-FAM is 150 nM, the concentration of the invasive strand probe AFB1-OR is 150 nM, and the concentration of the duplex-1 is 100 nM.

[0180] 2. Add the AFB2 solution to the mixed solution A to obtain a sample solution A1. In the sample solution A1, the concentration of AFB2 is 10 μM. Add the AFG1 solution to the mixed solution A to obtain a sample solution A2. In the sample solution A2, the concentration of AFG1 is 10 μM. Add the AFG2 solution to the mixed solution A to obtain a sample solution A3. In the sample solution A3, the concentration of AFG2 is 10 μM. Add the ZEN solution to the mixed solution A to obtain a sample solution A4. In the sample solution A4, the concentration of ZEN is 10 μM. Add the OTA solution to the mixed solution A to obtain a sample solution A5. In the sample solution A5, the concentration of OTA is 1 μM. Add the AFB1 solution to the mixed solution A to obtain a sample solution A6. In the sample solution A6, the concentration of AFB1 is 1 μM. Add the AFB1 solution and the OTA solution to the mixed solution A respectively to obtain a sample solution A7. In the sample solution A7, the concentrations of AFB1 and OTA are both 1 μM. Add the AFB1 solution, the AFB2 solution, the AFG1 solution, the AFG2 solution, the ZEN solution, and the OTA solution to the mixed solution A respectively to obtain a sample solution A8. In the sample solution A8, the concentrations of AFB1 and OTA are both 1 μM, and the concentrations of AFB2, AFG1, AFG2, and ZEN are all 10 μM. 3. After incubating the sample solutions A1 - A8 and the blank sample solution (i.e., the mixed solution A) in centrifuge tubes at room temperature for 2 hours, record the fluorescence spectra of each sample solution in the range of 500 nm to 550 nm, and the excitation wavelength λex is 480 nm.

[0181] Detection limit detection procedure for OTA:

[0182] 1. Add the duplex-1 formed by the substrate strand-1-FAM, the invasive strand probe OTA-OR, and bp-1 to DNAzyme-1 into Tris-HCl buffer, mix well to obtain a mixed solution B. In the mixed solution B, the concentration of the substrate strand-1-FAM is 150 nM, the concentration of the invasive strand probe OTA-OR is 150 nM, and the concentration of the duplex-1 is 100 nM.

[0183] 2. Add AFB1 to the mixed solution B to obtain sample solution B1, in which the concentration of AFB1 is 1 μM. Add OTB to the mixed solution B to obtain sample solution B2, in which the concentration of OTB is 10 μM. Add OTC to the mixed solution B to obtain sample solution B3, in which the concentration of OTC is 10 μM. Add ZEN to the mixed solution B to obtain sample solution B4, in which the concentration of ZEN is 10 μM. Add AFM1 to the mixed solution B to obtain sample solution B5, in which the concentration of AFM1 is 10 μM. Add OTA to the mixed solution B to obtain sample solution B6, in which the concentration of OTA is 1 μM. Add the AFB1 solution and the OTA solution to the mixed solution B respectively to obtain sample solution B7, in which the concentrations of both AFB1 and OTA are 1 μM. Add the AFB1 solution, the OTB solution, the OTC solution, the ZEN solution, the AFM1 solution and the OTA solution to the mixed solution B to obtain sample solution B8, in which the concentrations of both AFB1 and OTA are 1 μM, and the concentrations of OTB, OTC, ZEN and AFM1 are all 10 μM.

[0184] 3. After incubating sample solutions B1 - B8 and the blank sample solution (i.e., the mixed solution B) in centrifuge tubes at room temperature for 2 hours, record the fluorescence spectra of the sample solutions in the range of 500 nm to 550 nm, with the excitation wavelength λex being 480 nm.

[0185] Experimental results:

[0186] Specific detection results of AFB1:

[0187] The fluorescence spectra of sample solutions A1 - A8 containing different fungi are as Figure 11 shown. As can be seen from Figure 11 , the fluorescence signal intensity of the sample solution without mycotoxin or containing only one of AFB2, AFG1, AFG2, ZEN and OTA is very low, while the fluorescence signal intensity of the sample solution containing AFB1 is significantly enhanced. Moreover, when the sample solution contains AFB1 and other mycotoxins (such as A7 and A8), compared with the sample solution containing only AFB1 (A6), its fluorescence intensity has no significant change. This indicates that the interference of other toxins on the detection of AFB1 is extremely small.

[0188] Specific detection results of OTA:

[0189] The fluorescence spectra of sample solutions B1 - B8 containing different fungi are as Figure 12 shown. As can be seen from Figure 12It can be seen that the fluorescence signal intensity of the sample solution without mycotoxin or containing only one of the mycotoxins AFB1, OTB, OTC, ZEN, and AFM1 is very low, while the fluorescence signal intensity of the sample solution containing OTA is significantly enhanced. Moreover, when the sample solution contains OTA and other mycotoxins (such as B7, B8), compared with the sample solution containing only OTA (B6), there is no significant change in its fluorescence intensity. This indicates that the interference of other toxins on the detection of OTA is extremely small.

