A biomarker for predicting chemotherapy sensitivity in colorectal cancer and its application
The chemotherapy sensitivity of colorectal cancer is predicted by the autophagy-TIMP-2 signaling axis, and the chemotherapy effect is evaluated using autophagy levels and TIMP-2 protein markers. This solves the problem of lack of predictive markers in existing technologies, achieves accurate prediction of chemotherapy sensitivity and optimization of treatment plans, and improves patient survival rate.
Patent Information
- Application Number
- CN202510886020.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-06-30
AI Technical Summary
Existing technologies lack uniformly recognized markers for predicting chemotherapy sensitivity in colorectal cancer, resulting in some patients not responding well to chemotherapy regimens. Drug resistance and recurrence are the main cause of death in patients with advanced colorectal cancer.
The autophagy-TIMP-2 signaling axis is used as a molecular marker to predict the chemotherapy sensitivity of colorectal tumors, including the autophagy level-related markers p-ATG16L and TIMP-2 protein. Chemotherapy sensitivity is assessed by serological testing, and chemotherapy resistance caused by autophagy deficiency is reversed by overexpressing TIMP-2 or targeting MMP-2/9.
It improves the accuracy of chemotherapy sensitivity prediction, helps screen out people who may benefit from chemotherapy, optimizes treatment plans, improves patient survival rates, and reverses chemotherapy resistance caused by autophagy defects.
Smart Images

Figure CN120405130B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to a biomarker for predicting chemotherapy sensitivity of colorectal cancer and applications thereof. Background Art
[0002] Colorectal cancer (CRC) is a common cancer. 5-FU-based chemotherapy regimens, such as FOLFOX (5-FU+leucovorin+oxaplatin), are the mainstay of treatment for patients with advanced metastatic CRC (mCRC). However, a significant proportion of patients do not respond well to current first-line chemotherapy regimens. Drug-resistant relapse is a leading cause of death in patients with advanced colorectal cancer. Therefore, establishing highly effective and specific predictive biomarkers, identifying patients with potential chemotherapy benefits, optimizing treatment options, and achieving precise diagnosis and treatment are key to improving patient survival.
[0003] Currently, there is a lack of universally recognized biomarkers for predicting chemotherapy efficacy in colorectal cancer. Exploring the key mechanisms that determine chemotherapy sensitivity from a microenvironmental perspective is a highly sought-after research area in the field of biomedicine. Finding suitable biomarkers for predicting chemotherapy efficacy can better identify patients with potential chemotherapy benefits, optimize treatment plans, and ultimately achieve precise diagnosis and treatment. Summary of the Invention
[0004] The purpose of the present invention is to overcome the shortcomings of the existing technology and provide a molecular marker combination p-ATG16L / TIMP-2 or autophagy signature gene set / TIMP-2 for predicting the chemotherapy sensitivity of colorectal tumors based on the autophagy-TIMP-2 signaling axis.
[0005] To achieve the above object, the technical solution adopted by the present invention is:
[0006] In a first aspect, the present invention provides a biomarker for predicting chemotherapy sensitivity of colorectal cancer, wherein the biomarker is an autophagy-TIMP-2 signaling axis; the biomarker includes a marker related to autophagy levels and TIMP-2 protein.
[0007] In previous studies, the present invention found that chemotherapy can induce autophagy in in vitro colorectal tumor cell models and in vivo mouse colorectal tumor models. The anti-tumor immunity induced by chemotherapy depends on the level of autophagy in tumor cells. Inhibiting autophagy can significantly reduce the sensitivity of chemotherapy in immune-competent mouse colorectal tumor models. Further analysis of the changes in the tumor immune microenvironment under conditions of chemotherapy and without chemotherapy using CyTOF (mass spectrometry) revealed that inhibiting autophagy can significantly suppress the anti-tumor immunity induced by chemotherapy, including Ly6C, which has the characteristics of effector T cells. + CD8+ The abundance of T cells decreased, which indicates that autophagy can enhance chemotherapy sensitivity by regulating the immune microenvironment.
[0008] This study, using cytokine array experiments, discovered that the secreted protein TIMP-2, upregulated by chemotherapy, is a key "linker" molecule mediating autophagy regulation of the tumor immune microenvironment. Chemotherapy promotes TIMP-2 expression in an autophagy-dependent manner. TIMP-2 is an endogenous inhibitor of metalloproteinases (MMPs), primarily inhibiting MMP-2 / -9. MMPs can remodel the extracellular matrix, inhibiting immune cell infiltration and activation, and thus creating an immunosuppressive microenvironment. Furthermore, the present invention analyzed clinical patient samples and found that in clinical samples, autophagy levels (using the average expression level of genes included in the autophagy signature gene set to establish an "autophagy score" as a measurement standard, with a higher autophagy score indicating a higher autophagy level) and TIMP-2 expression were also significantly positively correlated. TIMP-2 was highly expressed in samples from chemotherapy-sensitive patients. Multicolor immunofluorescence detection of the autophagy marker p-ATG16L and TIMP-2 expression in tumor samples from sensitive and resistant patients showed that the proportion of patients with high p-ATG16L / TIMP-2 expression was significantly higher in the sensitive group than in the resistant group. In addition, Kaplan-Meier survival analysis also showed that higher TIMP-2 expression was associated with higher patient survival rates. These results suggest that the autophagy-TIMP-2 signaling axis can serve as a potential biomarker for predicting chemotherapy sensitivity. As a secreted protein, TIMP-2 can be more easily detected through serological testing, which also enhances the accessibility of this signaling axis as a predictive marker.
