Non-magical fantasy fungi

The preparation of non-psychedelic fungi by destroying the activity or gene expression of PsiD, PsiH, PsiK or PsiM enzymes solves the problems of hallucinogenic effects and legal risks of psilocybin, and retains the beneficial properties of other biologically active alkaloids.

CN120418409APending Publication Date: 2025-08-01LUMINOUS MIND INC
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202380072599.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-08-11
Filing Date
2023-08-11
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

The prior art cannot effectively utilize the beneficial effects of psilocybin-producing fungi, and their hallucinogenic effects are not applicable to certain individuals, and there are legal risks and possibility of abuse.

Method used

Non-talactogenic psychedelic fungi are prepared by disrupting the activity or gene expression of PsiD, PsiH, PsiK or PsiM enzymes, reducing or eliminating the production of psilocybin, and preserving the beneficial properties of other biologically active alkaloids.

Benefits of technology

It achieves the provision of non-psychedelic fungi with therapeutic and benefits without violation of the law, reducing legal risks and inapplicability, and retaining the beneficial properties of other biologically active alkaloids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120418409A_ABST
    Figure CN120418409A_ABST
Patent Text Reader

Abstract

The present invention provides genetically modified fungi, such as non-magical fantasy fungi, in which the biochemical pathways that produce bioactive alkaloids are disrupted. In some aspects, the stropharia rugoso-annulata biosynthetic pathway is disrupted, resulting in a non-magical fantasy fungus that does not produce or contains stropharia rugoso-annulata, or produces or contains a significantly reduced amount of stropharia rugoso-annulata relative to a wild-type fungus. Also provided are methods of making genetically modified fungi, e.g., by disrupting or rebalancing biochemical pathways therein, e.g., nummulina velutipes biosynthetic pathways, e.g., by using gene editing techniques, including by gene inactivation of small interfering RNA (siRNA), microRNA (miRNA), and CRISPR / Cas9. Also provided are compositions of genetically modified fungi, e.g., compositions of non-magical funguses, as well as methods of their use, including as functional foods, alpiniae, legal microdoses, nutraceuticals, and therapeutic agents.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross - reference

[0002] Claims priority to U.S. Provisional Application No. 63 / 371,121, filed Aug. 11, 2022, under PCT Article 8(1) and Rule 4.10, and which is hereby incorporated by reference in its entirety for all purposes as if fully set forth herein, including the accompanying ST.26 Sequence Listing, which was created on Aug. 4, 2022, named 122313 - 10103_sequence.xml and is 158 kb in size, and is in.xml format. Technical Field

[0003] The present invention generally relates to genetically modified fungi and their uses. In some aspects, the present invention relates to non - hallucinogenic psychedelic fungi, methods for preparing such fungi, compositions of such fungi, and methods of using such fungi and their compositions. Background Art

[0004] Psilocybin - producing fungi, commonly known as "magic mushrooms", are a polyphyletic group of fungi that are enzymatically synthesized and thus contain psilocybin. When a psilocybin - producing fungus is ingested, psilocybin is rapidly converted to its metabolite psilocin, which is the compound responsible for the "hallucinogenic" or "psychedelic" effects of magic mushrooms. Genera that contain psilocybin - producing fungi include, for example, Conocybe, Copelandia, Galerina, Gymnopilus, Inocybe, Mycena, Panaeolus, Pholiotina, Pluteus, and Psilocybe.

[0005] In addition to containing psilocybin, psilocybin - producing fungi are also rich in many other bioactive metabolites that provide therapeutic and other benefits for human health. These include other alkaloids such as "minor" tryptamines, including norbaeocystin, baeocystin, norpsilocin, and aeruginascin, as well as compounds such as phenols, terpenoids, glucans, polysaccharides, and lectins, which can provide antioxidant and other beneficial effects.

[0006] The U.S. Drug Enforcement Administration places psilocybin in Schedule I drugs under the Controlled Substances Act, which means that it currently has no accepted medical use and has a high potential for abuse. Thus, the beneficial effects of psilocybin - producing fungi cannot be obtained without violating federal law. In addition, the hallucinogenic effects of psilocybin, including profound alterations in consciousness, may be inappropriate for some individuals (e.g., those with certain pre - existing mental health conditions) or for certain individuals at certain times.

[0007] Accordingly, there is a need for fungi that can confer many of the benefits of psilocybin-producing fungi but have eliminated or reduced psilocybin content and thus no legal risks or other drawbacks associated with psilocybin. In non-limiting examples, such "non-hallucinogenic psychedelic fungi" and compositions prepared therefrom can be used as functional foods, nootropics, and legal "microdoses" of other psychedelic fungi.

[0008] To meet this and other needs, the present disclosure provides such non-hallucinogenic psychedelic fungi, methods of preparing the fungi, compositions of the fungi, and methods of using the fungi and their compositions, each of which will be understood to have such advantages and improvements as will become readily apparent from the following disclosure.

[0009] Incorporated by reference

[0010] Each cited patent, publication, and non-patent literature is incorporated by reference in its entirety as if incorporated by reference individually. Unless otherwise specifically stated, a reference should not be construed as an admission that the document or any underlying information therein is prior art in any jurisdiction or forms part of the common general knowledge in the art. Summary of the Invention

[0011] A simplified overview of some embodiments of the present invention is given below in order to provide a basic understanding thereof. This overview is not an extensive overview of the present invention. It is not intended to identify key or critical elements of the present invention or to delineate the scope of the present invention. Its sole purpose is to present some embodiments of the present invention in a simplified form as a prelude to the more detailed description that follows.

[0012] In some aspects, non-hallucinogenic psychedelic fungi with reduced production of bioactive alkaloids are disclosed, wherein the fungi have disrupted activity of one or more of the PsiD, PsiH, PsiK, or PsiM enzymes.

[0013] In some embodiments, the bioactive alkaloid is tryptamine, 4-hydroxytryptamine, norbaeocystin, baeocystin, or psilocybin. In some embodiments, the bioactive alkaloid is a hallucinogenic tryptamine. In some embodiments, the hallucinogenic tryptamine is psilocybin.

[0014] In some embodiments, the fungus is a Psilocybe spp. fungus. In some embodiments, the Psilocybe spp. fungus is Psilocybe cubensis or Psilocybe cyanescens.

[0015] In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted activity of the PsiD enzyme. In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted activity of the PsiH enzyme. In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted activity of the PsiK enzyme. In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted activity of the PsiM enzyme. In some embodiments, the disrupted activity is the result of disrupted expression of one or more of the PsiD, PsiH, PsiK, or PsiM genes.

[0016] In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted expression of the PsiD gene. In some embodiments, the disrupted expression of the PsiD gene includes downregulation of the PsiD gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR. In some embodiments, when measured by qRT-PCR, no detectable transcript of the PsiD gene is present. In some embodiments, the PsiD gene expression is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO:52, 53, 54, 55, or 56 or the reverse complementary sequence thereof.

[0017] In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted expression of the PsiH gene. In some embodiments, the disrupted expression of the PsiH gene includes downregulation of the PsiH gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR. In some embodiments, when measured by qRT-PCR, no detectable transcript of the PsiH gene is present. In some embodiments, the PsiH gene expression is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO:67, 68, 69, 70, or 71 or the reverse complementary sequence thereof.

[0018] In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted expression of the PsiK gene. In some embodiments, the disrupted expression of the PsiK gene includes downregulation of the PsiK gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR. In some embodiments, the non-hallucinogenic psychedelic fungus does not contain detectable transcripts of the PsiK gene when measured by qRT-PCR. In some embodiments, the PsiK gene expression is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO:57, 58, 59, or 61 or the reverse complementary sequence thereof.

[0019] In some embodiments, the non-hallucinogenic psychedelic fungus has disrupted expression of the PsiM gene. In some embodiments, the disrupted expression of the PsiM gene includes downregulation of the PsiM gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR. In some embodiments, the non-hallucinogenic psychedelic fungus does not contain detectable transcripts of the PsiM gene when measured by qRT-PCR. In some embodiments, the PsiM gene expression is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO:62, 63, 64, 65, or 66 or the reverse complementary sequence thereof.

[0020] In some embodiments, the non-hallucinogenic psychedelic fungus contains a deletion of one or more of the PsiD, PsiH, PsiK, and PsiM genes.

[0021] In some embodiments, the non-hallucinogenic psychedelic fungus contains a deletion of the PsiD gene. In some embodiments, the PsiD gene is deleted using CRISPR / Cas9. In some embodiments, deletion of the PsiD gene includes using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO:13, 14, 15, 16, or 17 or the reverse complementary sequence thereof.

[0022] In some embodiments, the non-hallucinogenic psychedelic fungus comprises a deletion of the PsiH gene. In some embodiments, the PsiH gene is deleted using CRISPR / Cas9. In some embodiments, deleting the PsiH gene comprises using an sgRNA having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO: 27, 28, 29, 30, or 31 or the reverse complementary sequence thereof.

[0023] In some embodiments, the non-hallucinogenic psychedelic fungus comprises a deletion of the PsiK gene. In some embodiments, the PsiK gene is deleted using CRISPR / Cas9. In some embodiments, deleting the PsiK gene comprises using an sgRNA having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO: 18, 19, 20, 21, or 22 or the reverse complementary sequence thereof.

[0024] In some embodiments, the non-hallucinogenic psychedelic fungus comprises a deletion of the PsiM gene. In some embodiments, the PsiM gene is deleted using CRISPR / Cas9. In some embodiments, deleting the PsiM gene comprises using an sgRNA having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence selected from SEQ ID NO: 22, 23, 24, 25, or 26 or the reverse complementary sequence thereof.

[0025] In some embodiments, the disrupted activity or disrupted expression is caused by gene knockout of one or more of the PsiD, PsiH, PsiK, and PsiM genes. In some embodiments, the disrupted activity or disrupted expression is caused by gene knockout of two or more of the PsiD, PsiH, PsiK, and PsiM genes. In some embodiments, the disrupted activity or disrupted expression is caused by gene knockout of three or more of the PsiD, PsiH, PsiK, and PsiM genes. In some embodiments, the disrupted activity or disrupted expression is caused by gene knockout of all four PsiD, PsiH, PsiK, and PsiM genes. In some embodiments, the gene knockout is caused at least in part by homologous recombination. In some embodiments, the gene knockout is produced at least in part by using zinc finger nucleases. In some embodiments, the gene knockout at least partly results from using TALEN. In some embodiments, the gene knockout at least partly originates from using CRISPR / Cas9. In some embodiments, the gene knockout is produced at least in part by using small interfering RNA (siRNA). In some embodiments, the gene knockout is produced at least in part by using microRNA (miRNA).

[0026] In some embodiments, the disrupted activity or disrupted expression is not caused by the insertion of foreign genetic material.

[0027] In some embodiments, the production of psilocybin is reduced by greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, greater than 99.9%, greater than 99.95% or greater than 99.99% relative to a comparable wild-type fungus. In some embodiments, the fungus contains less than 0.15, less than 0.10, less than 0.05, less than 0.001 or less than 0.005 weight / weight% psilocybin when dried. In some embodiments, the non-hallucinogenic psychedelic fungus does not contain detectable psilocybin.

[0028] In some embodiments, the non-hallucinogenic psychedelic fungus further comprises bioactive alkaloids other than psilocybin. In some embodiments, the bioactive alkaloids other than psilocybin are tryptamine, 4-hydroxytryptamine, norbaeocystin, or baeocystin. In some embodiments, the bioactive alkaloids other than psilocybin have therapeutic or beneficial properties. In some embodiments, the therapeutic or beneficial properties are any one of antibacterial, antibiotic, antifungal, anti-cancer, immunosuppressive, immunostimulatory, anti-inflammatory, hypoglycemic, antioxidant, antiviral, anti-neurodegenerative, anti-epileptic, neuroprotective, anti-angiogenic, anti-diabetic, or cholesterol-lowering properties. In some embodiments, the non-hallucinogenic psychedelic fungus comprises an increased amount of bioactive alkaloids other than psilocybin relative to a comparable wild-type fungus. In some embodiments, the increased amount is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, or at least 500% increase relative to a comparable wild-type fungus.

[0029] In some aspects, a method of preparing a non-hallucinogenic psychedelic fungus with reduced bioactive alkaloid production is disclosed, comprising disrupting the activity of one or more of the PsiD, PsiH, PsiK, or PsiM enzymes.

[0030] In some embodiments, the bioactive alkaloids are tryptamine, 4-hydroxytryptamine, norbaeocystin, baeocystin, or psilocybin. In some embodiments, the bioactive alkaloids are hallucinogenic tryptamines. In some embodiments, the hallucinogenic tryptamine is psilocybin.

[0031] In some embodiments, the fungus is a Psilocybe spp. fungus. In some embodiments, the Psilocybe spp. fungus is Psilocybe cubensis or Psilocybe cyanescens.

[0032] In some embodiments, the method comprises disrupting the activity of the PsiD enzyme. In some embodiments, the method comprises disrupting the activity of the PsiH enzyme. In some embodiments, the method comprises disrupting the activity of the PsiK enzyme. In some embodiments, the method comprises disrupting the activity of the PsiM enzyme.

[0033] In some embodiments, the method comprises disrupting the expression of one or more of the PsiD, PsiH, PsiK, or PsiM genes.

[0034] In some embodiments, the method includes disrupting the expression of the PsiD gene. In some embodiments, the expression of the PsiD gene is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO:52, 53, 54, 55, or 56 or the reverse complementary sequence thereof.

[0035] In some embodiments, the method includes disrupting the expression of the PsiH gene. In some embodiments, the expression of the PsiH gene is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO:67, 68, 69, 70, or 71 or the reverse complementary sequence thereof.

[0036] In some embodiments, the method includes disrupting the expression of the PsiK gene. In some embodiments, the expression of the PsiK gene is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO:57, 58, 59, or 61 or the reverse complementary sequence thereof.

[0037] In some embodiments, the method includes disrupting the expression of the PsiM gene. In some embodiments, the expression of the PsiM gene is disrupted using siRNA. In some embodiments, the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO:62, 63, 64, 65, or 66 or the reverse complementary sequence thereof.

[0038] In some embodiments, the method includes deleting one or more of the PsiD, PsiH, PsiK, and PsiM genes.

[0039] In some embodiments, the method includes deleting the PsiD gene. In some embodiments, the PsiD gene is deleted using CRISPR / Cas9. In some embodiments, deleting the PsiD gene includes using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO:13, 14, 15, 16, or 17 or the reverse complementary sequence thereof.

[0040] In some embodiments, the method comprises deleting the PsiH gene. In some embodiments, the CRISPR / Cas9 is used to delete the PsiH gene. In some embodiments, deleting the PsiH gene comprises using an sgRNA having at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 27, 28, 29, 30 or 31 or its reverse complementary sequence.

[0041] In some embodiments, the method comprises deleting the PsiK gene. In some embodiments, the CRISPR / Cas9 is used to delete the PsiK gene. In some embodiments, deleting the PsiK gene comprises using an sgRNA having at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 18, 19, 20, 21 or 22 or its reverse complementary sequence.

[0042] In some embodiments, the method comprises deleting the PsiM gene. In some embodiments, the CRISPR / Cas9 is used to delete the PsiM gene. In some embodiments, deleting the PsiM gene comprises using an sgRNA having at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 22, 23, 24, 25 or 26 or its reverse complementary sequence.

[0043] In some embodiments, the method comprises knocking out one or more of the PsiD, PsiH, PsiK and PsiM genes. In some embodiments, the method comprises knocking out two or more of the PsiD, PsiH, PsiK and PsiM genes. In some embodiments, the method comprises knocking out three or more of the PsiD, PsiH, PsiK and PsiM genes. In some embodiments, the method comprises knocking out all four of the PsiD, PsiH, PsiK and PsiM genes.

[0044] In some embodiments, the method comprises knocking out one or more of the genes using homologous recombination at least in part. In some embodiments, the method comprises knocking out one or more of the genes using zinc finger nucleases at least in part. In some embodiments, the method comprises knocking out one or more of the genes using TALENs at least in part. In some embodiments, the method comprises knocking out one or more of the genes using CRISPR / Cas9 at least in part. In some embodiments, the method comprises knocking out one or more genes using small interfering RNA (siRNA) at least in part. In some embodiments, the method comprises knocking out one or more genes using microRNA (miRNA) at least in part. In some embodiments, the method does not include inserting exogenous genetic material.

[0045] In some embodiments, the production of psilocybin is reduced by an amount greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, greater than 99.9%, greater than 99.95% or greater than 99.99% relative to a comparable wild-type fungus. In some embodiments, the fungus contains less than 0.15, less than 0.10, less than 0.05, less than 0.001 or less than 0.005 weight / weight% of psilocybin when dry. In some embodiments, the fungus does not contain detectable psilocybin.

[0046] In some embodiments, the fungus further comprises bioactive alkaloids other than psilocybin. In some embodiments, the bioactive alkaloids other than psilocybin are tryptamine, serotonin, norbaeocystin or baeocystin. In some embodiments, the bioactive alkaloids other than psilocybin have therapeutic or beneficial properties. In some embodiments, the therapeutic or beneficial properties are any one of antibacterial, antibiotic, antifungal, anticancer, immunosuppressive, immunostimulatory, anti-inflammatory, hypoglycemic, antioxidant, antiviral, anti-neurodegenerative, anti-epileptic, neuroprotective, anti-angiogenic, antidiabetic or cholesterol-lowering properties. In some embodiments, the fungus contains an increased amount of bioactive alkaloids other than psilocybin relative to a comparable wild-type fungus. In some embodiments, the increased amount is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300% or at least 500% increase relative to a comparable wild-type fungus.

[0047] Certain relevant features of the present disclosure have been generally outlined above, enabling a better understanding of the detailed description of the present invention below and a more comprehensive understanding of the contributions to the art. Accordingly, this summary is considered to be a brief and general overview of only some of the purposes and embodiments disclosed herein, provided solely for the benefit and convenience of the reader and not intended to limit in any way the scope legally authorized by the claims or the scope of equivalents. Other features of the present invention are described below. Those skilled in the art will appreciate that all of the specific compositions and methods disclosed are exemplary only and can readily be used as a basis for modifying or designing other compositions and methods for achieving the same purposes. Such equivalent compositions and methods will be understood to be within the scope and spirit of the present invention as set forth in the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] To further clarify various aspects of the present invention, a more specific description is made by reference to certain exemplary embodiments shown in the accompanying drawings. It should be understood that these drawings depict only illustrative embodiments of the present invention and should not be considered as limiting its scope. They are provided only as an exemplary illustration of certain concepts of some embodiments of the present invention. These figures and the elements depicted therein are not necessarily drawn to scale or in any scale. Unless the context otherwise implies, the same elements are denoted by the same numerals. Accordingly, certain aspects of the present invention are further described and explained with additional specificity and detail, but still only by way of example, with reference to the accompanying drawings, in which:

[0049] Figure 1 A consensus sequence alignment of the PsiD genes from P. cubensis and P. cyanescens is shown. Exemplary regions of nucleotide conserved segments are indicated in gray. These regions can be targeted for knocking out or silencing the PsiD gene using CRISPR or siRNA oligonucleotides across various species. Longer consensus regions (>9 bp) are preferred target regions for oligonucleotide binding.