Claims

1. A detection reagent for highly sensitive detection of OTA and AFB1, characterized in that: It includes a probe set composed of at least one of the invasive strand recognition probes AFB1-OR, OTA-OR, AFB1-AND, OTA-AND, AFB1-ortho and OTA-ortho; The nucleotide sequence of the invasive strand recognition probe AFB1-OR is: GAGTCAACCTTCGTGTTGTCTCTCTGTGTCTCGTTGAGTGAGTCAGCGATTAAA, as shown in SEQ ID NO.1; The nucleotide sequence of the invasive strand recognition probe OTA-OR is: GAGTCAACCTTGTCGGGTGTGGGTGGCGTAAAGGGAGCACTTGAGTGAGTCAGCGATTA, as shown in SEQ ID NO.2; The nucleotide sequence of the invasive strand recognition probe AFB1-AND is: ACACCCATGTTGTCAGAGGTTCGTGTTGTCTCTCTGTGTCTCGTTCTACATTC, as shown in SEQ ID NO.3; The nucleotide sequence of the invasive strand recognition probe OTA-AND is: AGTCAACCTTGTCGGGTGTGGGTGGCGTAAAGGGAGCACTTGAGTGAGTCAGCGATTAA, as shown in SEQ ID NO.4; The nucleotide sequence of the invasive strand recognition probe AFB1-ortho is: CTTACATCTTCGTGTTGTCTCTCTGTGTCTCGTTGAGTGAGTCAGCGATTAA, as shown in SEQ ID NO.5; The nucleotide sequence of the invasive strand recognition probe OTA-ortho is: TGTGATAGCTTGTCGGGTGTGGGTGGCGTAAAGGGAGCACTTGGTCACTACAGCGATTA, as shown in SEQ ID NO.

6.

2. A fluorescence aptasensor for highly sensitive detection of OTA and AFB1, characterized in that: It includes the detection reagent described in claim 1, complementary single-stranded bp-1, complementary single-stranded bp-2, complementary single-stranded bp-3, complementary single-stranded bp-4, deoxyribozyme DNAzyme-1, deoxyribozyme DNAzyme-2, substrate strand-1 and substrate strand-2. Complementary single-stranded bp-1 and complementary single-stranded bp-3 respectively form a duplex with deoxyribozyme DNAzyme-1 through base pairing. Complementary single-stranded bp-1 and complementary single-stranded bp-2 simultaneously form a triplex with both sides of deoxyribozyme DNAzyme-1 through base pairing. Complementary single-stranded bp-4 forms a duplex with deoxyribozyme DNAzyme-2 through base pairing; The nucleotide sequence of deoxyribozyme DNAzyme-1 is: AGTGAGTCAGCGATTAACCAGGTTACACCCATGTTGTCAGAG, as shown in SEQ ID NO.7; The nucleotide sequence of deoxyribozyme DNAzyme-2 is: GTCACTACAGCGATTAACCAGGTTACACCCATGTCAGTTCTG, as shown in SEQ ID NO.8; The nucleotide sequence of single-stranded bp-1 is: GTTAATCGCTGACTCACTCTTGGTTGACTC, as shown in SEQ ID NO.9; The nucleotide sequence of single-stranded bp-2 is: GAATGTAGTTCCTCTGACAACATGGGTGT, as shown in SEQ ID NO.10; The nucleotide sequence of single-stranded bp-3 is: GTTAATCGCTGACTCACTCTTGATGTAAG, as shown in SEQ ID NO.11; The nucleotide sequence of single-stranded bp-4 is: GTTAATCGCTGTAGTGACCTTGCTATCACA, as shown in SEQ ID NO.12; The nucleotide sequence of substrate strand-1 is: CTCTGACATrAGGACTCACT, as shown in SEQ ID NO.13; The nucleotide sequence of substrate strand-2 is: CAGAACTGTrAGGTAGTGAC, as shown in SEQ ID NO.14; In the nucleotide sequences of substrate strand-1 and substrate strand-2, rA represents an RNA base, and the others are DNA bases; The substrate strand-1 is respectively modified with a fluorescent group R1 and a quenching group Q, and the substrate strand-2 is respectively modified with a fluorescent group R2 and a quenching group Q.

3. The highly sensitive fluorescence aptasensor for detecting OTA and AFB1 according to claim 2, wherein: The fluorescent group R1 and the quenching group Q are modified at both ends of the substrate strand-1, and the fluorescent group R2 and the quenching group Q are modified at both ends of the substrate strand-2.

4. The highly sensitive fluorescence aptasensor for detecting OTA and AFB1 according to claim 3, wherein: The fluorescent group R1 is FAM, the quenching group Q is BHQ1, and the fluorescent group R2 is ROX.

5. A method for constructing a logic gate for highly sensitive detection of OTA and AFB1, characterized in that It includes the following steps: S1. Heat the deoxyribozyme DNAzyme with one single strand or two single strands to 92 - 95 °C, and then cool it to room temperature to form a double-stranded or triple-stranded body; S2. Incubate the test sample, the double-stranded or triple-stranded body, the probe set and the substrate strand at 23 - 27 °C, and detect the fluorescence signal.

6. The method for constructing a molecular logic gate for highly sensitive detection of OTA and AFB1 according to claim 5, characterized in that The detection system of the "OR" molecular logic gate is: 。 7. The method for constructing a molecular logic gate for highly sensitive detection of OTA and AFB1 according to claim 5, wherein The detection system of the "AND" molecular logic gate is:

8. The method for constructing a molecular logic gate for highly sensitive detection of OTA and AFB1 according to claim 5, characterized in that The detection system of the "ortho" molecular logic gate is: 。 9. The method for constructing a molecular logic gate for highly sensitive detection of OTA and AFB1 according to claim 5, characterized in that: The test sample is food.

Images