[0009] Preferably, the markers related to the autophagy level include p-ATG16L and / or an autophagy signature gene set.
[0010] In a second aspect, the present invention provides the use of the biomarker for predicting colorectal cancer chemotherapy sensitivity in the preparation of a product for screening a population sensitive to colorectal cancer chemotherapy.
[0011] Preferably, the chemotherapy sensitivity is the sensitivity of colorectal cancer patients to chemotherapy drugs; the chemotherapy drugs include 5-FU and oxaliplatin.
[0012] In a third aspect, the present invention provides the use of the biomarker for predicting colorectal cancer chemotherapy sensitivity in the preparation of a product for predicting colorectal cancer chemotherapy sensitivity or prognosis.
[0013] Preferably, the chemotherapy sensitivity is the sensitivity of colorectal cancer patients to chemotherapy drugs; the chemotherapy drugs include 5-FU and oxaliplatin.
[0014] Preferably, chemotherapy sensitivity is differentiated according to the Standard-TRG score: TRG <= 2 is considered sensitive, and TRG >= 3 is considered resistant.
[0015] Preferably, the product predicts colorectal cancer chemotherapy sensitivity or prognosis by detecting the autophagy level and / or TIMP-2 expression level; the autophagy level and / or TIMP-2 expression level is positively correlated with chemotherapy sensitivity / prognosis.
[0016] In a fourth aspect, the present invention provides a product for predicting the chemotherapy sensitivity of colorectal cancer, wherein the product comprises a substance for detecting the level of autophagy and / or a substance for detecting the expression level of TIMP-2 protein.
[0017] In a fifth aspect, the present invention provides the use of a substance that upregulates / overexpresses TIMP-2 and / or a substance that targets and inhibits MMP2 / 9 in the preparation of a drug for reversing chemotherapy resistance in patients with autophagy deficiency.
[0018] Previous studies have found that approximately 20% of colorectal cancer patients harbor ATG5 mutations, and abnormal autophagy has also been found to be a major contributor to colorectal tumorigenesis. Experiments in the mouse model presented in this study demonstrate that knocking out TIMP-2 can mimic the effects of autophagy inhibition, significantly impairing chemotherapy sensitivity and chemotherapy-induced anti-tumor immunity. Overexpressing TIMP-2 in autophagy-deficient tumor cells can restore chemotherapy sensitivity and chemotherapy-dependent anti-tumor immunity. TIMP-2 is an endogenous inhibitor of metalloproteinases (MMPs), primarily inhibiting MMP-2 / -9. MMPs, by remodeling the extracellular matrix, inhibit immune cell infiltration and activation, thereby creating an immunosuppressive microenvironment. Therefore, chemotherapy resistance caused by autophagy defects can be reversed by overexpressing the key "messenger" molecule TIMP-2 or by targeting the downstream MMP-2 / 9 pathways.
[0019] Preferably, the substance that upregulates / overexpresses TIMP-2 includes an overexpression vector, a nucleic acid molecule or a compound.
[0020] Preferably, the substance that targets and inhibits MMP2 / 9 includes a nucleic acid molecule, a small molecule inhibitor or an interfering lentivirus.
[0021] The beneficial effects of the present invention are:
[0022] In this study, the present invention combined preclinical mouse models with clinical patient sample analysis and found that autophagy-TIMP-2 signaling is expected to become a potential biomarker for predicting chemotherapy sensitivity in colorectal tumors. The autophagy-TIMP-2 signaling axis can enhance chemotherapy sensitivity by regulating anti-tumor immunity. Drug resistance and recurrence are one of the main causes of death in patients with mid-to-late stage colorectal tumors. As a molecular marker for predicting the efficacy of chemotherapy in colorectal tumor patients, the autophagy-TIMP-2 signaling axis can help screen patients with potential chemotherapy benefits, optimize treatment plans, achieve precise diagnosis and treatment, and improve patient survival.