[0050] Figure 2 A consensus sequence alignment of the PsiK genes from P. cubensis and P. cyanescens is shown. Exemplary regions of nucleotide conserved segments are indicated in gray. These regions can be targeted for knocking out or silencing the PsiK gene using CRISPR or siRNA oligonucleotides across various species. Longer consensus regions (>9 bp) are preferred target regions for oligonucleotide binding.

[0051] Figure 3Shows the consensus sequence alignment of the PsiM gene from P. cubensis and P. cyanescens. Exemplary regions of conserved segments of nucleotides are indicated in gray. These regions can be targeted for knocking out or silencing the PsiM gene using CRISPR or siRNA oligonucleotides across various species. Longer consensus regions (>9bp) serve as preferred target regions for oligonucleotide binding.

[0052] Figure 3 Shows the consensus sequence alignment of the PsiH gene from P. cubensis and P. cyanescens. Exemplary regions of conserved segments of nucleotides are indicated in gray. These regions can be targeted for knocking out or silencing the PsiH gene using CRISPR or siRNA oligonucleotides across various species. Longer consensus regions (>9bp) serve as preferred target regions for oligonucleotide binding.

[0053] Figure 4 Shows the consensus sequence alignment of the PsiH gene from P. cubensis and P. cyanescens. Exemplary regions of conserved segments of nucleotides are indicated in gray. These regions can be targeted for knocking out or silencing the PsiH gene using CRISPR or siRNA oligonucleotides across various species. Longer consensus regions (>9bp) serve as preferred target regions for oligonucleotide binding.

[0054] Figure 5 Shows the consensus sequence alignment of the PsiD polypeptide from P. cubensis and P. cyanescens. Exemplary regions of conserved segments of amino acids are indicated in gray.

[0055] Figure 6 Shows the consensus sequence alignment of the PsiK polypeptide from P. cubensis and P. cyanescens. Exemplary regions of conserved segments of amino acids are indicated in gray.

[0056] Figure 7 Shows the consensus sequence alignment of the PsiM polypeptide from P. cubensis and P. cyanescens. Exemplary regions of conserved segments of amino acids are indicated in gray.

[0057] Figure 8 Shows the consensus sequence alignment of the PsiH polypeptide from P. cubensis and P. cyanescens. Exemplary regions of conserved segments of amino acids are indicated in gray.

[0058] Figure 9Shows a schematic of the biosynthesis of psilocybin from L-tryptophan catalyzed by PsiD, PsiH, PsiK, and PsiM (adapted from Fricke, J., Blei, F., & Hoffmeister, D. (2017). Enzymatic synthesis of psilocybin. Angewandte Chemie Int’Ed., 56(40), 12352-12355). The in vivo biosynthesis of psilocybin starting from L-tryptophan in P. cubensis is depicted, where the PsiD, PsiH, PsiK, and PsiM enzymes are depicted along with the steps they catalyze, and the accompanying circles with diagonals indicate that in different embodiments herein, one or more such enzymes and the steps they catalyze are disrupted.

[0059] Figure 10 Shows the chemical structures of psilocybe natural products and enzyme products (adapted from Fricke et al. 2017). Detailed Description

[0060] Although aspects and features of certain embodiments are outlined above, the following detailed description further elaborates several exemplary embodiments to enable one of ordinary skill in the art to which this invention pertains (the “person skilled in the art”) to practice these embodiments and to make and use the full scope of the claimed invention.

[0061] It should be understood that those skilled in the art can make many modifications, substitutions, alterations, and variations to the examples, embodiments, applications, and details of the invention shown herein without departing from the spirit of the invention or the scope of the invention as set forth in the appended claims, and that the general principles defined herein can be applied to a wide range of aspects. Accordingly, the invention is not intended to be limited to the aspects presented, but rather to the broadest scope consistent with the disclosed principles and novel features. The following description is designed to make these embodiments obvious to a person skilled in the art, as the embodiments should be readily recognizable and readily created using only the teachings herein and the common general knowledge of the art, without undue experimentation.

[0062] While the methods described and shown herein may include specific steps, it should be apparent that other methods including fewer, more, or different steps than those described and shown are also within the spirit and scope of the invention. Accordingly, the methods and the use of the steps discussed and related shown herein should be understood to be provided for illustrative purposes only and not for limitation. It should be further understood that the particular order or hierarchy of steps in the disclosed methods and uses are merely exemplary methods.

[0063] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Although the term "one or more" may be used, its absence (or its replacement by the singular) does not imply only the singular. The terms "comprising", "including", "such as", and "having" are intended to be inclusive rather than exclusive (i.e., other elements may exist in addition to the recited elements). Accordingly, the term "including" as used herein refers to the phrase "including but not limited to" and may be used interchangeably with the phrase "including but not limited to". The term "or" as used herein is used to mean "and / or" and may be used interchangeably with the term "and / or" unless the context clearly dictates otherwise.

[0064] All numbers expressing quantities, properties, reaction conditions, etc. used to describe and claim certain embodiments of the present disclosure should be understood to be modified by the term "about" even if they are not explicitly so modified, and should be understood not to be modified by the term "about" even if they are explicitly so modified. Accordingly, each such number should be understood to be both modified and not modified by the term "about".

[0065] In some embodiments, the numerical parameters set forth in the specification and claims are approximations that may vary depending on the desired properties sought to be obtained by a particular embodiment. In some embodiments, "about" means plus or minus five percent (±5%) of the recited unit of measure. The term "substantially", when used to modify a feature or limitation herein and without otherwise defined or described, will be read in the context of the present disclosure and in light of the knowledge in the art to provide the appropriate degree of certainty, e.g., by using the standard recognized in the art for measuring the meaning of "substantially" as a term of degree, or by determining a range as would a person of ordinary skill in the art.

[0066] The headings in this document are provided only to expedite the reader's review. They should not be construed as limiting the invention in any way.

[0067] Definition

[0068] Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art. Further definitions that may assist the reader in understanding the disclosed embodiments are provided below; however, it should be understood that such definitions are not intended to limit the scope of the invention, which is appropriately interpreted and understood by reference to the complete description (and any explicit meanings known to one of ordinary skill in the art) and consideration of the language used in the appended claims. The terms used herein are for the purpose of describing particular embodiments only and are not intended to be limiting.

[0069] The terms "nucleic acid", "polynucleotide", and "oligonucleotide" are used interchangeably and refer to polymers of deoxyribonucleotides or ribonucleotides in linear or circular conformation and in single-stranded or double-stranded form. These terms should not be construed as limiting with respect to the length of the polymer. These terms can encompass known analogs of natural nucleotides, as well as nucleotides modified in the base, sugar, and / or phosphate moiety (such as a phosphorothioate backbone). In general, analogs of a particular nucleotide have the same base-pairing specificity; "Oligo" can be used interchangeably with "oligonucleotide" and is simply a shorthand for "oligonucleotide".

[0070] The terms "polypeptide", "peptide", and "protein" are used interchangeably and refer to polymers of amino acid residues of any length. These terms also apply to amino acid polymers in which one or more amino acids are chemical analogs or modified derivatives of the corresponding natural amino acids.

[0071] "Binding" refers to a non-covalent interaction between macromolecules (such as between a protein and a nucleic acid) that is sequence-specific. Not all components of the binding interaction need to be sequence-specific (such as contacts with phosphate residues in the DNA backbone), so long as the interaction as a whole is sequence-specific. In some embodiments, the binding interaction is characterized by a dissociation constant (K -6 or lower). d )

[0072] "Affinity" refers to the strength of binding, where increased binding affinity is associated with, for example, a lower K d .

[0073] "Binding protein" refers to a protein that is capable of non-covalently binding to another molecule. A binding protein can bind to, for example, a DNA molecule (DNA-binding protein), an RNA molecule (RNA-binding protein), and / or a protein molecule (protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and / or it can bind to one or more molecules of one or more different proteins. A binding protein can have more than one type of binding activity. For example, a zinc finger protein has DNA-binding, RNA-binding, and protein-binding activities.

[0074] "Sequence" refers to a nucleotide sequence of any length, which can be DNA or RNA, linear, circular, or branched, and single-stranded or double-stranded.

[0075] "Donor sequence" refers to a nucleotide sequence inserted into the genome. The donor sequence can be of any length, for example, between 2 and 10,000 nucleotides in length (or any integer value therebetween or above), between about 100 and 1000 nucleotides in length (or any integer therebetween), or between about 200 and 500 nucleotides in length.

[0076] "Homologous, non-identical sequences" refers to a first sequence that shares a degree of sequence identity with a second sequence but whose sequence is not identical to the sequence of the second sequence. For example, a wild-type sequence of a gene containing a mutant gene is homologous and non-identical to the sequence of the mutant gene. In some embodiments, the degree of homology between the two sequences is sufficient to allow homologous recombination therebetween using normal cellular mechanisms. The two homologous non-identical sequences can be of any length, and the degree of their non-homology can be as small as a single nucleotide (e.g., for correcting a genomic point mutation by targeted homologous recombination) or as large as 10 or more kb (e.g., for inserting a gene at a predetermined ectopic site in a chromosome). The two polynucleotides containing homologous non-identical sequences need not have the same length, for example, an exogenous polynucleotide (i.e., a donor polynucleotide) of about 20 to about 10,000 nucleotides or base pairs can be used.

[0077] Techniques for determining nucleic acid and amino acid sequence identity are known in the art. Generally, such techniques include determining the nucleotide sequence of the mRNA of a gene and / or determining the amino acid sequence encoded thereby and comparing these sequences to a second nucleotide or amino acid sequence. Genomic sequences can also be assayed and compared in this manner. Generally, identity refers to the exact nucleotide-nucleotide or amino acid-amino acid correspondence of two polynucleotide or polypeptide sequences, respectively.

[0078] "Gene cluster" refers to a set of genes that together constitute a biosynthetic pathway.

[0079] "Inactivating gene expression" refers to methods for reducing or eliminating gene expression. Inactivation of gene expression can occur by using genome editing techniques, such as clustered regularly interspaced short palindromic repeats (CRISPR), to target one or more of the following: functional DNA elements, such as promoters, CpG islands, transcription start sites (TSS), splice sites, translation start sites, and exons (coding regions). (See Guidelines for optimized gene knockout using CRISPR / Cas9, Van Campenhout et al., Biotechniques, Vol. 66, No. 6, 295-302, June 2019 & Jinek, M. et al. A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science (80) 337, 816-821 (2012)). Inactivation of gene expression can also occur at the transcriptional and translational stages by RNA-guided transcriptional gene silencing techniques such as small interfering RNA (siRNA) and microRNA (miRNA). The siRNA method involves introducing synthetic siRNA into target cells to trigger RNA interference (RNAi), thereby inhibiting the expression of specific messenger RNA (mRNA) to produce a gene silencing effect. (See Transcriptional gene silencing in humans, Weinberg et al., Nucleic Acids Research, Volume 44, Issue 14, 19 August 2016, Pages 6505-6517 & siRNA Versus miRNA as Therapeutics for Gene Silencing, Lam et al., Molecular Therapy-Nucleic acids, Volume 4, e252, January 01, 2015). MicroRNA inhibits the expression of mRNA targets by promoting translational repression and mRNA degradation.(See Gene silencing by microRNAs: contributions of translational repression and mRNA decay, Huntzinger et al., Nature Reviews Genetics vol.12, 99-110 (2011); A guide to microRNA-mediated gene silencing, Huberdeau et al., FEBS Journal 286 (2019) 642-652). Although targeted genetic engineering is used in the preferred embodiments herein, conventional mutagenesis techniques such as TILLING (Targeting Induced Local Lesions In Genomes) can also be used. (See, e.g., Kurowska, Marzena et al. TILLING: a shortcut in functional genomics. Journal of Applied Genetics vol.52, 4 (2011): 371-90).

[0080] "Disrupting", e.g., with respect to "disrupting the biosynthesis of psilocybin in mushrooms", refers to an alteration in structure and / or function as compared to a reference or control, e.g., a wild-type mushroom. For example, "disrupting the biosynthesis of psilocybin in mushrooms" can refer to introducing a genetic defect into one or more genes of the psilocybin biosynthetic pathway and / or into genetic elements involved in the control of the pathway, and / or can refer to an alteration in the function of the psilocybin biosynthetic pathway, such as disruption of psilocybin production; thus the meaning will be understood from the context. In some embodiments, "disrupting" includes disruption of one or more enzymes of the psilocybin biosynthetic pathway. In some embodiments, "disrupting" includes downregulation, e.g., downregulation of (gene) expression and / or downregulation of (enzyme) activity.

[0081] Terms such as "disrupting", "reducing", "decreasing", "inhibiting", "suppressing", etc. will generally refer to a reduction in a specified parameter or specified activity of at least about 5%, 10%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95%, 97%, 98%, 99% or 100%. These terms generally are intended relative to a reference or control, e.g., as disclosed herein. Similarly, terms of enhancement will generally refer to an increase in a specified parameter or specified activity of at least about 1.1-fold, 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 12-fold, 15-fold, 20-fold or more, also relative to a reference or control.

[0082] "Genetic modification" refers to the direct manipulation of the genes and / or gene control regions of an organism using genetic engineering. Gene modification can occur at the gene level, transcriptional level, or translational level. It includes engineered changes in nucleic acid sequences, such as disruption of promoters that drive gene expression or mutations in other control regions. It also encompasses disruption of gene expression through gene deletion by DNA editing carried by CRISPR, TALEN, or zinc finger nucleases. It also includes disruption of gene expression by RNAi using siRNA and miRNA.

[0083] Generally, the "CRISPR system" collectively refers to transcripts and other elements involved in the expression of CRISPR-associated ("Cas") genes or that direct the activity of CRISPR-associated ("Cas") genes, including sequences encoding Cas genes, the "tracr" (trans-activating CRISPR) sequence (e.g., tracrRNA or the active portion of tracrRNA), tracr-pairing sequences (including "direct repeats" and portions of direct repeats involved in tracrRNA processing in the context of an endogenous CRISPR system), guide sequences, or other sequences and transcripts from the CRISPR locus.

[0084] In some embodiments (equivalently, and simply referred to as "in embodiments"), one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are from a particular organism that contains an endogenous CRISPR system, such as Streptococcus pyogenes. Generally, the CRISPR system is characterized by elements that facilitate the formation of a CRISPR complex at the site of a target sequence (also referred to as a "protospacer" in the context of an endogenous CRISPR system).

[0085] In the context of forming a CRISPR complex, a "target sequence" refers to the sequence to which the guide sequence is designed to have complementarity, where hybridization between the target sequence and the guide sequence promotes the formation of the CRISPR complex. Full complementarity is not required, provided that there is sufficient complementarity to cause hybridization and promote the formation of the CRISPR complex. The target sequence can comprise any polynucleotide, such as a DNA or RNA polynucleotide. In some embodiments, the target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence can be within an organelle of a eukaryotic cell, e.g., a mitochondrion or a chloroplast. A sequence or template that can be used for recombination into a targeted locus containing the target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence". In aspects of the invention, an exogenous template polynucleotide can be referred to as an editing template. In one aspect of the invention, the recombination is homologous recombination.

[0086] Generally, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more than 50 base pairs of the target sequence). Without wishing to be bound by theory, the tracr sequence, which can comprise all or a portion of or consist of a wild-type tracr sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), can also form part of a CRISPR complex, e.g., by hybridizing along at least a portion of the tracr sequence to all or a portion of a tracr-mate sequence operably linked to the guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to the tracr-mate sequence to hybridize and participate in formation of the CRISPR complex. As with the target sequence, perfect complementarity is not thought to be required, so long as there is sufficient functionality.

[0087] In some embodiments, when optimally aligned, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence complementarity along the length of the tracr-mate sequence. In some embodiments, one or more vectors that drive expression of one or more elements of the CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system directs formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence can each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements can be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. The CRISPR system elements combined in a single vector can be arranged in any suitable orientation, e.g., one element “upstream” (5′) or “downstream” (3′) relative to a second element. The coding sequence of one element can be on the same or opposite strand and in the same or opposite orientation as the coding sequence of the second element.

[0088] A “complementary sequence” refers to the sequence of the bottom (antisense) strand in the same direction as the top strand. An “inverse complementary sequence” refers to the sequence of the top strand in the direction from its 3′-end to its 5′-end. (Since DNA is antiparallel, an inverse complementary sequence can be used to keep the 5′ and 3′ ends properly oriented, as known to those of skill in the art.)

[0089] In some embodiments, a single promoter drives the expression of a transcript that encodes a CRISPR enzyme and a guide sequence, a tracr-pairing sequence (optionally operably linked to the guide sequence), and one or more of the tracr sequences embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, guide sequence, tracr-pairing sequence, and tracr sequences are operably linked to the same promoter and expressed from the same promoter.

[0090] The term "fungus" refers to various eukaryotic single-celled or multinucleate organisms that live by decomposing and absorbing organic matter in which they grow, including mushrooms, molds, mildews, smuts, rusts, and yeasts, and are classified in the kingdom Fungi, or in some classification systems, in the fungal family (Thallophyta) of the plant kingdom. Some fungi contain fruiting bodies and long, branched filamentous structures called hyphae. Hyphae are the main mode of vegetative growth and are collectively called mycelium. In some aspects of the present invention, fungi containing fruiting bodies and mycelium are genetically modified such that they no longer produce hallucinogenic compounds such as psilocybin. In some embodiments, such genetically modified fungi and their compositions or other products, such as their extracts, are free of hallucinogenic compounds. In some embodiments, such compositions, extracts, and other products are used as nutritional products, therapeutic agents, and for other purposes, as disclosed herein and understood by those skilled in the art.

[0091] A "nutritional product" can refer to a preparation that can be sold as a dietary supplement (sometimes referred to as a nutritional supplement), e.g., in accordance with the appropriate regulations of the Federal Food, Drug, and Cosmetic Act (FDCA) (22 U.S.C. §§ 301 et seq.) and the Dietary Supplement Health and Education Act (DSHEA) of 1994 in the United States. A dietary supplement is a product taken orally that contains dietary ingredients intended to supplement the diet. A dietary supplement can also be an extract or concentrate and can exist in many forms, such as tablets, capsules, softgels, liquid, or powder. Although a "nutritional product" can be sold as a dietary supplement, the product does not actually need to meet any specific regulatory standards (e.g., according to DSHEA or other FDA regulations), or be considered a nutritional product for the purposes defined herein according to any specific regulatory standards. Thus, it will be understood that products sold as "natural products" or products outside of any specific regulatory regime are also within the definition of nutritional products.