[0023] The present invention also provides an optimized treatment plan for patients with autophagy deficiency. Chemotherapy resistance caused by autophagy deficiency can be reversed by overexpressing the key "messenger" molecule TIMP-2 or targeting downstream MMP-2 / 9. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 Figures 5-FU-based chemotherapy (5-FU / Oxa) induces autophagy in colorectal tumor cells in both in vitro cell models and mouse tumor models. Panel A shows Western blot (WB) analysis of the expression of autophagy-related markers p62 and LC3-I / II in autophagy-competent colorectal tumor cell lines (CT-26sgCtrl / RKOshCtrl) and autophagy-deficient colorectal tumor cell lines (CT-26 sgATG5#1,#2 / sgATG7#1,#2; RKO shATG5#1,#2 / sgATG7#1,#2) under 5-FU / Oxa treatment. Panels BC show immunofluorescence (IF) analysis of the expression of autophagy markers p62 and p-ATG16L (Ser278) in colorectal tumor tissues of autophagy-competent / autophagy-deficient mice with and without 5-FU / Oxa treatment.
[0025] Figure 2 Figure 3: Autophagy-competent colorectal tumor cell line (CT-26sgCtrl) and autophagy-deficient colorectal tumor cell line (CT-26 sgATG5) were subcutaneously inoculated into immunocompetent mice, respectively, with or without 5-FU / Oxa treatment, to monitor changes in tumor volume (A), size (B), and weight (C).
[0026] Figure 3 Figure 3: Autophagy-competent colorectal tumor cell line (CT-26sgCtrl) and autophagy-deficient colorectal tumor cell line (CT-26 sgATG7) were subcutaneously inoculated into immunocompetent mice, respectively, with or without 5-FU / Oxa treatment, to monitor changes in tumor volume (A), size (B), and weight (C).
[0027] Figure 4 Figure 3 shows the results of CyTOF analysis of the changes in the immune microenvironment of colorectal tumors in mice with or without complete or defective autophagy under 5-FU / Oxa treatment conditions; Figure A shows the results of t-SINE dimensionality reduction clustering analysis of the infiltration of different immune cells in tumor tissues; the treatment groups included the complete autophagy + solvent treatment control group (sgCtrl+Vehicle), the complete autophagy + 5-FU / Oxa treatment group (sgCtrl+5-FU / Oxa), the defective autophagy + solvent treatment control group (sgATG5+Vehicle), and the defective autophagy + 5-FU / Oxa treatment group (sgATG5+5-FU / Oxa); Figure B is a statistical bar graph of the infiltration ratios of different immune cell subsets in tumor tissues of the above four treatment groups.
[0028] Figure 5 Figure 2 shows the results of flow cytometry and multicolor immunofluorescence techniques to detect the changes in the immune microenvironment of colorectal tumors in mice with or without complete or defective autophagy under different treatment conditions; Figure A shows the detection of total infiltrating CD8 + Statistical chart of changes in the proportion of T cells; BC figure is the activated CD8 + Statistical chart of changes in T cell proportion.
[0029] Figure 6 Figure 3 is the result of cytokine chip analysis and ELISA test; Figure A is the result of cytokine chip analysis (Cytokinearray); Figure B is the result of enzyme-linked immunosorbent assay (ELISA) detecting the changes in TIMP-2 secretion in human autophagy-normal (RKOshCtrl) / autophagy-deficient (RKO shATG5) cell lines after chemotherapy treatment; Figure C is the result of enzyme-linked immunosorbent assay (ELISA) detecting the changes in TIMP-2 secretion in mouse autophagy-normal (CT-26sgCtrl) / autophagy-deficient (CT-26sgAtg5) cell lines after chemotherapy treatment.
[0030] Figure 7 The experimental results show that knocking out TIMP-2 inhibits the sensitivity of mouse colorectal tumor models to chemotherapy; Figure A shows the results of WB detection of the effect of TIMP-2 knockout; Figures B and D show the results of monitoring the changes of mouse tumors by treating an immune-competent mouse colorectal tumor model with 5-FU combined with oxaliplatin (Oxa) using a 5-FU-based chemotherapy regimen (B-tumor volume change, C-tumor size change, D-tumor weight change); Figure E shows the results of FACS detection of CD8 + Figure 5 is the result of FACS detection of activated CD8 + T (Ly6C + CD8 +T) Result graph of cell abundance.
[0031] Figure 8 Figure 2 shows the results of a significant positive correlation between the autophagy-TIMP-2 signaling axis and the chemotherapy sensitivity of clinical colorectal cancer patients; Figure A shows the results of a significant positive correlation between autophagy levels and TIMP-2 expression in clinical practice; Figures BC show the analysis results of autophagy levels and TIMP-2 expression in samples from chemotherapy-sensitive and resistant colorectal cancer patients; Figure D shows the analysis results of TIMP-2 levels and patient survival.
[0032] Figure 9 To overexpress normal TIMP-2 (TIMP-2WT, i.e., TIMP-2 Wildtype) and mutants TIMP-2 Ala+ mt and TIMP-2-C that have lost their MMP-2 / 9 inhibitory function in autophagy-deficient mouse colorectal tumor cells CT-26 sgAtg5, and to detect their overexpression levels by Western blotting and qRT-PCR. EV stands for Empty Vector, i.e., the result of the empty vector control group.
[0033] Figure 10 The graph shows the monitoring results of changes in tumor volume (A), size (B) and weight (C) of five groups of mouse colorectal tumor models, including autophagy-complete (sgCtrl), autophagy-deficient (sgATG5), overexpression of wild-type TIMP-2 (sgATG5+TIMP-2 WT), and TIMP-2-inhibiting MMP-2 / 9 loss-of-function mutant (sgATG5+TIMP-2 Ala+ mt / TIMP-2-C), under 5-FU / Oxa treatment conditions.
[0034] Figure 11 Flow cytometry was used to detect the total CD8 + T cells (A) and activated CD8 + T(B) ratio change results graph.
[0035] Figure 12 Figures 4 and 5 show that SB-3CT, a small molecule inhibitor targeting MMP-2 / 9, can significantly restore the sensitivity of autophagy-deficient mouse colorectal tumor models to chemotherapy; Figures AC show the results of monitoring tumor changes in autophagy-complete and autophagy-deficient mouse models under the conditions of 5-FU / Oxa or 5-FU / Oxa combined with SB-3CT treatment (A-tumor volume change, B-tumor size change, C-tumor weight change); Figures DE show the total CD8 + T cells and activated CD8 + Changes in T cell proportions. DETAILED DESCRIPTION
[0036] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0037] Example 1: Chemotherapy induces autophagy in colorectal cancer cells
[0038] 1. Simulating the clinical 5-FU-based chemotherapy regimen, 5-FU combined with oxaliplatin (Oxa) was used to treat the mouse autophagy-normal cell line (CT-26sgCtrl), the human autophagy-normal cell line (RKOshCtrl), the mouse autophagy-deficient cell line (CT-26 sgAtg5 / sgAtg7), and the human autophagy-deficient cell line (RKO shATG5 / sgATG7).
[0039] Autophagy-deficient cell lines were constructed using sgRNA / shRNA. #1 represents two independent sgRNA / shRNA sequences. Specific sequence information is as follows:
[0040] sgAtg5#1(mice):5'-AGTGAAAAGCACTTTCAGA-3';
[0041] sgAtg5#2(mice):5'-AACGTCAAATAGCTGACTCT-3';
[0042] shATG5#1(human):5'- CCTTTCATCAGAAGCTGTTT-3';
[0043] shATG5#2(human):5'- CCTGAACAGAATCATCCTTAA-3';
[0044] sgAtg7#1(mice):5'-GAAACTTGTTGAGGAGCAT-3';
[0045] sgAtg7#2(mice): 5'-ACGTCCAGGCACTATTAAA-3';
[0046] sgATG7#1(human):5'-GCGGCAGCTACGGGGGATCC-3';
[0047] sgATG7#2(human):5'-GCCAGCTCGCTTAACAT-3'.
[0048] RKO cells were treated with 100 μM 5-FU combined with 2.5 μM Oxa for 24 h, and CT-26 cells were treated with 10 μM 5-FU combined with 0.25 μM Oxa for 24 h. The changes in autophagy-related markers p62 and LC3-I / II were detected by Western blot (WB). The results are shown in Figure 2. Figure 1 Figure 3 (A). Under 5-FU / Oxa treatment, decreased p62 expression and increased conversion of LC3 type I to type II indicate enhanced autophagy. Knockdown of the autophagy-regulating core proteins ATG5 / ATG7 significantly inhibited chemotherapy-induced autophagy, demonstrating the successful establishment of an autophagy-deficient cell line.
[0049] 2. Use 6-8 week old BALB / c female mice to establish subcutaneous colorectal tumor model (subcutaneous injection of 2×10 6 cells / mouse) until the tumor size reaches 100 mm 3 , simulated the clinical 5-FU-based chemotherapy regimen using 5-FU combined with Oxa to treat the mouse colorectal tumor model (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal administration, three times a week), and the changes of the autophagy marker p62 in mouse tumor tissues were detected by immunofluorescence (IF). The results are as follows Figure 1 As shown in Figure B. Immunofluorescence (IF) was used to detect the changes of autophagy marker p-ATG16L1 (Ser278) in mouse tumor tissues. Figure 1 As shown in C. The decrease in p62 and the increase in p-ATG16L (Ser278) expression indicate enhanced autophagy.
[0050] The above results indicate that chemotherapy can induce autophagy in colorectal tumor cells in both in vitro and in vivo colorectal tumor models.