[0092] The term "fruiting body" refers to the generally fleshy fruiting body of a fungus (such as a basidiomycete), especially an edible one, which typically includes a cap (or "pileus") and a stem (or "stipe"), and which can occur on the ground (when growing naturally, e.g., in nature).

[0093] The term "mycelium" refers to a mass of the vegetative, thread-like, and usually branched network of hyphae, which is the main growth form of most fungi and which is typically within soil or organic matter or the tissue of a host, or otherwise underground (when growing naturally).

[0094] The term "protoplast" refers to an isolated cell from which the cell wall has been removed. The cell wall can be detached, weakened, intersticed, or otherwise removed from a plant, bacterial, or fungal cell by mechanical, chemical, or enzymatic means.

[0095] The term "spore" refers to a single-celled, haploid unit of sexual or asexual reproduction produced (and when growing naturally, dispersed) by a fungus.

[0096] The term "transformed into" refers to the transfer of an exogenous nucleic acid sequence into the interior of a fungal protoplast or mycelium by electrical, mechanical, or chemical means other than natural genetic transfer. Typically, transformation results in an alteration in the genetic coding or regulatory capacity relative to an untreated fungal protoplast or mycelium.

[0097] A "mushroom" refers to a mass of fungal cells that are mainly differentiated into structures present at any stage of mushroom development, whether typically found above ground, underground, or contained within a bioreactor production system. Such structures include, but are not limited to, fruiting bodies, sclerotia, protoplasts, spores, and mycelia.

[0098] A "magic mushroom" refers to a mushroom (such as from Psilocybe) that contains hallucinogenic (or "psychedelic") bioactive alkaloids (such as psilocybin).

[0099] A "mushroom extract" refers to a concentrated and / or condensed form of a mushroom in which bioactive compounds of interest found in the mushroom are concentrated and / or condensed by treatment with an extractant such as distilled water, 50 - 80% (v / v) ethanol, and a solvent such as ether. In some embodiments, preparing a mushroom extract includes milling, chopping, mixing, grinding, sonicating, and / or otherwise processing the mushroom such that the mushroom loses its naturally occurring physical form. In some embodiments, preparing a mushroom extract includes treatment with enzymes, including fungal enzymes.

[0100] The "psilocybin biosynthetic pathway" generally refers to a pathway that includes four genes and the four enzymes they each encode, called PsiD, PsiM, PsiH, and PsiK. Along this pathway, psilocybin is synthesized enzymatically from L-tryptophan, as Figure 9As shown. The psilocybin biosynthetic pathway is further described in the title section below.

[0101] "PsiD" can refer to L-tryptophan decarboxylase ("PsiD enzyme") and the gene encoding it ("PsiD gene"), as indicated by the context. The PsiD enzyme is a fungal L-tryptophan decarboxylase that participates in the first step of psilocybin biosynthesis. The PsiD enzyme catalyzes the decarboxylation of L-tryptophan to tryptamine.

[0102] "PsiM" can refer to a methyltransferase that catalyzes iterative N-methylation ("PsiM enzyme") and the gene encoding it ("PsiM gene"), as indicated by the context. Although the style conventions for genes and their proteins are different (e.g., capitalization and italicization conventions), for the purposes of convenience in this article, the gene and the enzyme can both be referred to similarly (e.g., "PsiM" gene, "PsiM" enzyme), and clarity is achieved through the context. The PsiM enzyme is a methyltransferase that catalyzes the iterative N-methylation of the amino group of norbaeocystin to produce psilocybin through the monomethylated intermediate baeocystin.

[0103] "PsiH" can refer to tryptamine 4-monooxygenase ("PsiH enzyme") and the gene encoding it ("PsiH gene"), as indicated by the context. The PsiH enzyme is a P450 monooxygenase that converts tryptamine to 4-hydroxytryptamine.

[0104] "PsiK" can refer to a phosphotransferase ("PsiK enzyme") and the gene encoding it ("PsiK gene"), as indicated by the context. The PsiK enzyme is a kinase that catalyzes the 4-O-phosphorylation step by converting 4-hydroxytryptamine to norbaeocystin.

[0105] "fsy1" refers to the P. cubensis gene (as a shorthand, by convention, P. cubensis) or an orthologous fungal gene encoding cytosine deaminase EC 3.5.4.1.

[0106] "pyrG" refers to the P. cubensis gene or an orthologous fungal gene encoding orotate 5'-phosphate decarboxylase EC 4.1.1.23.

[0107] "5-FC" refers to 5-fluorouracil (5-fluoro-1H-pyrimidine-2,4-dione, CAS#51-21-8).

[0108] "5-FOA" refers to 5-fluoroootic acid (5-fluoro-2,4-dioxo-1H-pyrimidine-6-carboxylic acid, CAS#703-95-7).

[0109] The following disclosure provides further definitions that may assist the reader in understanding the disclosed embodiments; however, it should be understood that all definitions herein are not intended to limit the scope of the invention, which should be construed and understood appropriately by reference to the complete specification (and any explicit meanings known to those skilled in the relevant art) and considering the language used in the claims. The terms used herein are for the purpose of describing particular embodiments only and are not intended to be limiting.

[0110] Bioactive alkaloids from fungi

[0111] In some aspects, genetically modified fungi are disclosed that do not produce one or more bioactive alkaloids, such as bioactive tryptamines, such as hallucinogenic tryptamines, such as psilocybin. In some other aspects, genetically modified fungi are disclosed that do not produce hallucinogenic tryptamines, such as psilocybin, but produce one or more other bioactive alkaloids, such as bioactive tryptamines, such as "minor" tryptamines or "complex" tryptamines.

[0112] In some embodiments, the disclosed genetically modified fungi produce a reduced amount of bioactive alkaloids, such as hallucinogenic tryptamines, such as psilocybin. In some embodiments, the genetically modified fungi produce a significantly reduced amount of hallucinogenic tryptamines, such as psilocybin. In some embodiments, the genetically modified fungi produce a negligible amount of hallucinogenic tryptamines, such as psilocybin, including amounts below the measurement or detection threshold. In some embodiments, compared to a comparable wild-type fungus, such as a wild-type fungus disclosed herein or understood to be comparable in the art, a substantially reduced amount of a bioactive alkaloid (such as a hallucinogenic tryptamine, such as psilocybin) includes an amount representing a reduction of greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, greater than 99.9%, greater than 99.95%, and greater than 99.99%, including up to 100%.

[0113] In some embodiments, the disclosed genetically modified fungi produce an increased amount of one or more bioactive alkaloids, such as bioactive tryptamines. In some embodiments, the genetically modified fungi produce an increased amount of "minor" tryptamines (such as aeruginascin, baeocystin, norbaeocystin, norpsilocin, etc.). In some embodiments, the genetically modified fungi produce an increased amount of one or more tryptamines naturally produced by the psilocybin biosynthetic pathway, such as any one or more of tryptamine, 4-hydroxytryptamine, norbaeocystin, or baeocystin (see also, for example Figure 9), or N-methyltryptamine (NMT) or N,N-dimethyltryptamine (DMT). In some embodiments, the genetically modified fungus produces an increased amount of "complex" tryptamines, such as β-carbolines (e.g., perlolyrine, harmaline, harmane, harmine, harmol, etc.). In some embodiments, compared to a comparable wild-type fungus, such as a wild-type fungus disclosed herein or understood to be comparable in the art, the increased amount of the bioactive alkaloid is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% and numbers therebetween, and greater multiples, such as at least 3X, 4X, 5X, and greater than 5X.

[0114] Exemplary non-limiting examples of bioactive alkaloids from fungi include:

[0115] - "Tryptamine" refers to 2-(1H-indol-3-yl)ethanamine (CAS#61-54-1).

[0116] - "Serotonin" refers to 3-(2-aminoethyl)-1H-indol-5-ol (CAS#50-67-9).

[0117] - "4-Hydroxytryptamine" refers to 3-(2-aminoethyl)-1H-indol-4-ol (CAS#570-14-9).

[0118] - "N-Acetyl-hydroxytryptamine" refers to N-hydroxy-N-[2-(1H-indol-3-yl)ethyl]acetamide.

[0119] - 4-Hydroxy-L-tryptophan refers to (2S)-2-amino-3-(4-hydroxy-1H-indol-3-yl)propanoic acid.

[0120] - 5-Hydroxy-L-tryptophan refers to (2S)-2-amino-3-(5-hydroxy-1H-indol-3-yl)propanoic acid.

[0121] - 7-Hydroxy-L-tryptophan refers to (2S)-2-amino-3-(7-hydroxy-1H-indol-3-yl)propanoic acid.

[0122] - "Aeruginascin" refers to N,N,N-trimethyl-4-phosphoryloxytryptamine (CAS#114264-95-8).

[0123] - "4-Hydroxy-N,N,N-trimethyltryptamine" refers to 2-(4-hydroxy-1H-indol-3-yl)ethyl-trimethylammonium, a metabolite of aeruginascin, (CHEBI:193061).

[0124] - “Baeocystin” refers to dihydrogen [3-[2-(methylamino)ethyl]-1H-indol-4-yl] phosphate (CAS# 21420-58-6).

[0125] - “Cordysinin C” refers to (1R)-1-(9H-β-carbolin-1-yl)ethanol (CAS# 1330197-18-6).

[0126] - “Cordysinin D” refers to (1S)-1-(9H-β-carbolin-1-yl)ethanol (CAS# 110282-66-1).

[0127] - “Harmaline” refers to 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole (CAS# 304-21-2).

[0128] - “Harmane” refers to 1-methyl-9H-pyrido[3,4-b]indole (CAS# 486-84-0).

[0129] - “Harmine” refers to 7-methoxy-1-methyl-9H-pyrido[3,4-b]indole (CAS# 442-51-3).

[0130] - “Perlolyrine” refers to [5-(9H-pyrido[3,4-b]indol-1-yl)furan-2-yl]methanol, (CAS# 29700-20-7).

[0131] - “Harmol” refers to 1-methyl-9H-pyrido[3,4-b]indol-7-ol (CAS# 487-03-6).

[0132] - “Norbaeocystin” refers to [3-(2-aminoethyl)-1H-indol-4-yl] dihydrogen phosphate (CAS# 21420-59-7).

[0133] - “Norharmane” refers to 9H-pyrido[3,4-B]indole (CAS# 244-63-3).

[0134] - “Norpsilocin” refers to 3-[2-(methylamino)ethyl]-1H-indol-4-ol (CAS# 28363-70-4).

[0135] - “Psilocybin” refers to 4-phosphoryloxy-N,N-dimethyltryptamine (CAS# 520-52-5).

[0136] - “Psilocin” means 4-hydroxy-N,N-dimethyltryptamine (CAS#520-53-6).

[0137] - “NMT” means N-methyltryptamine (CAS#61-49-4).

[0138] - “DMT” means N,N-dimethyltryptamine (CAS#61-50-7).

[0139] - “β-carboline” may refer to 9H-pyrido[3,4-b]indole (CAS#244-63-3) or a class of compounds collectively referred to as “β-carbolines”, depending on the context.

[0140] Other examples of bioactive alkaloids from fungi will be readily known or identifiable to those skilled in the art. See, for example, Zorrilla JG, Evidente A. Structures and Biological Activities of Alkaloids in Mushrooms, a Fungal Subgroup. Biomolecules. 2022;12(8):1025; Wieczorek, Piotr et al. Bioactive alkaloids of hallucinogenic mushrooms. St. NatProds Chem. 2015;46:133-168.

[0141] Psilocybin-producing fungi and other fungi producing bioactive alkaloids

[0142] In some aspects, genetically modified fungi that do not produce psilocybin and / or another bioactive alkaloid are disclosed. In some embodiments, such genetically modified fungi are prepared by selecting fungi that produce bioactive alkaloids, such as psilocybin-producing fungi, and performing the steps of the disclosed methods to obtain genetically modified fungi. In an embodiment, non-hallucinogenic psychedelic fungi are prepared by the disclosed methods.

[0143] In some embodiments, the fungus that produces bioactive alkaloids is a psilocybin-producing fungus. Psilocybin-producing fungi are known in the art and, by way of non-limiting example, include many species from the genera Athelia, Conocybe, Copelandia, Fibularhizoctonia, Galerina, Gymnopilus, Inocybe, Mycena, Panaeolus, Pholiotina, Pluteus, and Psilocybe. Those skilled in the art will readily know or readily identify different species of psilocybin-producing fungi.

[0144] As used herein, the terms "psilocybin-producing" fungus and "hallucinogenic" fungus are used interchangeably and can be used to refer to fungi in which the native wild-type fungus produces psilocybin (and thus produces a "hallucinogenic" or "psychedelic" effect upon ingestion), as well as the genetically modified fungi of the present disclosure (e.g., gene knockout fungi that no longer produce psilocybin or the hallucinogenic effect prepared according to the disclosed methods).

[0145] In some embodiments, the psilocybin-producing fungus is a Psilocybe spp. fungus.

[0146] In some embodiments, the Psilocybe spp. fungus is any one of the following fungi: P. acutipilea, P. allenii, P. alutacea, P. angulospora, P. antioquiensis, P. araucariicola, P. atlantis, P. aquamarina, P. armandii (Mexicana), P. aucklandiae, P. aztecorum, P. azurescens, P. baeocystis, P. banderillensis, P. bispora, P. brasilensis, P. brunneocystidiata, P. caeruleoannulata, P. caerulescens, P. caerulipes, P. callosa, P. carbonaria, P. caribaea, P. chuxiongensis, P. collybioides, P. colombiana, P. congolensis, P. cordispora, P. cubensis, P. cyanescens, P. cyanofibrillosa, P. dumontii, P. egonii, P. eximia, P. fagicola, P. farinacea, P. fimetaria, P. fuliginosa, P. furtadoana, P. galindoi, P. gallaeciae, P. graveolens, P. guatapensis, P. heimii, P. herrerae, P. hispanica, P. hoogshagenii, P. inconspicua, P. indica, P. isabelae, P. jacobsii, P. jaliscana, P. kumaenorum, P. laurae, P. lazoii, P. liniformans, P. mexicana, P. mairei, P. makarorae, P. mammillata, P. medullosa, P. meridensis, P. meridionalis, P. mescaleroensis, P. moseri, P. muliercula, P. naematoliformis, P. natalensis, P. natarajanii, P. neorhombispora, P. neoxalapensis, P. ovoideocystidiata, P. papuana, P.paulensis, P. pelliculosa, P. pintonii, P. pleurocystidiosa, P. plutonia, P. portoricensis, P. pseudoaztecorum, P. puberula, P. quebecensis, P. rickii, P. rostrate, P. rzedowskii, P. samuiensis, P. schultesii, P. semilanceata, P. septentrionalis, P. serbica, P. sierrae, P. sylvatica, P. singer, P. strictipes, P. stuntzii, P. subacutipilea, P. subaeruginascens, P. subaeruginosa, P. subcaerulipes, P. subcubensis, P. subpsilocybioides, P. subtropicalis, P. tampanensis, P. thaicordispora, P. thaiaerugineomaculans, P. thaiduplicatocystidiata, P. uruguayensis, P. uxpanapensis, P. venenata, P. villarrealiae, P. weilii, P. weldenii, P. weraroa, P. wrightii, P. yungensis, P. zapotecoantillarum, P. zapotecocaribaea, or P. zapotecorum, including strains thereof. Further descriptions of each of the above Psilocybe species are provided in U.S. Provisional Application No. 63 / 371,121, the priority application of this application, which was filed on August 11, 2022 and is incorporated herein by reference for all purposes as if fully set forth herein.

[0147] Other Psilocybe fungi that produce psilocybin will be known to those of skill in the art.

[0148] In some embodiments, the Psilocybe spp. fungi are P. carpophores fungi or strains. In some embodiments, the Psilocybe spp. fungi are members of the P. cyanescens species complex.

[0149] In some embodiments, the Psilocybe spp. fungi are Psilocybe cubensis fungi or strains.

[0150] In some embodiments, the P. cubensis strain is any one of GoldenTeacher, B+, Mazapatec, Z strain, Treasure Coast, or Koh Samui super strain. In some embodiments, the P. cubensis strain is any one of the following: A+ (A- strain), AA+ (Albino A+), Acadian Coast, Alice, Alamo, Alacabenzi, Albino Chodewave (ACW), Albino Monkey Dick / Dong (AMD), Ajax, ALAC (Alacabenzi Supreme), Albino MVP, American Mystic, AMAK (Albino Melmac), AMPE, AMVP (Albino MostValued Producer), APE (Albino Penis Envy), APE-R, ARC (Albino Rollercoaster), Argentina, Australian, Avery’s Albino, Aztec God, B+, Ban Hua Thanon (BHT), BanNathon Dhupatamyia (BND), Ban Phang Ka (BPK), Ban Thurain (BT), BeePee, Blue Avians, Blue Jay, Blue Magnolia Classic (BMC), Blue Magnolia Rust (BMR), Blue Meanie (cubensis), Blue Moon, Brazilian, Burma, Burmese Smurf, Cambodian, Chitwan, Chocolate Krinkle, Chodewave (OG CW), Clockwork Orange, Colombian Rust Spore (CRS), Colorado, Coneheads TAT, Corumba, Creeper (Keeper’s Creeper), Crooked Mystery, Daddy Long Legs, Dancing Dragons, Destiny, Divinity, Eclipse, Ecuador, El Choco, Elephant Dung, End Game, Enigma, E-Froot, EntheogenExplosion、Escondido、Eyelike、F+、Falbino、FillJilly、Fiji、Gandalf、Ghost、Golden E4K、Golden Hawk、GoldenHalo、GoldenMammoth、Golden Teacher(GT)、Great White Monster(GWM)、Ground Zero、Guadalajara、Gumby、Hanoi、Hillbilly / Menace、Huautla、Hung、Iceberg(ATLY)、IllusionWeaver、Jack Frost、Jedi Mind Fuck(JMF)、JohnAllen(Allen菌株)、Juke'sPeak、KAPE、KSAT、Koh Samui Classic(KSC)、Koh Samui超级菌株(KSSS)、LAPE(LongAPE)、L.A.S.S.(LangAlbino Super Squats)、Leng、Leucistic JMF(Jedi Mind Fuck)、Leucistic Treasure Coast(LTC)、Lex Luther(Cream Lex Luther)、Lightwave、LipaYai、Lizard King(LK)、Loaves、Mak 120、Mak / AA、Makilla Gorilla、Malabar、Malaysian、Mars、Mazapatec、Maza-Bensi、McKennai、Mexicana Cubensis、Melmac Revert、Melmac 118、Melmac、Melmac TP(Thick Penis)、Menace、MexicanAlbino、Mexican Dutch King、Mexicube、Moby Dick、Mr.Krinkle、MVP(MostValuedProducer)、Namaste、Nezuko、NewZealand Chaw、Normak(Normac)、Nutcracker、Omni、Orissa India、Palenque、PEA+(YETI)、Peakock / Peacock、PE6、Pearly Gates、PES Amazonian(PESA)、PES Hawaiian(PESH)、PenisEnvy(PE)、PE+、Penis EnvyHawk (P.E. Hawk), Penis Envy Uncut (PEU), PF Albino, PF Classic, PF Redspore, Phobos, Pink Buffalo (PB), Plantasia Mystery, Puerto Rico (PR), Purple Mystic (PM), Quinn's Cut, R44, Redboy, Riddler, Riptide, Roatan Honduras, Roger Rabbit (RR), Rollercoaster, Rudolph, Rusty Whyte (RW), Saint Nick, Scylla, Shaman's Gift, Shakti, Shooting Star, South African Transkei (SAT), South American, Sporeworks PE (SWPE), Stargazer, Starry Night, Sunny Side Up (SSU), SV-10, SyZyGy, Taman Negara, Tasmania, TAT Smurf, Tidalwave (TW), Tooth Decay, Tosohatchee, Trinity, Tsunami, True Albino Teacher (TAT), TAT Black Cap (TBC), TePe, Texas Gulf Coast (TGC), Thai Elephant Dung, Thai LipaYi, Treasure Coast, Vader, White Teacher, Wollongong, Wombat TAT, Xilo, XXX, Yeti, Ymir, Zillacybin (Zilla), or the Z strain. Other Psilocybe cubensis strains, as well as other psilocybin-producing strains of species in other genera that produce psilocybin, will be readily known or identifiable to those skilled in the art.