[0051] Example 2: Blocking autophagy inhibits the sensitivity of immunocompetent mouse colorectal tumor model to chemotherapy
[0052] To investigate the regulatory function of tumor cell autophagy during chemotherapy, a subcutaneous colorectal tumor model was established using 6-8 week-old BALB / c immune-competent female mice. 6 Autophagy-complete (CT-26sgCtrl) or autophagy-deficient (CT-26 sgAtg5 / sgAtg7) mouse colorectal tumor cells were injected subcutaneously into each mouse, with 6 mice in each group. Tumor volume was measured every 3 days. 3, simulating the clinical 5-FU-based chemotherapy regimen, 5-FU combined with Oxa was used to treat the mouse colorectal tumor model (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal administration, three times a week), and the changes in mouse tumor volume and weight were monitored.
[0053] In the mouse colorectal tumor model with complete autophagy or inhibition of tumor cell autophagy by knocking out Atg5, the changes in tumor volume, size and weight were as follows: Figure 2 As shown in the figure, the changes in tumor volume, size and weight of the mouse colorectal tumor model with complete autophagy or inhibition of tumor cell autophagy by knocking out Atg7 were as follows: Figure 3 shown.
[0054] The results showed that in immunocompetent mice, inhibiting autophagy significantly weakened chemotherapy sensitivity, suggesting that tumor cell autophagy may affect chemotherapy sensitivity by regulating the immune microenvironment.
[0055] Example 3: Blocking autophagy inhibits chemotherapy-induced anti-tumor immunity
[0056] Mass spectrometry flow cytometry (CyTOF) and flow cytometry (FACS) were used to detect the changes in the tumor immune microenvironment under chemotherapy conditions and the regulatory function of autophagy in this process.
[0057] Subcutaneous colorectal tumor models were established using 6-8 week old BALB / c immunocompetent female mice inoculated with autophagy-complete (CT-26sgCtrl) or autophagy-deficient (CT-26 sgAtg5) mouse colorectal tumor cells (2×10 6 cells / mouse) until the tumor size reaches 100 mm 3 , simulated the clinical 5-FU-based chemotherapy regimen using 5-FU combined with Oxa to treat the mouse colorectal tumor model (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal administration, three times a week). After two weeks of treatment, tumor samples were collected for CyTOF analysis and flow cytometry detection. The results are as follows Figure 4 、 5 shown.
[0058] The results showed that chemotherapy-induced anti-tumor immunity depends on tumor cell autophagy. Chemotherapy can activate anti-tumor immunity, which is reflected in the total CD8 + T cells and activated CD8 + The proportion of T cells increased significantly; inhibition of autophagy could significantly weaken the anti-tumor immunity induced by chemotherapy and significantly reduce the total CD8 + T cells and activated CD8 + T (Ly6C+ CD8 + T and GZMB + CD8 + T cell) cell ratio.
[0059] Example 4: Blocking autophagy inhibits the secretion of TIMP-2, a cytokine upregulated by chemotherapy
[0060] This example studies the key "link" molecules that regulate the immune microenvironment through tumor cell autophagy. Cytokine arrays (cytokine chips) and ELISA were used to detect changes in cytokine secretion by autophagy-normal and autophagy-deficient tumor cells under chemotherapy conditions.
[0061] Methods: Human / mouse colorectal tumor cells (RKO (shCtrl) / CT-26sgCtrl) and autophagy-deficient RKO (shATG5, knockdown of the autophagy core regulatory protein ATG5 to inhibit autophagy) / CT-26sgAtg5 were treated with chemotherapy for 48 hours. The cell culture supernatants were collected for cytokine chip analysis and ELISA detection.
[0062] Experimental process:
[0063] 1. Simulate the clinical 5-FU-based chemotherapy regimen using 5-FU combined with oxaliplatin (Oxa) to treat human autophagy-normal (RKOshCtrl) and autophagy-deficient (RKOshATG5) cell lines. After 48 hours of treatment with 100 µM 5-FU combined with 2.5 µM Oxa, the supernatant was collected for cytokine array analysis. The results are as follows: Figure 6 As shown in A. Cytokine chip analysis experiments showed that 5-FU / Oxa promoted TIMP-2 secretion, while knocking down ATG5 to inhibit autophagy significantly inhibited TIMP-2 secretion.
[0064] 2. Simulate the clinical 5-FU-based chemotherapy regimen. Human and mouse autophagy-normal (RKOshCtrl / CT-26sgCtrl) and autophagy-deficient (RKO shATG5 / CT-26 sgAtg5) cell lines were treated with 5-FU combined with oxaliplatin (Oxa). RKO cells were treated with 100 µM 5-FU combined with 2.5 µM Oxa for 48 h, and CT-26 cells were treated with 10 µM 5-FU combined with 0.25 µM Oxa for 48 h. Cell culture supernatants were collected and enzyme-linked immunosorbent assay (ELISA) was used to detect changes in TIMP-2 secretion. The results are as follows: Figure 6 As shown in BC.