[0151] In some embodiments, the fungus that produces bioactive alkaloids is a fungus that does not produce psilocybin but contains the PsiD, PsiH, PsiK, or PsiD gene. In some embodiments, the fungus that produces bioactive alkaloids contains a sequence that is homologous but not identical to the PsiD, PsiH, PsiK, or PsiD gene in a psilocybin-producing fungus. In some embodiments, the fungus that produces bioactive alkaloids contains a sequence that is homologous but not identical to the PsiD, PsiH, PsiK, or PsiD gene obtained by horizontal gene transfer.

[0152] In some embodiments, the fungi that produce bioactive alkaloids have genes with homologous, non-identical sequences that do not form clusters but encode enzymes that may be active in producing metabolites similar to those produced by psilocybin-producing fungi. In some embodiments, fungi that produce bioactive alkaloids and have homologous, non-identical sequences to the PsiD, PsiH, PsiK, or PsiD genes are manipulated to reduce the production and levels of tryptamine. In some embodiments, fungi that produce bioactive alkaloids and have homologous, non-identical sequences to the PsiD, PsiH, PsiK, or PsiD genes belong to the genera Pleurotus, Lentinula, or Trametes.

[0153] For the disclosed and other known psilocybin-producing fungi, and for other fungi that can be genetically modified according to the methods of the present disclosure, such as the various genera, species, and strains listed above, those skilled in the art will understand that genomic data, including genomes, transcripts, protein sequences, annotations, and data reports, can be obtained as National Center for Biotechnology Information (NCBI) datasets of the National Library of Medicine (ncbi.nlm.nih.gov / datasets, e.g., for P. cubensis, ncbi.nlm.nih.gov / datasets / taxonomy / 181762 / , NCBI Taxonomy ID 181762), including NCBI RefSeq components and GenBank components, and obtained on the NCBI Genome Data Viewer (GDV), as well as other databases known to those skilled in the art.

[0154] Available datasets for exemplary species include, for example, P. azurescens (genomic scaffold GCA_019721835.1); P. cubensis (chromosome-level genomic assembly GCA_017499595.2); P. cyanescens (genomic scaffold GCA_002938375.1); P. galindoi (genomic scaffold GCA_019721455.1); and P. tampanensis (genomic scaffolds for three isolates GCA_019904355.1, GCA_019908715.1, GCA_019908695.1). Non- hallucinogenic psychedelic fungi and other genetically modified fungi

[0155] In some aspects, methods are provided for genetically modifying fungi that produce bioactive alkaloids such that the fungi no longer produce bioactive alkaloids, or produce bioactive alkaloids below a desired threshold, such as producing a reduced amount of bioactive alkaloids, or producing a substantially reduced amount of bioactive alkaloids.

[0156] In some embodiments, the bioactive alkaloid is psilocybin, norpsilocin, psilocin, tryptamine, 4-hydroxytryptamine, N,N-dimethyltryptamine, baeocystin, norbaeocystin, serotonin, N-acetyl-hydroxytryptamine, 4-hydroxy-L-tryptophan, 5-hydroxy-L-tryptophan, 7-hydroxy-L-tryptophan, aeruginascin, 4-hydroxy-N,N,N-trimethyltryptamine, harmane, norharmane, harmine, harmol, harmaline, cordycinin C, cordycinin D, perlolyrine, β-carboline or a derivative or analogue thereof (Zorrilla JG, Evidente A. Structures and Biological Activities of Alkaloids Produced by Mushrooms, a Fungal Subgroup. Biomolecules. 2022;12(8):1025 and Blei F. et al. Simultaneous Production of Psilocybin and a Cocktail of β-Carboline Monoamine Oxidase Inhibitors in ‘Magic’ Mushrooms. Chemistry. 2020;26(3):729-34; Wieczorek, Piotr etal. Bioactive alkaloids of hallucinogenic mushrooms. Studies Nat Prods Chem. 2015;46:133-168).

[0157] In some embodiments, the bioactive alkaloid is a hallucinogenic alkaloid. In some embodiments, the hallucinogenic alkaloid is a hallucinogenic tryptamine. In some embodiments, the hallucinogenic tryptamine is psilocybin.

[0158] In some embodiments, where the disclosed method includes genetically modifying a psilocybin-producing fungus such that the fungus no longer produces psilocybin (or produces a reduced or substantially reduced amount of psilocybin, e.g., below a desired threshold), one or more additional bioactive alkaloids may also be reduced, substantially reduced, or absent in the fungus. For example, small amounts of psilocin are typically present in psilocybin-producing fungi (Stamets P. Psilocybin Mushrooms of the World: An Identification Guide. Ten Speed Press; 1996. and F, T, J. Psilocybin: Summary of knowledge and new perspectives. Eur Neuropsychopharm. 2014;24(3):342 - 356.). However, psilocybin is thought to be a precursor of naturally occurring psilocin (Nichols DE. Psilocybin: From ancient magic to modern medicine. J Antibiot. 2020;73(10):679 - 686.). Thus, in some embodiments where the disclosed method includes interfering with the biosynthesis of psilocybin in the fungus, the method also directly or indirectly interferes with or disrupts the biosynthesis of psilocybin, and the resulting genetically modified fungus may have a reduced or substantially reduced amount of psilocin, or be completely lacking in psilocin (e.g., no psilocin is present at a detectable level using the analytical techniques described herein and otherwise known to those skilled in the art).

[0159] Likewise, in embodiments where the disclosed method includes interfering with the biosynthesis of psilocybin in the fungus by interfering with or disrupting the function of catalytic enzymes (e.g., PsiD, PsiM, PsiH, PsiK) involved in psilocybin biosynthesis, such a method may also interfere with or disrupt the biosynthesis of another bioactive alkaloid involved in the psilocybin biosynthesis pathway. For example, as Figure 9As shown, the figure depicts the in vivo biosynthesis preparation of psilocybin in P. cubensis starting from L-tryptophan. PsiM is responsible for the conversion of norbaeocystin to baeocystin and the subsequent conversion of baeocystin to psilocybin. Thus, in embodiments where psilocybin biosynthesis is disrupted by interfering with the function of PsiM (e.g., by knockout or reduction of PsiM expression, inactivation of the catalytic function of PsiM, or another disclosed method), the level of baeocystin in the resulting genetically modified fungus can also be reduced, substantially reduced, or absent. As another example and referring again to Figure 9 , PsiK is responsible for the conversion of serotonin to norbaeocystin. Thus, in some embodiments where psilocybin biosynthesis is disrupted by interfering with the function of PsiK (e.g., by knockout or reduction of PsiK expression, inactivation of the catalytic function of PsiK, or another disclosed method), the levels of norbaeocystin and baeocystin in the resulting genetically modified fungus can also be reduced, substantially reduced, or absent.

[0160] It should be understood that while in some embodiments the genetic modification is of the psychedelic fungus to eliminate or reduce the amount of hallucinogenic tryptamines such as psilocybin, the present disclosure can also be readily applied to eliminate or reduce the amount of one or more other compounds in the fungus, such as knocking out a single compound in order to compare the single knockout variants with each other to test for "environmental effects", or knocking out a single compound that is undesirable for any reason (illegality, sensitizing properties, individual sensitivity, achieving a synergistic level or ratio of compounds, etc.).

[0161] In some embodiments, a substantially reduced amount, compared to an unmodified fungus, the average of unmodified fungi, or another quantity known in the art, will be a reduction of 50%, 60%, 70%, 80%, 90%, or greater than 90%. In some preferred embodiments, the substantially reduced amount is a reduction of greater than 90%, such as 92.5%, 95%, 97.5%, or greater than 97.5%. In some further preferred embodiments, the substantially reduced amount is a reduction of greater than 97.5%, such as 98.0%, 98.5%, 99.0%, or greater than 99.0%, including 99.25%, 99.5%, 99.6%, 99.7%, 99.8%, 99.90%, 99.95%, and 99.99%, including greater than 99.99%, such as an amount below the limit of detection, as determined by area normalization of an HPLC curve or other similar detection methods. In some yet further preferred embodiments, no measurable amount is present in the genetically modified mushrooms of the present disclosure.

[0162] In some embodiments, the substantially reduced amount is the amount of psilocybin that is substantially reduced. In some such embodiments, the amount of psilocybin that is significantly reduced is reduced by 50%, 60%, 70%, 80%, 90% or greater than 90% compared to the average of an unmodified fungus (e.g., an unmodified mushroom from the same strain or species), a representative sample of an unmodified fungus (e.g., an unmodified mushroom from the same strain or species), or another amount known in the art (e.g., the average amount of psilocybin for that strain or species, as reported in the literature or otherwise known to one of ordinary skill in the art). In some preferred embodiments, the amount of psilocybin that is substantially reduced is reduced by greater than 90%, such as 92.5%, 95%, 97.5% or greater than 97.5%. In some further preferred embodiments, the amount of psilocybin that is substantially reduced is reduced by greater than 97.5%, such as 98.0%, 98.5%, 99.0% or greater than 99.0%, including 99.25%, 99.5%, 99.6%, 99.7%, 99.8%, 99.90%, 99.95% and 99.99%, including greater than 99.99%, such as an amount below the limit of detection, as determined by area normalization of an HPLC curve or other similar detection method. In some yet further preferred embodiments, there is no measurable psilocybin in the genetically modified mushrooms of the present disclosure.

[0163] The average amount of psilocybin present in mushrooms not modified according to the present disclosure will be known in the art or readily determinable by one of ordinary skill in the art. As an example, the following Psilocybe spp. have been reported to have the following amounts of psilocybin, as a percentage of dry weight (% w / w): P. azurescens (1.78); P. bohemica (1.34); P. semilanceata (0.98); P. baeocystis (0.85); P. cyanescens (0.85); P. tampanensis (0.68); P. cubensis (0.63); P. weilii (0.61); P. hoogshagenii (0.60); P. stuntzii (0.36); P. cyanofibrillosa (0.21); P. liniformans (0.16). (See, e.g., Stamets, Psilocybin Mushrooms of the World, 1996.) It will be readily understood that such amounts can vary depending on growth conditions, even within a single flush, and averaging the fungi within a comparable strain can provide greater accuracy; such measurements are readily understandable to one of ordinary skill in the art. As a general rule of thumb, the amount of psilocybin in Psilocybe spp., or other mushrooms not genetically modified to reduce psilocybin biosynthesis, will be understood to be in the range of from 0.5 to 1.5% (including the end values), about 1% w / w, or to be at about 1% w / w of the dry weight of the mushroom.

[0164] In some embodiments, if the genetically modified mushrooms of the present disclosure contain less than 0.1% psilocybin as determined by dry weight, preferably less than 0.05% psilocybin as determined by dry weight, and more preferably less than 0.01% psilocybin as determined by dry weight, then psilocybin biosynthesis will be understood to be disrupted or blocked. In some embodiments, the genetically modified mushrooms of the present disclosure will contain less than 0.10%, less than 0.09%, less than 0.08%, less than 0.07%, less than 0.06%, less than 0.05%, less than 0.04%, less than 0.03%, less than 0.02%, less than 0.01%, less than 0.005%, or less than 0.001% psilocybin as determined by dry weight. In some preferred embodiments, the genetically modified mushrooms of the present disclosure will contain no measurable psilocybin.

[0165] Psilocybin biosynthesis pathway

[0166] Methods for disrupting or preventing the biosynthesis of bioactive alkaloids in fungi that produce or are capable of producing bioactive alkaloids are disclosed. In some embodiments, the disclosed methods disrupt or prevent the biosynthesis of psilocybin in fungi that produce psilocybin.

[0167] In some embodiments, disrupting or preventing the biosynthesis of psilocybin in fungi that produce psilocybin comprises disrupting or preventing the function of one or more enzymes of the psilocybin biosynthetic pathway or genes encoding them.

[0168] The psilocybin biosynthetic pathway from L-tryptophan involves the action of four different enzymes: PsiD (IUBMB enzyme nomenclature; Enzyme Commission number; EC 4.1.1.105); PsiK (EC 2.7.1.222); PsiH (EC 1.14.99.59); and PsiM (EC 2.1.1.345). (See, for example, Blei F, Baldeweg F, Fricke J, Hoffmeister D. Biocatalytic Production of Psilocybin and Derivatives in Tryptophan Synthase-Enhanced Reactions. Chemistry. 2018;24(40):10028-10031; Fricke J, Blei F, Hoffmeister D. Enzymatic Synthesis of Psilocybin. Angew Chem Int Ed Engl. 2017;56(40):12352-55, both of which are incorporated herein by reference as if fully set forth herein. The synthetic steps adapted from Fricke et al. 2017 are Figure 9 schematically shown in

[0169] In some embodiments, PsiD has at least 60%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% amino acid sequence identity to the protein sequence deposited under GenBank accession number ASU62239.1 (Psilocybe cubensis) or GenBank accession number ASU62242.1 (Psilocybe cyanescens), or to the amino acid sequence (SEQ ID NO: 1) encoded by the polynucleotide SEQ ID NO: 2.

[0170] In some embodiments, PsiK has at least 60%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% amino acid sequence identity with the protein sequence deposited under GenBank accession number ASU62237.1 (Psilocybe cubensis) or GenBank accession number ASU62240.1 (Psilocybe cyanescens), or with the amino acid sequence (SEQ ID NO:3) encoded by the polynucleotide SEQ ID NO:4.

[0171] In some embodiments, PsiH has at least 60%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% amino acid sequence identity with the protein sequence deposited under GenBank accession number ASU62246.1 (Psilocybe cubensis) or GenBank accession number ASU62250.1 (Psilocybe cyanescens), or with the amino acid sequence (SEQ ID NO:5) encoded by the polynucleotide SEQ ID NO:6.

[0172] In some embodiments, PsiM has at least 60%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% amino acid sequence identity with the protein sequence deposited under GenBank accession number ASU62238.1 (Psilocybe cubensis) or GenBank accession number ASU62241.1 (Psilocybe cyanescens), or with the amino acid sequence (SEQ ID NO:7) encoded by the polynucleotide SEQ ID NO:8.

[0173] PsiD, PsiK, PsiH, and PsiM nucleotide and amino acid sequences

[0174] Methods for disrupting or preventing the biosynthesis of psilocybin in psilocybin-producing fungi are disclosed in some aspects. In some embodiments, disrupting or preventing such psilocybin biosynthesis comprises disrupting or preventing the function of one or more enzymes of the psilocybin biosynthesis pathway and / or the genes encoding them.

[0175] In some embodiments, disrupting or preventing the biosynthesis of psilocybin in psilocybin-producing fungi comprises disrupting or preventing the function of one or more of the PsiD, PsiK, PsiH, and PsiM enzymes and / or the PsiD, PsiK, PsiH, and PsiM genes.

[0176] Those skilled in the art will know the nucleotide sequences of the known PsiD, PsiK, PsiH, and PsiM genes, as well as the encoded amino acid sequences of the PsiD, PsiK, PsiH, and PsiM enzymes. The following provides exemplary nucleotide sequences of the PsiD, PsiK, PsiH, and PsiM genes, as well as the encoded amino acid sequences of the PsiD, PsiK, PsiH, and PsiM enzymes, from an exemplary Psilocybe cubensis psilocybin-producing fungus, as SEQ ID NO: 1-8:

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184] Following are additional sequences SEQ ID NO: 9-12, representing the coding regions of the mRNAs expressed from the Psilocybe cubensis genes PsiD, PsiK, PsiH, and PsiM. In these sequences, the bold regions indicate the positions where exemplary siRNA silencing oligonucleotides bind, which are selected from the following SEQ ID NO: 32-71, and Bold underlined region indicate the positions where exemplary crRNA oligonucleotide sequences for CRISPR knockout bind, which are selected from the following SEQ ID NO: 13-31:

[0185]

[0186]

[0187]

[0188]

[0189] The following sequences (SEQ ID NO: 13 - 31) are examples of single - targeting crRNA sequences that can be used to generate deletions in the PsiD gene of P. cubensis (SEQ ID NO: 13 - 17 have the target - matching positions shown above in SEQ ID NO: 9), PsiK gene (SEQ ID NO: 18 - 21 match SEQ ID NO: 10), PsiM gene (SEQ ID NO: 23 - 26 match SEQ ID NO: 11), and PsiH gene (SEQ ID NO: 27 - 31 match SEQ ID NO: 12), respectively. This single crRNA is suitable for use with a high - fidelity Cas9 derivative in plasmid transfection or in ribonucleoprotein (RNP) complexes introduced as described in the examples herein. The targeting oligonucleotides are illustrated as 5′→3′ spacer DNA plus PAM (protospacer adjacent motif). Following are further SEQ ID NO: 13 - 31, representing CRISPR knockout oligonucleotides:

[0190]

[0191]

[0192] The following sequences SEQ ID NO: 32 - 71 represent alternative siRNA oligonucleotides that can be used to silence the corresponding Psi genes (e.g., SEQ ID NO: 32 - 36, 52 - 56 for silencing PsiD, SEQ ID NO: 37 - 41, 57 - 59, 61 for PsiK, SEQ ID NO: 43 - 46, 62 - 66 for PsiM, SEQ ID NO: 47 - 51, 67 - 71 for PsiH).

[0193] The positions of the siRNA sequence SEQ ID NO: 52 - 56 are shown in bold in SEQ ID NO: 9 as targeting PsiD. The positions of the siRNA sequences SEQ ID NO: 37 - 39, 41 are shown as targeting PsiK in SEQ ID NO: 10. The positions of the siRNA sequence SEQ ID NO: 42 - 46 are shown as targeting PsiM in SEQ ID NO: 11. The positions of the siRNA sequence SEQ ID NO: 47 - 51 are shown as targeting PsiH in SEQ ID NO: 12.

[0194] The sequences from SEQ ID NO: 32 - 71 have a 9 - bp spacer loop sequence (GCTGGTGGA). Optionally, additional sequences can be generated by using spacer lengths of 3, 4, 5, 6, 7, 9, and 23 bases. The sequences represented as SEQ ID NO: 32 - 71 also have AA or GG at the 5' end, which can provide stability. (See Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate; Martinez et al., EMBO J. 2001 Dec 3; 20(23):6877 - 88); Sui G et al., A DNA vector - based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci. 2002 Apr 16; 99(8):5515 - 20). The bases represented as (TTTT) or (UUUU) at the sequence ends are optional and can be longer (6 bases) or shorter (4 bases). (See Using siRNA for gene silencing is a rapidly evolving tool in molecular biology, siRNA Design Guidelines, Tech. Bulletin #506, Thermo Fisher Scientific.)

[0195] SEQ ID NO: 32 - 71 is as follows and represents gene siRNA oligonucleotides or their DNA templates:

[0196]

[0197]

[0198]

[0199]

[0200] The protein - coding nucleotide sequences SEQ ID NO: 72 - 75 of the Psi - cluster psilocybin - synthesizing genes from P. cyanescens were aligned with their orthologs SEQ ID NO: 2, 4, 6, 8 from Figures 1-4 P. cubensis to identify regions of extensive identity and potential target regions with conserved structure and function.

[0201] SEQ ID NOs: 72-75 respectively represent the consensus protein-coding nucleotide sequences of the mRNAs of PsiD, PsiK, PsiM, and PsiH of P. cyanescens.

[0202]

[0203]

[0204]

[0205] The conceptual translations of the coding sequences SEQ ID NOs: 76-79 of the Psi cluster psilocybin synthases from P. cyanescens were aligned with their orthologs from P. cubensis SEQ ID NOs: 1, 3, 5, and 7 in Figures 5-8 to identify regions of extensive identity and potential target regions with conserved structure and function.

[0206] The subsequent SEQ ID NOs: 76-79 respectively represent the conceptual translations of the coding sequences of the mRNAs of PsiD, PsiM, PsiK, and PsiH of P. cyanescens.

[0207]

[0208]

[0209] The nucleotide sequences SEQ ID NOs: 80-87 with extensive identity between the protein-coding sequences of the PsiK genes of P. cubensis and P. cyanescens are shown in Figure 2 and generally correspond to the extended regions of the same amino acid sequences in the conceptual translation Figure 6 Such regions can be used to generate loss-of-function missense substitutions, for example, by CRISPR-Cas gene editing with a gapped repair template oligonucleotide with a new sequence substitution. Thus, in some embodiments, these sequences are targets for engineering the loss and alteration of protein domains corresponding to structural folding and specific enzyme functions such as substrate binding, cofactor binding, allosteric modulator binding, substrate specificity, and catalytic kinetics, all of which can be measured after in vitro expression of the variant genes with the DNA sequence identification and editing.

[0210] The following SEQ ID NOs: 80-87 are examples of the nucleotide sequences with extensive identity between the protein-coding sequences of the PsiK genes of P. cubensis and P. cyanescens:

[0211]

[0212]

[0213] The nucleotide sequences SEQ ID NO:88 - 95 that are extensively identical between the protein - coding sequences of the PsiM genes of P. cubensis and P. cyanescens are shown in Figure 3 and generally correspond to extended regions of the same amino acid sequence in the conceptual translation Figure 7 Such regions can be used to generate loss - of - function missense substitutions, for example, by CRISPR - Cas gene editing with a nick - repair template oligonucleotide with a novel sequence substitution. Thus, in some embodiments, these sequences are targets for the engineered loss and alteration of protein domains corresponding to structural folding and specific enzyme functions such as substrate binding, cofactor binding, allosteric modulator binding, substrate specificity, and catalytic kinetics, all of which can be measured after in vitro expression of the variant genes with the DNA sequence identified and edited.

[0214] The following SEQ ID NO:88 - 95 are examples of the nucleotide sequences that are extensively identical between the protein - coding sequences of the PsiM genes of P. cubensis and P. cyanescens:

[0215]

[0216]

[0217] The nucleotide sequences SEQ ID NO:96 - 108 that are extensively identical between the protein - coding sequences of the PsiH genes of P. cubensis and P. cyanescens are shown in Figure 4 and generally correspond to extended regions of the same amino acid sequence in the conceptual translation Figure 8 Such regions can be used to generate loss - of - function missense substitutions, for example, by CRISPR - Cas gene editing with a nick - repair template oligonucleotide with a novel sequence substitution. Thus, in some embodiments, these sequences are targets for the engineered loss and alteration of protein domains corresponding to structural folding and specific enzyme functions such as substrate binding, cofactor binding, allosteric modulator binding, substrate specificity, and catalytic kinetics, all of which can be measured after in vitro expression of the variant genes with the DNA sequence identified and edited.

[0218] The following SEQ ID NO:96 - 108 are examples of the nucleotide sequences that are extensively identical between the protein - coding sequences of the PsiH genes of P. cubensis and P. cyanescens:

[0219]

[0220]

[0221] The nucleotide sequences SEQ ID NO:109 - 117 that are extensively identical between the protein - coding sequences of the PsiD genes of P. cubensis and P. cyanescens are shown in Figure 1 and generally correspond to extended regions of the same amino acid sequences in the conceptual translation Figure 5 Such regions can be used to generate loss - of - function missense substitutions, for example, by CRISPR - Cas gene editing with a gapped repair template oligonucleotide with a new sequence substitution. Thus, in some embodiments, these sequences are targets for engineering loss and alteration of protein domains corresponding to structural folds and specific enzyme functions such as substrate binding, cofactor binding, allosteric modulator binding, substrate specificity, and catalytic kinetics, all of which properties can be measured after in vitro expression of the variant genes with DNA sequence identification and editing.

[0222] The following SEQ ID NO:109 - 117 are examples of nucleotide sequences that are extensively identical between the protein - coding sequences of the PsiD genes of P. cubensis and P. cyanescens:

[0223]

[0224] Non - hallucinogenic psychedelic fungi and other genetically modified fungi

[0225] In some aspects, non - hallucinogenic psychedelic fungi and other genetically modified fungi are disclosed. In some embodiments, the genetically modified fungi are knockout fungi.

[0226] "Knockout" refers to an organism (e.g., a "knockout" fungus) produced by genetic techniques, in which one or more genes in the organism, or one or more enzymes or other proteins encoded by them, are made non - functional.

[0227] "Non - operative" means having been intentionally modified by genetic or molecular techniques as disclosed herein to have a disrupted (e.g., impaired or eliminated) catalytic activity, substrate binding, or another generally required functional property characteristic of an active, functional state (e.g., in a wild - type organism).

[0228] In some aspects of the present invention, knockout of one or more of the PsiD, PsiK, PsiH, and PsiM genes is disclosed, whereby any one of the PsiD, PsiK, PsiH, and PsiM genes and / or any one of the PsiD, PsiK, PsiH, and PsiM enzymes encoded thereby is rendered non-functional. In some embodiments, the PsiD, PsiK, PsiH, and / or PsiM gene knockout of the present invention provides a knockout fungus that is a non-hallucinogenic psychedelic fungus, as disclosed herein.

[0229] "Knockout" (KO) (or "gene knockout") also refers to an organism having at least one non-functional gene. For example, a "single knockout" (SKO) (or equivalently, "single gene knockout") refers to an organism having one non-functional gene. Those skilled in the art will understand that reference to "one" non-functional gene (and any other number, as below) refers to one non-functional target gene, and thus other (non-functional) genes may also be non-functional.

[0230] "Double knockout" (DKO) refers to an organism having two non-functional genes (i.e., two genes of interest), such as where two genes have been knocked out simultaneously.

[0231] "Triple knockout" (TKO) and "quadruple knockout" (QKO) refer to organisms having three or four non-functional genes (of interest), respectively.

[0232] "Heterozygous knockout" or "heterozygous KO" refers to an organism in which only one of the two gene copies (alleles) has been knocked out. "Homozygous knockout" or "homozygous KO" refers to an organism having both alleles knocked out.

[0233] "Mononuclear knockout" refers to monospores, protoplasts, or mycelia derived from a single nucleus or identical nuclei, all nuclei containing the same introduced deletion or null allele at the relevant locus or gene.

[0234] "Dikaryotic gene knockout" would be the hybridization of two fungal strains in which the mononuclear gene knockouts containing the same gene or locus are inactivated, such that the resulting dikaryotic mycelium, sclerotium, or mushroom does not contain nuclei having functional copies of the relevant locus or gene.

[0235] Gene knockout techniques and their general applications are well known to those skilled in the art. In the disclosed embodiments, gene knockout can be achieved by a variety of techniques, combining the teachings of the present invention with common general knowledge in the art. Non-limiting examples of gene knockout techniques include: (a) homologous recombination; (b) cleavage using zinc finger nucleases; (c) transcription activator-like effector nucleases (TALENs); and (d) clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9.

[0236] a. Gene knockout using homologous recombination

[0237] In some embodiments, the disclosed methods include knocking out a gene (e.g., PsiD, PsiM, PsiK, and / or PsiH) using homologous recombination. Homologous recombination generally involves generating a DNA construct containing the desired mutation. For knockout purposes, this typically involves replacing the desired knockout gene (e.g., PsiD, PsiM, PsiK, and / or PsiH) with a drug resistance marker.

[0238] In some embodiments, a sequence of 35 - 50 bp or 100 bp identical to the PsiD, PsiM, PsiK, or PsiH gene can be inserted into a construct containing, for example, a drug resistance marker or a marker gene encoding a selectable metabolic enzyme that is 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, or 6 kb in length.

[0239] In some embodiments, the drug resistance marker can be the nourseothricin resistance gene.

[0240] In some embodiments, the drug resistance marker can be the phleomycin resistance gene.

[0241] In some embodiments, the marker gene encoding a selectable metabolic enzyme can be the P. cubensis fsy1 gene. In other embodiments, the marker gene encoding a selectable metabolic enzyme can be the P. cubensis pyrG gene.

[0242] Alternative methods for introducing the Cas / sgRNA complex into the fungal nucleus can be achieved by transforming in vitro pre-assembled RNPs. The RNP-based CRISPR system is superior to the DNA-based CRISPR system because the RNP-based system avoids strain construction and can be used across different species / strains. A system using in vitro-assembled Cas9 RNPs coupled with a microhomology repair template was established, and compared with the classical gene replacement system, this system showed greater gene targeting efficiency on different genetic backgrounds of the fungus Aspergillus fumigatus. Single and tandem insertions of a 2890-bp HygR cassette flanked by 35-bp or 50-bp microhomology regions targeted and replaced the pksP locus (Afu2g17600) Al Abdallah Q., Ge W., Fortwendel J.R. A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates. mSphere. 2017;2:e00446-17. doi:10.1128 / mSphere.00446-17.)

[0243] In some embodiments, the construct comprises two flanking regions of at least 35 bp having the same sequence as the PsiD gene. In some embodiments, the construct comprises two flanking regions of at least 35 bp having the same sequence as the PsiM gene. In some embodiments, the construct comprises two flanking regions of at least 35 bp having the same sequence as the PsiK gene. In some embodiments, the construct comprises two flanking regions of at least 35 bp having the same sequence as the PsiH gene. The construct is delivered into the cells of the psilocybin-producing fungus by microinjection or electroporation.

[0244] Without being bound by theory, the cell's own repair mechanism then recombines the DNA of the construct that is homologous to the PsiD, PsiM, PsiK, or PsiH DNA in the fungal genome. This can result in the sequence of the PsiD, PsiM, PsiK, or PsiH gene being altered, where the mRNA transcribed from the construct sequence can be translated into a non-functional protein, thereby causing inactivation of the desired PsiD, PsiM, PsiK, or PsiH gene.

[0245] Protocols for inactivating genes by homologous recombination can be found, for example, in Bradford et al., Overview: Generation of Gene Knockout Mice. Current Protocols in Cell Biology. 44. Wiley - Blackwell. Unit 19.12 19.12.1 - 17, which is incorporated herein by reference.

[0246] b. Gene knockout using zinc - finger nucleases

[0247] In some embodiments, the disclosed methods include using zinc - finger nucleases to knockout genes (e.g., PsiD, PsiM, PsiK, and / or PsiH). Zinc - finger nucleases typically consist of a DNA - binding domain that can precisely target a DNA sequence. Without being bound by theory, each zinc - finger can recognize a specific codon of the desired DNA sequence and thus can be modularly assembled to bind to a specific sequence. These binding domains can be coupled to a restriction endonuclease that can cause a double - strand break (DSB) in the DNA. The repair process may introduce mutations that disrupt gene function.

[0248] In some embodiments, zinc - finger DNA - binding domains are generated to target a three - base - pair sequence in the DNA sequence of PsiD, PsiM, PsiK, or PsiH and then fused to a restriction endonuclease domain. The construct is delivered to the cells of the psilocybin - producing fungus by methods known to those skilled in the art, such as by microinjection or electroporation. Without being bound by theory, after binding to the target sequence, the endonuclease can cause a double - strand break in the sequence. Then, the DNA repair mechanism of the cell can repair the break, which can introduce insertions or deletions that render the sequence non - functional.

[0249] Protocols for gene inactivation using zinc - finger nucleases can be found in Santiago et al., Targeted gene knockout in mammalian cells by using engineered zinc - finger nucleases, Proc Nat’l Acad Sci. 105(15):5809 - 5814, April 15 th , 2008; see also, for example, Song et al., The Use of CRISPR / Cas9, ZFNs, and TALENs in Generating Site - Specific Genome Alterations, Methods Enzymol., Vol. 546(2014), both of which are hereby incorporated by reference.

[0250] c. Gene knockout using TALENs

[0251] In some embodiments, the disclosed methods include using transcription activator-like effector nucleases (TALENs) to knockout genes (e.g., PsiD, PsiM, PsiK, and / or PsiH). TALENs generally comprise a DNA-binding domain and a nuclease that can cleave DNA. Without being bound by theory, the DNA-binding region consists of amino acid repeats of individual bps that each recognize the desired target DNA sequence. If such cleavage targets the gene coding region and non-homologous end joining (NHEJ)-mediated repair introduces insertions and deletions, it may result in a frameshift mutation, thereby disrupting the function of the target gene.

[0252] In some embodiments, TALENs are generated to target a 3-bp sequence in the PsiD, PsiH, PsiK, or PsiM DNA sequence. The construct is delivered to the cells of the psilocybin-producing fungus by methods known to those skilled in the art, such as by microinjection or electroporation. Without being bound by theory, when bound to the target sequence, the endonuclease causes a double-strand break in the sequence. Then, DNA repair mechanisms, such as those mediated by non-homologous end joining NHEJ, may attempt to repair the break, which may disrupt the reading frame of the gene and the resulting function.

[0253] Protocols for gene inactivation using TALENs can be found in Keith et al., TALENs: a widely applicable technology for targeted genome editing, Nature Reviews Molecular Cell Biol. 14(1):49-55, Jan 2013; see also, e.g., Song et al., The Use of CRISPR / Cas9, ZFNs, and TALENs in Generating Site-Specific Genome Alterations, Methods Enzymol., Vol. 546(2014), both of which are hereby incorporated by reference. d. Gene knockout using CRISPR / Cas9

[0254] In some embodiments, the disclosed methods include using clustered regularly interspaced short palindromic repeats (CRISPR) to knock out genes (e.g., PsiD, PsiM, PsiK, and / or PsiH). CRISPR / Cas9 is a method for genome editing that involves a guide RNA complexed with the Cas9 protein. Without being bound by theory, the guide RNA can be engineered to match a desired DNA sequence by simple complementary base pairing. The coupled Cas9 can then cause a double-strand break in the DNA. Following the same principle as zinc fingers and TALENs, attempts to repair these double-strand breaks may result in frameshift mutations, leading to a non-functional target gene.

[0255] Protocols for gene inactivation by CRISPR can be found in Optimized Gene Knockout Guidelines Using CRISPR / Cas9 (VanCampenhout et al., Biotechniques, Vol. 66, No. 6, 295 - 302, June 2019) and Wei et al., Efficient Gene Knockout in Goats Using CRISPR / Cas9 System, PLOS ONE. 9(9):e106718, September 2014); see also, e.g., Song et al., The Use of CRISPR / Cas9, ZFNs, and TALENs in Generating Site-Specific Genome Alterations, Methods Enzymol., Vol. 546 (2014), both of which are hereby incorporated by reference.

[0256] CRISPR-associated endonucleases: CRISPR (clustered regularly interspaced short palindromic repeats) is present in bacteria and is thought to protect bacteria from phage infection. It has been used as a means to alter gene expression in eukaryotic DNA and as a way to introduce insertions or deletions to increase or decrease transcription in the DNA of target cells or cell populations. See, e.g., Horvath P, Barrangou R. CRISPR / Cas, the immune system of bacteria and archaea. Science. 2010 Aug;327(5962):167-70; Terns MP, Terns RM. CRISPR-based adaptive immune systems. Curr Opin Microbiol. 2011;14(3):321-7 and Wang H, Yang H, Shivalila CS, Dawlaty MM, Cheng AW, Zhang F, Jaenisch R. One-step generation of mice carrying mutations in multiple genes by CRISPR / Cas-mediated genome engineering. Cell. 2013;153(4):910-8, each of which is incorporated herein by reference in its entirety.

[0257] The CRISPR method employs a nuclease, CRISPR-associated (Cas), which complexes with a small RNA, the guide RNA (gRNA), to cleave DNA upstream of the protospacer adjacent motif (PAM) in a sequence-specific manner at any genomic location. CRISPR can use separate guide RNAs known as crRNA and tracrRNA. These two separate RNAs have been combined into a single RNA to achieve site-specific mammalian genome cleavage by designing short guide RNAs. Cas and the guide RNA (gRNA) can be synthesized by known methods. The Cas / guide-RNA (gRNA) uses a non-specific DNA cleavage protein, Cas, and hybridizes with an RNA oligonucleotide to target and recruit the Cas / gRNA complex. See, e.g., Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 2013;23(4):465-72. and Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, Peterson RT, Yeh JR, Joung JK. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013;31(3):227-9, all of which are incorporated herein by reference in their entirety.