[0065] These results indicate that chemotherapy-induced TIMP-2 upregulation is dependent on tumor cell autophagy. Chemotherapy can promote TIMP-2 secretion, while inhibition of autophagy significantly suppresses TIMP-2 secretion.
[0066] Example 5: TIMP-2 is a key effector molecule regulating chemotherapy sensitivity. Knockout of TIMP-2 inhibits the sensitivity of mouse colorectal tumor models to chemotherapy.
[0067] To investigate the role of secretory protein TIMP-2 in chemotherapy response and regulation of anti-tumor immunity, this example established a TIMP-2 knockout mouse colorectal tumor cell line (CT-26-sgTimp-2) based on the CRISPR / Cas9 gene editing system. The sgRNA sequence targeting the TIMP-2 gene locus was sgTIMP-2:5'-CGCCTGTTGCGGGTGCACCG-3'. The knockout effect was detected by WB. The results are shown in Figure 3. Figure 7 A. A colorectal tumor model was established in immunocompetent mice using control cells CT-26-sgCtrl and CT-26-sgTIMP-2.
[0068] A subcutaneous colorectal tumor model (2×10 6 cells / mouse) until the tumor size reaches 100 mm 3 , simulated the clinical 5-FU-based chemotherapy regimen using 5-FU combined with Oxa to treat the mouse colorectal tumor model (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal administration, three times a week). After two weeks of administration, the changes in mouse tumor volume and weight were monitored. The results are as follows Figure 7 Total CD8 + T cells and activated CD8 + T (Ly6C + CD8 + T) cell abundance, the results are as follows Figure 7 As shown in EF.
[0069] The results showed that knockout of TIMP-2 could significantly inhibit chemotherapy sensitivity and chemotherapy-induced anti-tumor immunity, including total CD8 + The abundance of T cells and effector T cells was significantly reduced. The above results suggest that the secreted protein TIMP-2 is a key downstream "link" molecule in which tumor cell autophagy mediates the sensitivity of colorectal tumor chemotherapy. Knockdown of TIMP-2 significantly inhibited the sensitivity of mouse colorectal tumor models to chemotherapy. At the same time, the total CD8 + T cells and activated CD8 + The T ratio decreased significantly.
[0070] Example 6: Autophagy-TIMP-2 signaling axis is significantly positively correlated with chemotherapy response in clinical colorectal cancer patients
[0071] To evaluate the feasibility of the autophagy-TIMP-2 signaling axis as a potential biomarker for predicting chemotherapy efficacy in patients with colorectal cancer, this example analyzed the correlation between autophagy levels and TIMP-2 expression in a clinical sample database. At the same time, clinical samples were collected to further verify the correlation between the autophagy-TIMP-2 signaling axis and chemotherapy sensitivity.
[0072] 1. Analysis of the correlation between autophagy levels and TIMP-2 expression in different clinical sample databases
[0073] The autophagy level was evaluated using the autophagy score (the mean expression value of the genes contained in the GOBP_POSITIVE_REGULATION_OF_AUTOPHAGY dataset was used as the autophagy score, reference: 2021.Cell, Colorectal Cancer Cells Enter a Diapause-like DTP State to SurviveChemotherapy). The higher the autophagy score, the higher the autophagy level. The external validation cohorts used were from TCGA_COADREAD (431 samples), GSE69657 (samples collected after FOLFOX treatment, including 17 resistant cases and 13 sensitive cases, a total of 30 tumor tissue samples), and GSE45404 (FOLFOX, samples collected before treatment, including 10 resistant cases and 12 sensitive cases, a total of 22 tumor tissue samples). The results are as follows: Figure 8 As shown in Figure A, the autophagy level in clinical samples was significantly positively correlated with TIMP-2 expression.
[0074] The comparison results of TIMP-2 expression levels in chemotherapy-resistant (Resistant) and sensitive (Sensitive) groups are as follows Figure 8 The results showed that TIMP-2 expression was significantly positively correlated with chemotherapy sensitivity, and TIMP-2 expression was high in samples from sensitive patients (published databases GSE12246, samples before FOLFOX treatment; GSE69657, samples after FOLFOX treatment).
[0075] 2. Verify the correlation between the autophagy-TIMP-2 signaling axis and chemotherapy sensitivity
[0076] To validate the correlation between the autophagy-TIMP-2 signaling axis and chemotherapy sensitivity, this study collected post-treatment colorectal cancer samples from the Sixth Affiliated Hospital of Sun Yat-sen University as a validation set. (Responder and non-responder tumors were categorized according to the TRG score, with TRG = 2 designated as sensitive and TRG = 3 as resistant, totaling 40 tumor tissue samples.) FOLFOX was used as the treatment regimen. Sensitivity was assessed using the Standard-TRG score, which ranges from 0 to 4, with increasing values indicating decreased sensitivity. According to existing literature, TRG <= 2 is considered sensitive, while TRG >= 3 is considered resistant. Due to sample availability limitations, samples with TRG = 2 and TRG = 3 were collected in this study to represent the sensitive and resistant populations, respectively. TRG = 2 was considered sensitive, while TRG = 3 was considered resistant. The definitions of sensitivity and resistance in the cohort collected for this study were based on the published literature: Ref: Pharmacological modulation of RB1 activity mitigates resistance toneoadjuvant chemotherapy in locally advanced rectal cancer. 2024, PNAS. TRG3 significantly shortened DFS compared to TRG1 and 2. Therefore, TRG = 3 was defined as non-responder, and TRG = 2 as responder. p-ATG16L1 (Ser278) expression levels were used as a marker for assessing autophagy levels; higher p-ATG16L1 expression levels indicate higher autophagy levels. Immunofluorescence was used to assess the expression of autophagy markers (p-ATG16L; higher expression indicates higher autophagy levels) and TIMP-2 in clinical samples. High and low expression levels of p-ATG16L1 and TIMP-2 were distinguished based on the mean expression values of all samples.
[0077] The results are as follows Figure 8 As shown in Figure C, the proportion of high p-ATG6L1 expression / high TIMP-2 expression in chemotherapy-sensitive patients was significantly higher than that in insensitive patients, further confirming that the autophagy-TIMP-2 signaling axis (p-ATG6L1 / TIMP-2) was significantly positively correlated with chemotherapy sensitivity.
[0078] 3. This example also used data from a published clinical sample database to plot a Kaplan-Meier curve and establish the correlation between TIMP-2 and patient survival prognosis (GSE143985 has 91 samples and GSE24550 has 77 samples, with a total of 168 samples in the two datasets. Both tested RNA expression, and the optimal cut-off option provided by the Kaplan-Meier plotter website was selected as the cut-off, with a specific value of 2.19483. According to this value, the number of samples with high TIMP-2 was 106 and the number of samples with low TIMP-2 was 62). The results are as follows: Figure 8 As shown in D, the higher the TIMP-2 level, the higher the patient's five-year survival rate (DFS).
[0079] These results indicate that the autophagy-TIMP-2 signaling axis has significant clinical relevance. Autophagy levels are significantly positively correlated with TIMP-2 expression, and autophagy / TIMP-2 is significantly positively correlated with chemotherapy sensitivity and patient survival.
[0080] Example 7: TIMP-2 restores chemotherapy sensitivity in an autophagy-deficient mouse colorectal tumor model by inhibiting MMP-2 / 9 activity
[0081] To evaluate whether TIMP-2 enhances the chemotherapy sensitivity of autophagy-deficient colorectal tumors by targeting MMP-2 / 9, this example used an autophagy-deficient colorectal tumor cell line (CT-26 sgATG5) to establish mouse colorectal tumor cell lines overexpressing full-length TIMP-2 and loss-of-function mutants (loss of MMP-2 / 9 inhibitory function). These cell lines are CT-26-sgATG5+TIMP-2 WT (overexpressing full-length TIMP-2), CT-26-sgATG5+TIMP-2Ala+mt (TIMP-2 alanine mutant, loss of MMP-2 / 9 inhibitory function), and CT-26-sgATG5+TIMP-2-C (TIMP-2 N-terminal 1-126 amino acid deletion mutant, loss of MMP-2 / 9 inhibitory function). Empty vector EV was also used as a control.
[0082] The specific experimental methods are as follows:
[0083] 1. Amplify the target fragment using PCR. The primers used include:
[0084] TIMP-2Ala+mt (TIMP-2 alanine mutant, loss of MMP-2 / 9 inhibitory function) forward primer: 5′-GAAGCTTGCAGCTGCTCCCCGGTGC-3′;
[0085] TIMP-2-C (TIMP-2 N-terminal 1-126 amino acid deletion mutant, lacking MMP-2 / 9 inhibitory function) forward primer: 5′- GAGTGCAAGATCACTCGCTGTC -3′;
[0086] TIMP-2Ala+mt and TIMP-2-C backward primer (common to both mutants): 5′-GGCGTCGGCCGGGCGCAGCAGCGTG-3′.
[0087] 2. After enzyme digestion, the target fragment was ligated to the overexpression viral vector Plenti-CRISPR-V2 to construct a vector that overexpresses the corresponding target protein. After sequencing verification, 2μg TIMP-2 OE plasmid, 2μg pREV, 2μg pGag / Pol, and 1μg pVSVG were transfected into HEK 293T cells using Lipofectamine2000 reagent. 48 hours after transfection, the culture medium containing the lentiviral particles was aspirated, centrifuged at 1000 g for 5 minutes to discard the cell debris, and the virus liquid was collected to infect the autophagy-deficient mouse cell line (CT-26sgAtg5). After 72 hours, the product Blastidicin (10 mg / mL) encoded by the resistance gene carried by the vector was used for screening. One week later, the cells were collected and the successful expression of the target protein was verified by WB and fluorescence quantitative PCR (qRT-PCR). The results are as follows Figure 9 shown.