[0258] Generally, the CRISPR / Cas protein comprises at least one RNA recognition and / or RNA binding domain. The RNA recognition and / or RNA binding domain interacts with the guide RNA. The CRISPR / Cas protein may also comprise a nuclease domain (i.e., a DNA nuclease or an RNA nuclease domain), a DNA binding domain, a helicase domain, an RNA nuclease domain, a protein-protein interaction domain, a dimerization domain, and other domains. The mechanism by which CRISPR / Cas9-induced mutations inactivate the PsiD, PsiM, PsiH, and PsiK genes can vary. For example, the mutations may affect the expression of the PsiD, PsiM, PsiH, and PsiK genes or excise all or part of the genes. The mutations may comprise one or more deletions. The size of the deletions can vary from a single nucleotide base pair to about 10,000 base pairs. In some embodiments, the deletions may include all or substantially all of the PsiD, PsiM, PsiH, and PsiK sequences. The mutations may also comprise one or more insertions, i.e., the addition of one or more nucleotide base pairs to the PsiD, PsiM, PsiH, and PsiK sequences. The size of the inserted sequences can also vary, e.g., from about one base pair to about 300 nucleotide base pairs. The mutations may include one or more point mutations, i.e., a single nucleotide is replaced by another nucleotide. Useful point mutations are those with functional consequences, e.g., mutations that result in the conversion of an amino acid codon to a stop codon or that result in the production of a non-functional protein.

[0259] In embodiments, the CRISPR / Cas-like protein can be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter enzyme activity, and / or alter another property of the protein. For example, the nuclease (i.e., DNA nuclease, RNA nuclease) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the fusion protein. The CRISPR / Cas-like protein can also be truncated or modified to optimize the activity of the effector domain of the fusion protein.

[0260] In some embodiments, the CRISPR / Cas-like protein is derived from a wild-type Cas9 protein or a fragment thereof. In other embodiments, the CRISPR / Cas-like protein is derived from a modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties of the protein (e.g., nuclease activity, affinity, stability). Alternatively, Cas9 protein domains that do not participate in RNA-guided cleavage can be eliminated from the protein, such that the modified Cas9 protein is smaller than the wild-type Cas9 protein.

[0261] Three types (I-III) of CRISPR systems have been identified. The CRISPR cluster contains spacers, i.e., sequences complementary to previous mobile elements. The CRISPR cluster is transcribed and processed into mature CRISPR RNA (crRNA). In embodiments, the CRISPR / Cas system can be a type I, type II, or type III system. Non-limiting examples of suitable CRISPR / Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966.

[0262] In one embodiment, the RNA-guided endonuclease is derived from a type II CRISPR / Cas system. The CRISPR-associated endonuclease Cas9 belongs to the type II CRISPR / Cas system and has strong endonuclease activity to cleave target DNA. Cas9 is guided by mature crRNA, which contains a unique target sequence of approximately 20 base pairs (bp) (referred to as the spacer) and a trans-activating small RNA (tracrRNA), which serves as ribonuclease III-assisted processing of pre-crRNA. The crRNA:tracrRNA duplex guides Cas9 to the target DNA via complementary base pairing between the spacer on the crRNA and the complementary sequence on the target DNA (referred to as the protospacer). Cas9 recognizes the trinucleotide (NGG) protospacer adjacent motif (PAM) to specify the cleavage site (the 3rd nucleotide from the PAM). The crRNA and tracrRNA can be expressed separately or engineered into an artificial fusion small guide RNA (sgRNA) via a synthetic stem-loop (AGAAU) to mimic the native crRNA / tracrRNA duplex. Such sgRNAs, like shRNAs, can be synthesized or in vitro transcribed for direct RNA transfection or expressed from U6- or H1-promoted RNA expression vectors, although the cleavage efficiency of artificial sgRNAs is lower than that of systems with separately expressed crRNA and tracrRNA.

[0263] The CRISPR-associated endonuclease Cas9 nuclease can have a nucleotide sequence identical to the wild-type Streptococcus pyogenes sequence. The CRISPR-associated endonuclease can be a sequence from other species, such as other Streptococcus species, e.g., thermophiles. The Cas9 nuclease sequence can be derived from other species, including but not limited to: Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophiles, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina. Pseudomonas aeruginosa, Escherichia coli, or other sequenced bacterial genomes and archaea or other prokaryotic microorganisms can also be sources of the Cas9 sequences used in the embodiments disclosed herein.

[0264] The Cas9 nuclease sequence can be a mutated sequence. For example, the Cas9 nuclease can be mutated in the conserved HNH and RuvC domains, which are involved in strand-specific cleavage. For example, the aspartic acid to alanine (D10A) mutation in the RuvC catalytic domain allows the Cas9 nickase mutant (Cas9n) to nick rather than cut DNA to generate a single-strand break, and subsequent preferential repair by HDR can potentially reduce the frequency of unwanted indel mutations from off-target double-strand breaks.

[0265] The Cas9 can be orthologous. Six smaller Cas9 orthologs have been used and reports have shown that Cas9 from Staphylococcus aureus (SaCas9) can edit the genome with an efficiency similar to that of SpCas9 while being over 1 kilobase shorter.

[0266] In addition to the wild-type and variant Cas9 endonucleases described above, embodiments of the present disclosure also encompass CRISPR systems comprising newly developed "enhanced specificity" Streptococcus pyogenes Cas9 variants (eSpCas9), which significantly reduce off-target cleavage. These variants are engineered to have alanine substitutions to neutralize positively charged sites in the groove that interacts with the non-target strand of DNA. This modification can reduce the interaction of Cas9 with the non-target strand, thus encouraging re-hybridization between the target and non-target strands. The effect of this modification is a more stringent requirement for Watson-Crick pairing between the gRNA and the target DNA strand, which limits off-target cleavage (Slaymaker IM, Gao L, Zetsche B, Scott DA, Yan WX, Zhang F. Rationally engineered Cas9 nucleases with improved specificity. Science. 2016 Jan 1;351(6268):84-8.).

[0267] As used herein, the term "Cas" refers to all Cas molecules, including variants, mutants, orthologs, high-fidelity variants, etc., unless the specific context requires otherwise.

[0268] Guide nucleic acid sequence: The guide RNA sequences according to the present disclosure can be sense or antisense sequences. The specific sequences of the gRNAs can vary. However, regardless of the sequence, useful guide RNA sequences will be those that minimize off-target effects while achieving high efficiency and complete ablation of the THC gene. The guide RNA sequence generally includes a protospacer adjacent motif (PAM). The sequence of the PAM can vary according to the specificity requirements of the CRISPR endonuclease used. In the CRISPR-Cas system derived from S. pyogenes, the target DNA is typically immediately preceded by a 5'-NGG protospacer adjacent motif (PAM). Thus, for S. pyogenes Cas9, the PAM sequence can be AGG, TGG, CGG, or GGG. Other Cas9 orthologs can have different PAM specificities. For example, Cas9 from S. thermophilus requires 5'-NNAGAA for CRISPR 1 and 5'-NGGNG for CRISPR3, and Neisseria meningitidis requires 5'-NNNNGATT. The specific sequence of the guide RNA can vary. However, regardless of the sequence, useful guide RNA sequences will be those that minimize off-target effects while achieving high efficiency and complete ablation of the THC gene. The length of the guide RNA sequence can vary from about 20 to about 60 or more nucleotides, such as about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 45, about 50, about 55, about 60 or more nucleotides.

[0269] The guide RNA sequences can be configured as a single sequence or a combination of one or more different sequences, e.g., a multiplex configuration. The multiplex configuration can include a combination of two, three, four, five, six, seven, eight, nine, ten, or more different guide RNAs. In certain embodiments, the composition comprises multiple different gRNA molecules, each targeting a different target sequence. In certain embodiments, this multiplex strategy provides increased efficacy. These multiplex gRNAs can be expressed separately in different vectors or expressed in a single vector.

[0270] Non-hallucinogenic PsiD, PsiK, PsiM, and / or PsiH knockout psychedelic fungi

[0271] Genetically modified fungi with one or more gene knockouts are disclosed in some aspects. In some embodiments, the genetically modified fungi are non-hallucinogenic psychedelic fungi. In some embodiments, the non-hallucinogenic psychedelic fungi are psilocybin-producing fungi with one or more gene knockouts. In some embodiments, the non-hallucinogenic psychedelic fungi are psilocybin-producing fungi that have introduced alterations into their genomes that result in the loss of psilocybin biosynthesis. Such non-hallucinogenic psychedelic fungi can include genetic defects directly introduced into the coding sequences of at least one gene of the psilocybin biosynthetic pathway, said genes including one, two, three, or four genes of the psilocybin biosynthetic pathway. In some embodiments, the non-hallucinogenic psychedelic fungi have genetic defects directly introduced into the coding sequences of one or more of the PsiD, PsiK, PsiM, and PsiH genes.

[0272] In some embodiments, the non-hallucinogenic psychedelic fungi are psychedelic fungi in which only one of the PsiD, PsiK, PsiM, or PsiH genes is inactivated.

[0273] In some embodiments, the non-hallucinogenic psychedelic fungi are psychedelic fungi in which the PsiD gene is inactivated, thereby disrupting psilocybin synthesis at the catalytic step of the psilocybin biosynthetic pathway in which PsiD is involved, but leaving intact steps that do not involve that enzyme. In P. cubensis, the PsiD enzyme is primarily responsible for catalyzing the decarboxylation of L-tryptophan to produce tryptamine (see also Figure 9 , which depicts each of the PsiD, PsiK, PsiM, or PsiH enzymes, and the effects of their potential disruption according to different disclosed embodiments). Thus, in some embodiments, where the PsiD gene is inactivated, or the catalytic function of the PsiD enzyme is otherwise disrupted or interfered with, the resulting genetically modified fungi can contain increased or substantially similar levels of L-tryptophan; and reduced levels of any one of tryptamine, 4-hydroxytryptamine, norbaeocystin, baeocystin, psilocybin, and psilocin; said levels being compared to an unmodified fungus, the average of unmodified fungi, or another quantity known in the art.

[0274] In some embodiments, the non-hallucinogenic psychedelic fungi are psychedelic fungi in which the PsiH gene is inactivated, thereby disrupting psilocybin synthesis at the catalytic step of the psilocybin biosynthetic pathway in which PsiH is involved, but leaving intact steps that do not involve that enzyme. In P. cubensis, the PsiH enzyme is primarily responsible for catalyzing the oxidation of tryptamine to produce 4-hydroxytryptamine (see also Figure 9)。Thus, in some embodiments, in which the PsiH gene is inactivated, or the catalytic function of the PsiH enzyme is otherwise disrupted or interfered with, the resulting genetically modified fungus can contain increased or substantially similar levels of L-tryptophan and / or tryptamine; and reduced levels of any one of 4-hydroxytryptamine, norbaeocystin, baeocystin, psilocybin, and psilocin; the levels being compared to an unmodified fungus, the average of unmodified fungi, or another quantity known in the art.

[0275] In some embodiments, a non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiK gene is inactivated, thereby disrupting psilocybin synthesis at the catalytic step of the psilocybin biosynthetic pathway involving PsiK, but leaving intact steps not involving the enzyme. In P. cubensis, the PsiK enzyme is primarily responsible for catalyzing the phosphorylation of 4-hydroxytryptamine to produce norbaeocystin (see also Figure 9 )。Thus, in some embodiments, in which the PsiK gene is inactivated, or the catalytic function of the PsiK enzyme is otherwise disrupted or interfered with, the resulting genetically modified fungus can contain increased or substantially similar levels of any one of L-tryptophan, tryptamine, and 4-hydroxytryptamine; and reduced levels of any one of norbaeocystin, baeocystin, psilocybin, and psilocin; the levels being compared to an unmodified fungus, the average of unmodified fungi, or another quantity known in the art.

[0276] In some embodiments, a non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiM gene is inactivated, thereby disrupting psilocybin synthesis at the catalytic step of the psilocybin biosynthetic pathway involving PsiM, but leaving intact steps not involving the enzyme. In P. cubensis, the PsiM enzyme is primarily responsible for catalyzing the methylation of norbaeocystin to produce baeocystin, and subsequently catalyzing the methylation of baeocystin to produce psilocybin (see also Figure 9 )。Thus, in some embodiments, in which the PsiM gene is inactivated, or the catalytic function of the PsiM enzyme is otherwise disrupted or interfered with, the resulting genetically modified fungus can contain increased or substantially similar levels of any one of L-tryptophan, tryptamine, 4-hydroxytryptamine, and norbaeocystin; and reduced levels of any one of baeocystin, psilocybin, and psilocin; the levels being compared to an unmodified fungus, the average of unmodified fungi, or another quantity known in the art.

[0277] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiD and PsiH genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway in which PsiD and PsiH enzymes are involved, but leaving intact the steps that do not involve these enzymes.

[0278] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiD and PsiM genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway in which PsiD and PsiM are involved, but leaving intact the steps that do not involve these enzymes.

[0279] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiD and PsiK genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway in which PsiD and PsiK are involved, but leaving intact the steps that do not involve these enzymes.

[0280] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiH and PsiK genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway involving PsiH and PsiK, but leaving intact the steps that do not involve these enzymes.

[0281] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiH and PsiM genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway involving PsiH and PsiM, but leaving intact the steps that do not involve these enzymes.

[0282] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiK and PsiM genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway in which PsiK and PsiM are involved, but leaving intact the steps that do not involve these enzymes.

[0283] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiD, PsiH, and PsiK genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway involving PsiD, PsiH, and PsiK, but leaving intact the steps that do not involve these enzymes.

[0284] In some embodiments, the non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiH, PsiK, and PsiM genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway involving PsiH, PsiK, and PsiM, but leaving intact the steps that do not involve these enzymes.

[0285] In some embodiments, a non-hallucinogenic psychedelic fungus is a psychedelic fungus in which the PsiK, PsiM, and PsiD genes are inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway involving PsiK, PsiM, and PsiD, but leaving intact steps that do not involve these enzymes.

[0286] In some embodiments, a non-hallucinogenic psychedelic fungus is a psychedelic fungus in which each of the PsiD, PsiH, PsiK, and PsiM genes is inactivated, thereby disrupting psilocybin synthesis at the catalytic steps of the psilocybin biosynthetic pathway involving PsiD, PsiH, PsiK, and PsiM, but leaving intact steps that do not involve these enzymes.

[0287] CRISPR / Cas9-edited fungi

[0288] CRISPR / Cas9-edited fungi are disclosed in some aspects of the present invention. In some embodiments, the CRISPR / Cas9-edited fungi are prepared by introducing deletions in one or more of the psilocybin biosynthetic genes and / or in a portion of one or more of the psilocybin biosynthetic genes, namely the PsiD, PsiK, PsiM, and PsiH genes.

[0289] In some preferred embodiments, the disclosed CRISPR / Cas9-edited fungi do not contain foreign (i.e., exogenous) DNA integrated into the fungal genome. Those skilled in the art will understand that, at the time of this disclosure, non-transgenic CRISPR / Cas9-edited fungi are not regulated articles under the United States Department of Agriculture (USDA). See Ltr. from Michael J. Firko, PhD, APHIS Deputy Admin., Biotech. Reg. Svc’s, USDA, dated Apr. 13, 2016, available at www.aphis.usda.gov / biotechnology / downloads / reg_loi / 15-321-01_air_response_signed.pdf, which confirms that CRISPR / Cas9-edited Agaricus bisporus fungi “have small deletions (1-14 bp) in specific polyphenol oxidase genes but do not contain exogenous DNA integrated into the mushroom genome” and are not regulated articles under 7 C.F.R. § 340 (regulating certain organisms engineered or produced through genetic engineering). Thus, in an embodiment, one advantage of the present invention is to provide non-hallucinogenic psychedelic fungi that are not regulated as genetically engineered (GE) organisms or as genetically modified organisms (GMOs).

[0290] In some embodiments, the CRISPR / Cas9-edited fungi of the present disclosure can be prepared as described, for example, in Schuster, M., & Kahmann, R. (2019) Figure 1 “CRISPR-Cas9 genome editing approaches in filamentous fungi and oomycetes” Fungal Genetics and Biology, 130, 43-53, which is incorporated herein by reference in its entirety.

[0291] In some embodiments, the Cas9 and sgRNA genes are delivered as DNA fragments. In some such embodiments, the DNA fragments integrate into the genome at specific sites. In other embodiments, the DNA fragments incorporate into the genome at random sites.

[0292] In some embodiments, the Cas9 gene integrates into the genome, and the sgRNA gene is transiently delivered as part of a plasmid. In some such embodiments, the Cas9 gene integrates into the genome at a specific site, and the sgRNA gene is transiently delivered as part of a plasmid. In other embodiments, the Cas9 gene incorporates into the genome at a random site, and the sgRNA gene is transiently delivered as part of a plasmid.

[0293] In some embodiments, the Cas9 gene integrates into the genome at defined or random sites, and the sgRNA is provided as an RNA molecule. In some such embodiments, the Cas9 gene integrates into the genome at a specific site, and the sgRNA is provided as an RNA molecule. In other embodiments, the Cas9 gene incorporates into the genome at a random site, and the sgRNA is provided as an RNA molecule.

[0294] In some embodiments, the Cas9 and sgRNA genes can be delivered as part of a plasmid. In some embodiments, the Cas9 gene is delivered as part of a plasmid. In some embodiments, the sgRNA gene is delivered as part of a plasmid. In some embodiments, the Cas9 gene is provided as part of a plasmid, and the sgRNA is delivered as an RNA molecule. In some embodiments, the Cas9 and sgRNA are delivered as a pre-assembled ribonucleoprotein (RNP) complex. In some embodiments, the Cas9 is delivered as a pre-assembled RNP complex. In embodiments, the sgRNA is delivered as a pre-assembled RNP complex.

[0295] The edited strain can vary depending on the delivery strategy employed. For example, in embodiments where the Cas9 and sgRNA genes are delivered as DNA fragments, the edited strain can contain both the Cas9 and sgRNA expression cassettes. In other embodiments, such as where the Cas9 gene is integrated into the genome and the sgRNA gene is transiently delivered as part of a plasmid or as an RNA molecule, the edited strain can contain only the Cas9 expression cassette. In some embodiments, such as where one or both of the Cas9 and sgRNA genes are delivered as part of a plasmid or as a pre-assembled RNP complex, the edited strain can differ from the parental strain only at the edited locus.

[0296] Protocols for gene editing using CRISPR are described, for example, in U.S. Patent Nos. 6,603,061; 7,868,149; 9,822,372 and 10,934,554; U.S. Publication Nos. 2009 / 0100536-A1, 2022 / 0002742-A1 and 2022 / 0356484-A1; and Morrell et al., Crop genomics: advances and applications. Nat Rev Genet. December 29, 2011; 13(2):85-96; and other references disclosed herein, the entire contents and disclosures of each of which are incorporated herein by reference in their entirety.