[0088] The subcutaneous colorectal tumor model was established using 6-8 week old BALB / c immune competent mice. The mice were subcutaneously inoculated with the mouse colorectal tumor cell lines overexpressing TIMP-2 and TIMP-2 functional mutants prepared above (2×10 6 cells / mouse) until the tumor size reaches 100 mm 3 , simulated the clinical 5-FU-based chemotherapy regimen using 5-FU+Oxa (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal administration, three times a week), administered for two weeks, and monitored tumor growth, volume and weight changes. The results are as follows Figure 10 Flow cytometry (FACS) was used to detect changes in the immune microenvironment, including total CD8 + T cells and activated CD8 + The abundance of T changes, the results are as follows Figure 11 shown.
[0089] The results showed that overexpression of wild-type full-length TIMP-2 could significantly restore the sensitivity of autophagy-deficient colorectal tumors to chemotherapy, while overexpression of TIMP-2 loss-of-function mutant (loss of MMP-2 / 9 inhibitory function) could not restore chemotherapy sensitivity, suggesting that TIMP-2 enhances chemotherapy sensitivity by inhibiting MMP-2 / 9.
[0090] Example 8: SB-3CT, a small molecule inhibitor targeting MMP-2 / 9, can significantly restore the sensitivity of autophagy-deficient colorectal tumors to chemotherapy
[0091] BALB / c immunocompetent mice aged 6-8 weeks were inoculated with autophagy-competent (CT-26sgCtrl) or autophagy-deficient (CT-26sgAtg5) mouse colorectal tumor cells to establish a subcutaneous colorectal tumor model in mice. 3 , simulated the clinical 5-FU-based chemotherapy regimen using 5-FU+Oxa or 5-FU+Oxa combined with MMP-2 / 9 inhibitor (SB-3CT) to treat mouse colorectal tumor models (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, 20 mg / kg SB-3CT, intraperitoneal administration, three times a week). After two weeks of administration, tumor growth, volume and weight changes were monitored. The results are as follows Figure 12 AC. Flow cytometry (FACS) was used to detect the changes in the immune microenvironment of tumor tissues in the three groups of mice, including the total CD8 + T cells and activated CD8 + The abundance of T changes, the results are as follows Figure 12 DE shown.
[0092] In this example, the small molecule inhibitor SB-3CT was used to target MMP-2 / 9. The results showed that the small molecule inhibitor SB-3CT targeting MMP-2 / 9 can exert a function similar to that of TIMP-2 overexpression, namely, restoring the sensitivity of autophagy-deficient colorectal tumors to chemotherapy.
[0093] Taken together, these results indicate that overexpression of TIMP-2 or targeting its downstream MMP-2 / 9 can restore the sensitivity of the autophagy-deficient mouse colorectal tumor model to chemotherapy and the anti-tumor immunity induced by chemotherapy.
[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. Use of a biomarker for predicting colorectal cancer chemotherapy sensitivity in the preparation of a product for predicting colorectal cancer chemotherapy sensitivity or prognosis, characterized in that: The biomarker is p-ATG16L Ser278 -TIMP-2 signaling axis; the biomarkers include p-ATG16L Ser278 and TIMP-2 protein; the chemotherapy sensitivity refers to the sensitivity of colorectal cancer patients to chemotherapy drugs, and the chemotherapy drugs include 5-FU and oxaliplatin.
2. The use of a biomarker for predicting colorectal cancer chemotherapy sensitivity in the preparation of a product for screening colorectal cancer chemotherapy-sensitive populations, characterized in that: The biomarker is p-ATG16L Ser278 -TIMP-2 signaling axis; the biomarkers include p-ATG16L Ser278 and TIMP-2 protein; the chemotherapy sensitivity refers to the sensitivity of colorectal cancer patients to chemotherapy drugs, and the chemotherapy drugs include 5-FU and oxaliplatin.
3. Use of a substance that overexpresses TIMP-2 and / or a substance that inhibits MMP2 / 9 in the preparation of a drug for reversing the resistance of patients with colorectal cancer autophagy deficiency to chemotherapy with a 5-FU combined with oxaliplatin treatment regimen, characterized in that: The substance that overexpresses TIMP-2 is the overexpression viral vector Plenti-CRISPR-V2 that overexpresses wild-type full-length TIMP-2; and the substance that targets and inhibits MMP2 / 9 is SB-3CT.
Citation Information
Patent Citations
Technology for regulating and controlling Jak-Stat pathway to differentiate, dedifferentiate and rejuvenate cells, and application of technology
CN110423719A