[0297] Silencing the psilocybin biosynthesis pathway using siRNA and miRNA

[0298] Double-stranded RNA (dsRNA) is either transcribed from cellular genes or an infecting pathogen or is artificially introduced into the cell and is processed by a special ribonuclease III-like enzyme called Dicer in the cytoplasm into smaller dsRNA molecules. This short dsRNA molecule is called siRNA, which has 21-23 nucleotides and has 3' two-nucleotide overhangs. The siRNA interacts with the RNA-induced silencing complex (RISC) and activates the RISC. The endonuclease argonaute 2 (AGO2) component of RISC cleaves the passenger strand (sense strand) of the siRNA, while the guide strand (antisense strand) remains associated with the RISC. Subsequently, the guide strand directs the active RISC to its target mRNA for cleavage by AGO2. Since the guide strand binds only to the mRNA that is perfectly complementary to it, siRNA causes specific gene silencing. The psilocybin biosynthetic pathway can be blocked by utilizing siRNA, which in turn can silence genes necessary for psilocybin production such as PsiD, PsiK, PsiM, and PsiH.

[0299] The first fundamental step for successful siRNA silencing is to design siRNA sequences that are effective and specific to the intended mRNA to minimize any off-target effects. Conventional siRNAs consist of 19-21 nucleotides with two-nucleotide overhangs at the 3' end, typically TT and UU, which are important for recognition by the RNAi machinery. There are several siRNA design algorithms well-known in the art that can be used to design specific siRNA molecules that are specific to the genes involved in the psilocybin biosynthetic pathway (PsiD, PsiH, PsiM, and PsiK). (See Chaudhary et al., Development of a software tool and criteria evaluation for efficient design of small interfering RNA, Biochem Biophys Res Commun, 404 (2011), pp. 313-320; Zhong et al., Computational detection and suppression of sequence-specific off-target phenotypes from whole genome RNAi screens. Nucleic Acids Res, 42 (2014), pp. 8214-8222; Naito et al., siRNA design software for a target gene-specific RNA interference, Front Genet., 11 June 2012; all of which are incorporated herein by reference.)

[0300] A summary of common strategies for enhancing the efficacy and specificity of siRNAs and reducing off-target effects is provided below (see Lam et al., siRNA Versus miRNA as Therapeutics for Gene Silencing, Molecular Therapy: Nucleic Acids (2015) 4, e252.).

[0301]

[0302]

[0303] Computer-selected siRNA target candidates targeting the psilocybin biosynthetic pathway are then synthesized using commercial vendors such as Dharmacon or Integrated DNA technologies. In some embodiments, the siRNA delivery strategy employed includes a soaking method using chemically synthesized siRNA. In some embodiments, the siRNA delivery strategy employed includes inserting an inverted repeat transgene (IRT) into a desired plasmid using long hairpin RNA (lhRNA).

[0304] In some embodiments, siRNA delivery is accomplished as described, for example, in FIG. 12.2 of Jain, C.K., Wadhwa, G. (2018), Computational Tools: RNA Interference in Fungal Therapeutics. In: Wadhwa, G. et al. (eds) Current Trends in Bioinformatics: An Insight. Springer, Singapore, the full text of which is incorporated herein by reference.

[0305] In some embodiments, siRNA is delivered according to the soaking method. In some embodiments, the soaking method includes soaking the fungus with siRNA. In some embodiments, siRNA is delivered by inserting an IRT into a desired plasmid using lhRNA. In some embodiments, the IRT consists of the sense and antisense orientations of genes separated by a spacer. In some embodiments, the IRT is incorporated into a desired plasmid and transformed into the fungus. In some embodiments, the endogenous dicer enzyme cleaves the hairpin loop formed after IRT transcription and generates siRNA. In some embodiments, the passenger strand and the guide strand of the siRNA it cleaves enter RISC, where it cleaves the target mRNA.

[0306] An IRT is constructed using a target gene sequence, and the target gene sequence is incorporated into a plasmid specific to an organism. The plasmid containing the IRT is transformed into the organism, and a hairpin loop is formed during transcription in the organism. The hairpin loop is cleaved by an endogenous dicer enzyme to produce siRNA. (See Nakade et al., Gene silencing of the Lentinula edodes lcc1 gene by expression of a homologous inverted repeat sequence, Microbiological Research, Vol. 166, No. 6, September 20, 2011, pp. 484-493). The small interfering RNA (siRNA) produced cleaves endogenous mRNA with the help of RISC. Considering that several RNA systems expressing hairpins can be used for robust RNA silencing using tissue-specific RNApol II promoters, for tissue-specific expression of dsRNA, and hairpin RNA ensures efficient formation of dsRNA. (See Paddison et al., 2008, RNA interference, Current Topics in Microbiology and Immunology, vol. 320. Springer-Verlag, Berlin).

[0307] In some embodiments, the IRT is a long hairpin RNA (lhRNA), which generally consists of an open reading frame of more than 300 bp, a spacer region of about 250-500 oligonucleotides, and an inverted repeat of the gene sequence. The IRT construct is inserted into a plasmid specific to a particular fungus and transformed into the corresponding fungus by protoplast formation or electroporation. In some embodiments, the IRT is a short hairpin RNA (shRNA), which consists of 19 bp siRNA sense and antisense sequences separated by a 9-nucleotide spacer, wherein the siRNA sequence should be 100% homologous to the target mRNA.

[0308] According to the protocols disclosed in this article and the examples, the synthetic siRNA target candidates thus obtained are introduced into the protoplasts of Psilocybe mushrooms. Initial experiments are carried out using Cy3-labeled siRNA molecules to test the uptake of siRNA molecules targeting the target genes (PsiD, PsiM, PsiK, PsiH) by the protoplasts. Unlabeled siRNA is used for subsequent experiments. Controls are generated using protoplasts treated with irrelevant siRNA and cultures without the addition of siRNA. (See Calkins et al., Development of an RNA interference (RNAi) gene knockdown protocol in the anaerobic gut fungus Pecoramyces ruminantium strain C1A, PeerJ. 2018; 6: e4276. doi: 10.7717 / peerj.4276.).

[0309] Supernatants (0.5 ml) of the siRNA-treated and control cultures are sampled regularly and tested for the presence of psilocybin by Keller's reagent (glacial acetic acid containing ferric chloride and concentrated sulfuric acid). Cultures of Psilocybe in which psilocybin production has been silenced by the siRNA candidates will not show a clear blue or purple Keller reaction, while cultures that are controls with irrelevant siRNA or untreated cultures will show the presence of blue, indicating the presence of psilocybin. Cultures that do not show a distinct blue or purple Keller reaction are collected and propagated to produce a large number of knockout mushrooms for extract preparation. (See Injury-Triggered Blueing Reactions of Psilocybe “Magic” Mushrooms, Lenz et al. Angewandte Chemie, Vol. 59, Issue 4 Jan. 20, 2020 pp. 1450-1454.).

[0310] Blotting techniques, fluorescence imaging, and biochemical assays are further confirmatory tests that can be used to analyze silencing at the RNA and protein levels. Studies were conducted in the blast fungus M. oryzae by Kadotani et al (see Kadotani N et al (2003) RNA silencing in the phytopathogenic fungus Magnaporthe oryzae. MPMI 16:769-776), where they studied RNA silencing using enhanced green fluorescent protein (eGFP). Sense-sense, antisense-antisense, and sense-antisense IRT constructs of eGFP separated by partial sequences of the β-glucuronidase gene as internal spacers were used. Significant silencing was induced only by the sense-antisense IRT construct, as detected by loss of GFP fluorescence using an image analyzer. Northern blot analysis was used in the study to investigate gene silencing in fungi (see Yamada O et al (2007) Gene silencing by RNA interference in the Koji Mold Aspergillus oryzae. Biosci Biotechnol Biochem. 71:138-144). In some embodiments, such techniques are used to test the efficacy of silencing produced by siRNA candidates according to the teachings herein and the techniques in the art.

[0311] Inactivation of the catalytic functions of PsiD, PsiK, PsiM, and / or PsiH

[0312] In some embodiments, the disclosed methods of disrupting or preventing the biosynthesis of bioactive alkaloids in fungi that produce bioactive alkaloids include inactivating the catalytic function of enzymes involved in the biosynthesis of bioactive alkaloids. In some embodiments, the disclosed methods of disrupting or preventing the biosynthesis of psilocybin in fungi that produce psilocybin include inactivating the catalytic function of any one or more of PsiD, PsiK, PsiM, and / or PsiH. In another aspect, genetically modified fungi (e.g., fungi that produce psilocybin) are provided, wherein one or more enzymes (e.g., PsiD, PsiK, PsiM, and / or PsiH) involved in the biosynthesis of bioactive alkaloids (e.g., psilocybin) have been modified, for example, according to the methods and techniques disclosed herein, such that the catalytic function of the one or more enzymes is inactivated.

[0313] In some embodiments, PsiD, PsiK, PsiM, and / or PsiH are inactivated by inactivating the enzyme active site. This can be achieved according to various strategies using the methods disclosed herein. For example, the enzyme active site can be inactivated by small deletions of nucleotides in the amino acid sequence encoding the enzyme active site, resulting in an enzyme that lacks a functional active site and thus lacks (or has a significantly reduced) catalytic activity. In another exemplary embodiment, the methods disclosed herein can be used to introduce amino acid substitutions in the sequence of the enzyme active site, thereby modifying the function of the active site and inactivating (or substantially reducing) the catalytic function of the active site. In another exemplary embodiment, the methods disclosed herein can be used to alter the genetic sequence in the gene encoding any one or more of PsiD, PsiK, PsiM, and / or PsiH such that the amino acid sequence of the resulting enzyme is altered. In some embodiments, a frameshift mutation is made, resulting in a complete change in the downstream amino acid sequence. In some embodiments, the active site sequence is deleted such that the resulting protein does not contain an active site. In some embodiments, point mutations are made in the active site sequence. In some embodiments, the point mutation is a missense mutation in which a single nucleotide is changed such that the resulting downstream amino acid sequence is disrupted, inactivated, or has a significantly reduced activity. In some embodiments, the point mutation is a nonsense mutation in which a stop codon is inserted into the active site sequence, resulting in a truncated enzyme that lacks functional activity. In some embodiments, a mutation is generated in the nucleotide that results in protein misfolding or non-functional interactions in the protein, which inactivates the active site or significantly reduces its activity.

[0314] Exemplary characteristics and uses of the disclosed genetically modified fungi

[0315] In some embodiments, genetically modifying a fungus that produces a bioactive alkaloid prevents the production of the bioactive alkaloid such that the fungus can be used to produce other compounds, such as other therapeutic compounds, without the bioactive alkaloid.

[0316] In a preferred embodiment, genetically modifying a fungus that produces psilocybin prevents the production of psilocybin such that the fungus can be used to produce other therapeutic compounds that lack the hallucinogenic properties of psilocybin. In some embodiments, the other therapeutic compounds are Psilocybe environmental metabolites. In some embodiments, the Psilocybe environmental metabolites include non-hallucinogenic bioactive alkaloids.

[0317] In some embodiments, the disclosed genetically modified fungi are used to produce non-hallucinogenic bioactive alkaloids. In some embodiments, the non-hallucinogenic bioactive alkaloids are any one of baeocystin, norbaeocystin, aeruginascin, tryptophan, tryptamine, serotonin, N-acetyl-5-hydroxytryptamine, 4-hydroxytryptamine, 4-hydroxy-L-tryptophan, 5-hydroxy-L-tryptophan, 2-(4-hydroxy-1H-indol-3-yl)ethyl-trimethylazanium, 7-hydroxy-L-tryptophan, harmane, norharmane, harmine, harmol, harmaline, cordysinin C, cordysinin D, perlolyrine, β-carboline, bisnoryangonin, hispidin, bufotenin or a derivative or analogue thereof.

[0318] In some embodiments, the disclosed genetically modified fungi are used to produce therapeutic compounds. In some embodiments, the therapeutic compounds are any one of phenolic compounds, flavonoids, antioxidants, metal chelators, steroids, neurosteroids, polysaccharides, terpenes, terpenoids, non-hallucinogenic alkaloids, folic acid, tocopherols, volatile oils, ascorbic acid, proteins, fats, minerals, enzymes, carotenoids, glycosides, lactones, lectins or organic acids. (See, for example, Chugh RMatal. Fungal mushrooms: a natural compound with therapeutic applications. Front Pharmacol. 2022;13:925387.).

[0319] In some embodiments, the disclosed genetically modified fungi are used to produce compounds having therapeutic or beneficial properties. In some embodiments, the therapeutic or beneficial properties are any one of antibacterial, antibiotic, antifungal, anticancer, immunosuppressive, immunostimulatory, anti-inflammatory, hypoglycemic, antioxidant, antiviral, anti-neurodegenerative, anti-epileptic, neuroprotective, anti-angiogenic, antidiabetic or cholesterol-lowering properties. (See, for example, Elkhateeb WA, et al. Medicinal mushrooms as a new source of natural therapeutic bioactive compounds. Egypt Pharm J. 2019;18(2):88-101.).

[0320] In some embodiments, the disclosed genetically modified fungi are eaten fresh. In some embodiments, the disclosed genetically modified fungi are eaten dried.

[0321] In some embodiments, the disclosed therapeutic compounds are extracted from specific mushroom tissues. In some embodiments, the mushroom tissue is any one of mycelium, fruiting body, protoplast, or spore. In some embodiments, the disclosed therapeutic compounds are extracted from more than one type of mushroom tissue, or from any type of mushroom tissue.

[0322] In some embodiments, the disclosed fungi are used as products, for producing products, or in products. In some embodiments, exemplary products include nootropics, supplements, nutraceuticals, therapeutic agents, microdoses, functional foods, or topical creams.

[0323] In some embodiments, the disclosed genetically modified fungi are processed for use in formulations. In some embodiments, the formulations are used as nootropics, supplements, nutraceuticals, microdoses, functional foods, or skin creams. In some embodiments, the formulations consist of any suitable dosage form, including ground fungal material, aqueous oral dispersions, aqueous oral suspensions, solid dosage forms including oral solid dosage forms, aerosols, controlled release formulations, fast-dissolving formulations, effervescent formulations, self-emulsifying dispersions, solid solutions, liposomal dispersions, lyophilized formulations, tablets, capsules, pills, powders, delayed release formulations, immediate release formulations, modified release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate release and controlled release formulations.

[0324] As illustrative and non-limiting examples, the genetically modified fungal formulations prepared according to the examples herein have a variety of applications for improving human health, including reducing pain and treating pain disorders, reducing and treating inflammation and inflammatory disorders, benefiting immunity and reducing or treating the symptoms of immune disorders, including autoimmune diseases and disorders, and for general improvement in physical health and wellness, including relaxation and improved sleep.

[0325] In some aspects, methods of modulating neurotransmission are provided, which include administering the disclosed extracts to a subject, thereby modulating neurotransmission in the subject. In some embodiments, the neurotransmission is serotonergic neurotransmission. In some embodiments, the serotonergic neurotransmission does not include significant activity (e.g., agonism) at the serotonin 2A (5-HT2A) receptor.

[0326] In some aspects, methods for treating a health condition are provided, which include administering to a patient an effective amount of the disclosed extract, compound, or pharmaceutical composition. In some embodiments, the health condition is a mental health disorder. In some embodiments, the mental health disorder is selected from depression, dysthymia, anxiety and phobic disorders, generalized anxiety disorder, social anxiety disorder, panic disorder, posttraumatic stress disorder, adjustment disorder, feeding and eating disorders, binge eating disorder, bulimia nervosa, and anorexia nervosa, other binge eating behaviors, body dysmorphic syndrome, alcoholism, tobacco abuse, substance abuse or dependence disorders, disruptive behavior disorders, impulse control disorders, gaming disorder, gambling disorder, memory loss, senile dementia, attention deficit hyperactivity disorder, personality disorders, antisocial personality disorder, avoidant personality disorder, borderline personality disorder, histrionic personality disorder, narcissistic personality disorder, obsessive-compulsive disorder, paranoid personality disorder, schizoid personality disorder, schizotypal personality disorder, attachment disorders, autism, and dissociative disorders. In some embodiments, the mental health disorder is an anxiety disorder. In some embodiments, the anxiety disorder is any one of acute stress disorder, anxiety due to a medical condition, generalized anxiety disorder, panic disorder, panic attack, phobias, posttraumatic stress disorder (PTSD), separation anxiety disorder, social anxiety disorder, substance-induced anxiety disorder, and selective mutism. In some embodiments, the mental health disorder is a substance use disorder. In some embodiments, the substance use disorder is any one of alcohol use disorder, cannabis use disorder, hallucinogen use disorder, inhalant use disorder, opioid use disorder, sedative use disorder, stimulant use disorder, tobacco use disorder, and nicotine use disorder. In some embodiments, the mental health disorder is a behavioral addiction. In some embodiments, the behavioral addiction is selected from gambling disorder, gaming disorder, sexual addiction, compulsive buying disorder, and technology addiction. In some embodiments, the health condition is a sleep disorder. In some embodiments, the sleep disorder is any one of insomnia, hypersomnia, parasomnia, and sleep-wake schedule disorder.

[0327] In some embodiments, the health disorder is a physical health disorder. In some embodiments, the physical health disorder is a pain disorder. In some embodiments, the pain disorder is any one of arthritis, abnormal pain, atypical trigeminal neuralgia, trigeminal neuralgia, somatoform disorder, hypoesthesia, hyperalgesia, neuralgia, heuritic inflammation, neuropathic pain, analgesia, narcotic dolomite, burning pain, sciatica pain disorder, degenerative joint disorder, fibromyalgia, visceral disease, chronic pain disorder, migraine / headache, chronic fatigue syndrome, complex regional pain syndrome, dystrophy, plantar fasciitis, or cancer-related pain. In some embodiments, the physical health condition is a condition that causes acute inflammation or exhibits chronic inflammation as a symptom.

[0328] In some embodiments, the physical health disorder is an autoimmune disorder. In some embodiments, the autoimmune disorder is acute disseminated encephalomyelitis (ADEM), Addison's disease, allergy or hypersensitivity, amyotrophic lateral sclerosis, antiphospholipid antibody syndrome (APS), arthritis, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune pancreatitis, bullous pemphigoid, celiac disease, Chagas disease, chronic obstructive pulmonary disease (COPD), type 1 diabetes (T1D), endometriosis, fibromyalgia, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome (GBS), Hashimoto's thyroiditis, pyogenic spondylitis, idiopathic thrombocytopenic purpura, inflammatory bowel disease, interstitial cystitis, lupus, including discoid lupus erythematosus and systemic lupus erythematosus; morphea, multiple sclerosis (MS), myasthenia gravis, myopathy, narcolepsy, neuromyotonia, pemphigus vulgaris, pernicious anemia, primary biliary cirrhosis, recurrent disseminated encephalomyelitis, including multiphasic disseminated encephalomyelitis, rheumatic fever, schizophrenia, scleroderma, Sjögren's syndrome, tendinitis, vasculitis, and vitiligo. In some embodiments, the autoimmune disorder is a systemic autoimmune disorder, including systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis, and polymyositis. In embodiments, the autoimmune disorder is a local autoimmune disorder, including disorders of the endocrine system, including type 1 diabetes, Hashimoto's thyroiditis, and Addison's disease; skin disorders, including pemphigus vulgaris; blood disorders, including autoimmune hemolytic anemia; and nervous system disorders, including multiple sclerosis.

[0329] In some forms, provided are methods of improving health conditions using the disclosed extracts, which include administering to a subject an effective amount of the extract, compound, or composition. In some embodiments, the improvement in the health condition is a reduction in stress. In some embodiments, the improvement in health and wellness is a relief of muscle tension. In some embodiments, the improvement in health and wellness is the promotion of restorative sleep. In some embodiments, the improvement in health and wellness is any one of the soothing of the body, the calming of the mind, and the reduction of physical pain. In some embodiments, the improvement in health and wellness includes any one or more of the following: a reduction in feelings of tension, "jitters", nervousness, or anxiety; a reduction in feelings of discomfort, unhappiness, existential anxiety, revulsion, and general dissatisfaction; and an increase in feelings of happiness, wellness, relaxation, contentment, pleasure, openness to experience, and life satisfaction. In some forms, provided are methods of inducing euphoria using the disclosed extracts, compounds, or compositions, which include administering to an individual an effective amount of the extract, compound, or composition.

[0330] According to one embodiment of the present invention, the genetically modified fungus can be prepared in the form of a liquid solution, liquid suspension, tincture, beverage concentrate or beverage for ingestion, for example, for the above purposes. According to another embodiment of the present invention, the genetically modified fungus extract can be prepared in the form of tablets, capsules, softgels and soft capsules for ingestion, for the above purposes. According to another embodiment of the present invention, the genetically modified fungus extract can be prepared in the form of creams, ointments, gels, foams and liquid compositions for topical application, for example, for transdermal application to relieve pain, itching and inflammation, and to moisturize, rejuvenate and provide immunomodulation to the skin and nearby tissues.

[0331] In some embodiments, the disclosed genetically modified fungus is grown in an industrial mushroom growing house. In some embodiments, the disclosed genetically modified fungus is grown in a consumer-friendly kit. In some embodiments, the disclosed genetically modified fungus is grown in a bioreactor, which can be of consumer, commercial or industrial size. In some embodiments, the disclosed genetically modified fungus is grown in culture, for example on a growth medium or culture medium.

[0332] In some embodiments, the disclosed genetically modified fungus is supplemented with factors during the growth phase to increase the activity of specific biosynthetic pathways. In some embodiments, the disclosed genetically modified fungus is supplemented with factors during the growth phase to increase the production of specific compounds.

[0333] In some embodiments, genetically modifying a fungus that produces bioactive alkaloids prevents the production of bioactive alkaloids from the mycelium and the above-ground fruiting bodies (cap and stalk) of the fungus. For example, in some fungal species, both the fruiting bodies and the mycelium naturally produce psilocybin. For example, in Psilocybe samuiensis, the dried caps of the mushroom contain the most psilocybin, approximately 0.23%-0.90%, and the mycelium contains approximately 0.24%-0.32%. Both the mushroom caps and the mycelium contain phytologically active compounds as well as psilocybin. According to an example of the present disclosure, knocking out the production of psilocybin from P. samuiensis thus ensures that extracts from both the caps and the mycelium lack psilocybin and thus lack hallucinogenic properties.

[0334] In some embodiments, genetic modification of a fungus that produces a bioactive alkaloid can prevent the production of the bioactive alkaloid. The genetically modified fungus thus bioconverts an added substrate into a desired non-hallucinogenic pharmaceutical product. This can be done on any scale, including experimental biosynthesis in mycelia or fruiting bodies or by mycelia in bioreactor production. For precedent with intact fungi without genetic modification, see, e.g., Gartz, J. 1989. Biotransformation of Tryptamine Derivatives in Mycelial Cultures of Psilocybe. J Basic Microbiol. 29(6):347-52. Wolfgang Hüttel, Dirk Hoffmeister. 2010. Fungal Transformations in Pharmaceutical Sciences. In Industrial Applications, edited by Martin Hofrichter, 293-317. The Mycota. Springer Berlin, Heidelberg.

[0335] Example

[0336] The following exemplary and prophetic embodiments are included for illustrative purposes only and are not intended to limit the scope of the invention or any of its embodiments.

[0337] Example 1: Gene inactivation of the psilocybin biosynthesis pathway using CRISPR-Cas9

[0338] Deletion of a target gene in Psilocybe mushrooms can be achieved by using a CRISPR genome editing method based on the use of RNA-guided DNA endonucleases. There are several alternative pathways for implementing the CRISPR genome editing method. Similarly, there are several alternative RNA-guided DNA endonucleases (e.g., Cas9, Cpfl, and MAD7), which in some embodiments are used in conjunction with the CRISPR genome editing method.

[0339] In some embodiments, the RNA-guided DNA endonuclease is delivered into cells as a plasmid expressing the endonuclease. In some embodiments, the RNA-guided DNA endonuclease is delivered directly into cells as a protein. Without being bound by theory, the RNA-guided DNA endonuclease requires a target-specific guide RNA (gRNA) to create a double-strand break into the genomic target or locus. In some embodiments, the gRNA is delivered as a plasmid expressing the gRNA. In some embodiments, the gRNA is delivered directly as a chemically synthesized gRNA. (See, e.g., Qin et al., CRISPR-Cas9 assisted gene disruption in the higher fungus Ganoderma species, Process Biochemistry, vol. 56, 2017, Pages 57-61).

[0340] In some embodiments, the CRISPR genome editing method is a type II CRISPR / Cas9 system. Two components are typically used in the type II CRISPR / Cas9 system: a functional Cas9 nuclease and a chimeric guide RNA (gRNA) consisting of two regions, a CRISPR RNA (crRNA) with a 20-nucleotide target recognition sequence at the 5'-end and a trans-activating crRNA (tracrRNA) for Cas9 binding. The crRNA is user-defined to match a target genomic locus, such as one or more genes (PsiD, PsiH, PsiM, and PsiK) of the psilocybin biosynthetic pathway. It guides the gRNA to form an RNA / DNA hybrid at the target genomic locus and recruits the Cas9 nuclease to generate a DNA DSB (double-strand break).

[0341] There are several promoters available for driving gRNA transcription. Common examples known in the art include the RNA polymerase II (Pol II) promoter of A. niger, the U6 promoter - RNA polymerase III (Pol III) promoter of A. Oryzae, the U3 promoter of A. fumigatus, and the transfer RNA (tRNA) promoter. (See Song et al., Efficient genome editing using tRNA promoter-driven CRISPR / Cas9 gRNA in Aspergillus niger, 2018, PLoS ONE 13(8):e0202868.).

[0342] An alternative to expressing the Cas9 gene and sgRNA is to use a preassembled RNP complex of Cas9 protein and in vitro transcribed sgRNA 30,31. In fungi, this method has been applied to several yeasts and multicellular ascomycetes, including various Aspergillus species, Penicillium chrysogenum, and Cryptococcus neoformans (see Woo, J.W. et al. DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat. Biotechnol. 33, 1162-1164 (2015); Grahl, et al., Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere 2, e00218-17 (2017); Kiel, J.A. et al., CRISPR / Cas9 Based Genome Editing of Penicillium chrysogenum. ACS Synth. Biol. 5, 754-764 (2016) and Wang, Y. et al. A ‘suicide’ CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans. Sci. Rep. 6, 31145 (2016)).

[0343] Gene replacement can also be used to knock out one, two, three, or all four of the PsiD, PsiM, PsiK, and PsiH genes. The protocol can be carried out as described in the following: Lax et al., Stable and reproducible homologous recombination enables CRISPR-based engineering in the fungus Rhizopus microspores, Cell Reports Methods, vol. 1, Issue 8, 20 Dec. 2021, 100124. Lax et al., Transformation and CRISPR-Cas9-mediated homologous recombination in the fungus Rhizopus microspores, Cell Reports Methods, vol. 3, Issue 1, 18 March 2022, 101237, which describe the stable, targeted integration of DNA templates via homologous recombination (HR) using CRISPR-Cas9 technology.

[0344] Cultivation of Psilocybe mushrooms

[0345] The Psilocybe carpophore grows in a basal medium from a small agar inoculum at 30 °C. For solid culture, the medium is supplemented with 1.5% agar. For phenotypic characterization, the strains are grown at 25 °C in a 16 / 8 h day / night cycle for 7 days. The periphery of actively growing colonies on solid cultures and the mycelia from shake flask cultures are used for protoplast isolation. The mycelial cells are then treated with two kinds of lysozymes, Novozym 234 or lywallzyme, to produce protoplasts. (See Jyun-De Wu et al., 2019, Optimization of Protoplast Preparation and Regeneration of a Medicinal Fungus Antrodia cinnamomea, Mycobiology, 47:4, 483-493). If desired, the protoplasts thus prepared can be cryopreserved according to the protocol taught, for example, in Sugano SS et al. Genome editing in the mushroom-forming basidiomycete Coprinopsis cinerea, optimized by a high-throughput transformation system. Sci Rep. 2017 Apr 28;7(1):1260.doi:10.1038 / s41598-017-00883-5, which is incorporated herein by reference in its entirety. The protoplasts thus prepared are used for transformation allowing the introduction of CRISPR-Cas9 gene editing components.

[0346] Design and synthesis of gene-specific sgRNAs for gene disruption

[0347] The coding regions of genes involved in the psilocybin biosynthetic pathway (PsiD, PsiH, PsiK, and PsiM) were screened for candidate protospacers (including PAM sites) using the CCtop program (see Stemmer et al., CCTop: An Intuitive, Flexible and Reliable CRISPR / Cas9 Target Prediction Tool, Plos One, 24 Apr 2015, 10(4):e0124633). Candidates were then examined against the whole genome of the Psilocybe fungus to identify potential off-target regions. Two sgRNAs were selected for each targeted gene based on minimal off-targets and the presence of one or more guanines at the start of the sgRNA, as this facilitates high yields of in vitro T7 transcription. The selected sgRNAs were synthesized in vitro according to the specifications of the GeneArt Precision sgRNA Synthesis Kit (ThermoFisher Scientific, USA).

[0348] Design of repair templates for homologous recombination

[0349] The psi deletion vector was used as a template for homologous recombination. See Ohm et al., Transcription factor genes of Schizophyllum commune involved in regulation of mushroom formation. Mol. Microbiol. 81, 1433-1445 (2011). The plasmid contains a nourseothricin resistance cassette flanked by 1200 bp homologous arms outside the desired target gene. In addition, the plasmid contains a phleomycin resistance cassette that is only integrated when the plasmid integrates by single crossover (i.e., ectopic integration). Linear templates with reduced homologous arm lengths (approx. 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp) were prepared on the intact vector by PCR. Primers were designed to bind 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp outside the nourseothricin resistance cassette.

[0350] Transformation

[0351] Protoplasts were prepared as described above and stored at -80 °C until use. 20 μg of Cas9 was mixed with two sgRNAs (2 μg each) targeting the gene of interest (Psi D or Psi H or Psi K or Psi M), resulting in a 2:1:1 molar ratio of Cas9, sgRNA 1, and sgRNA 2 in 1x Cas9 buffer (20 mM HEPES, 100 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, pH 6.5). 12.5 μg of a repair template containing the nourseothricin resistance cassette was added. (See Vonk et al., High-thumputure targeted gene deletion in the model mushromulus schizophyllum commune using pre-assembly Cas9 ribonucleoproteins, Scientific reports vol.9, no.7632 (2019)). In the negative control, Cas9 was replaced with dialysis buffer and sgRNA was replaced with MilliQ water. Cas9 and sgRNA were pre-assembled at 37 °C for 10 minutes. The regenerated protoplasts were plated on agar medium supplemented with nourseothricin and grown for 3 days. (See Ohm et al., An efficiency gene deletion procedure for the mulhoush-forming basidiomycete schizophyllum commune, World J Microbiol & Biotechnol. Vol.26, pp.1919-1923 (2010).)

[0352] Three days later, colonies were randomly selected from each transformation, subcultured in phleomycin selection medium, and then plated onto agar plates supplemented with nourseothricin and phleomycin. DNA was isolated from a single culture in 50 μl of TE buffer (10 mM Tris pH8.0, 1 mM EDTA) for PCR verification using primers. The size of the DNA band was used to determine whether the gene of interest (PsiD, PsiH, PsiK, and PsiM) had been replaced by the nourseothricin resistance cassette.

[0353] If additional genes are to be inactivated, the same process can be repeated in a sequential manner using different antibiotic selection cassettes in repair plasmids (amphotericin B, chloramphenicol, leucomycin B, etc.). The same process can be carried out in a multiplex manner using different repair plasmids containing different antibiotic resistance markers for each gene of interest to be inactivated. The resulting colonies can be screened by growing them in media supplemented with the corresponding antibiotics and then verified by using PCR or sequencing.

[0354] Similarly, by using sequence alignments of genes of interest across species (PsiD, PsiH, PsiK, and PsiM) to identify consensus regions for targeting, the same process can be extended to multiple species of Psilocybe mushrooms. Thus, the guide sequences for each gene can be determined by targeting the gene portions that fall under the consensus sequence. For example, the gene sequences of PsiD from several species of Psilocybe can be aligned using a software program such as Clustal (at www.clustal.org), e.g., ClustalW, to identify the consensus region; sgRNAs are designed on a computer using similar or known software to target the consensus sequence in order to knock out PsiD expression in several species of Psilocybe mushrooms.

[0355] a. Inactivation of the PsiD gene using CRISPR-Cas9

[0356] Two sgRNAs specific to the PsiD gene are designed on a computer using the computational program as above. The sgRNA sequences are given below, and any one of them can be used for knockout. Exemplary CRISPR oligonucleotides for PsiD knockout Acid:

[0357] SEQ ID NO:13 CRISPRPsiD knockout 5’GGTGATACCCGCGTGCAACTCGG-3’ SEQ ID NO:14 ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0358] Protoplasts of Psilocybe species are prepared as above. As described previously, two sgRNAs (2 μg of each sgRNA) are transformed into the protoplasts. The transformed protoplasts are plated. Colonies are selected and screened for antibiotic resistance markers, and then PCR sequencing is performed to verify the deletion of the PsiD gene.

[0359] ​

[0360] Two sgRNAs specific to the PSiH gene are designed on a computer using the computational program as above. The sgRNA sequences are given below, and any one of them can be used for knockout. [[ID=2?]] ​ ​

[0361] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0362] Prepare the protoplasts of Psilocybe species as described above. As previously described, transform two sgRNAs (2 μg of each sgRNA) into the protoplasts. Plate the transformed protoplasts. Select colonies and screen for antibiotic resistance markers, and then perform PCR sequencing to verify the deletion of the PsiH gene.

[0363] c. Inactivate the PsiM gene using CRISPR-Cas9

[0364] Design two sgRNAs specific for the PSiM gene on a computer using the computational program described above. The sgRNA sequences are given below, and any one of them can be used for knockout. Exemplary CRISPR oligonucleotides for PsiM knockout Nucleotides:

[0365] SEQ ID NO:22 CRISPRPsiM knockout 5’TGACTATCAAGCACTTTCAGAGG-3’ SEQ ID NO:23 CRISPRPsiM knockout 5’TTTGTGTCTGTCAATGCAGATGG-3’ SEQ ID NO:24 CRISPRPsiM knockout 5’CACTATCCCAGAAGCCCAGAGGG-3’ SEQ ID NO:25 CRISPRPsiM knockout 5’GCTCTTCTTCATCGTGACTTCGGG-3’ SEQ ID NO:26 CRISPRPsiM knockout 5’GTCTGTGCCCAACAGTCCCCAATAGG-3’

[0366] Prepare the protoplasts of Psilocybe species as described above. As previously described, transform two sgRNAs (2 μg of each sgRNA) into the protoplasts. Plate the transformed protoplasts. Select colonies and screen for antibiotic resistance markers, and then perform PCR sequencing to verify the deletion of the PsiM gene.

[0367] d. Inactivate the PsiK gene using CRISPR-Cas9

[0368] Design two sgRNAs specific for the PsiK gene on a computer using the computational program as above. The sgRNA sequences are given below, and any one of them can be used for knockout. Exemplary CRISPR oligonucleotides for PsiK knockout Acids:

[0369] SEQ ID NO:18 CRISPRPsiK knockout 5’GTTCGATCTCAAGACTGAAGACGG-3’ SEQ ID NO:19 CRISPRPsiK knockout 5’TCTTTGGACGTCGACACGAGCGG-3’ SEQ ID NO:20 CRISPRPsiK knockout 5’GAGGCTTTGTCAATGTAACCTGG-3’ SEQ ID NO:21 CRISPRPsiK knockout 5’GCATGCTCAGCCGCACATGTCTACGG-3’

[0370] Prepare the protoplasts of Psilocybe species as described above. As previously described, transform two sgRNAs (2 μg of each sgRNA) into the protoplasts. Plate the transformed protoplasts. Select colonies and screen for antibiotic resistance markers, and then perform PCR sequencing to verify the deletion of the PsiK gene.

[0371] e. Inactivate the PsiD and PsiH genes using CRISPR-Cas9

[0372] Use four sgRNAs, two sgRNAs specific for the PsiD gene and two sgRNAs specific for the PsiH gene, which are designed on a computer using the computational program as above. The sequences of the sgRNAs are given above. Any one of the sequences represented by SEQ ID NO: 13 - 17 can be used for PsiD gene inactivation, and any one of the sequences represented by SEQ ID NO: 27 - 31 can be used for PsiH gene inactivation.

[0373] Prepare protoplasts of the Psilocybe species as described above. As previously described, four sgRNAs (2 μg of each sgRNA) were simultaneously transformed into the protoplasts. The transformed protoplasts were plated. Colonies were selected and screened for the presence of two antibiotic resistance markers (one for each gene to be knocked out), and then PCR sequencing was performed to verify the deletion of the PsiH and PsiD genes.

[0374] f. Inactivate the PsiD and PsiM genes using CRISPR-Cas9

[0375] Four sgRNAs were used, two sgRNAs were specific for the PsiD gene and two sgRNAs were specific for the PsiM gene, which were designed on a computer using the above-described computational program. The sequences of the sgRNAs are given below. Any of the sequences represented by SEQ ID NOs: 13 - 17 can be used for PsiD gene inactivation, and any of the sequences represented by SEQ ID NOs: 22 - 26 can be used for PsiM gene inactivation.

[0376] Prepare protoplasts of the Psilocybe species as described above. As previously described, four sgRNAs (2 μg of each sgRNA) were simultaneously transformed into the protoplasts. The transformed protoplasts were plated. Colonies were selected and screened for the presence of two antibiotic resistance markers (one for each gene to be knocked out), and then PCR sequencing was performed to verify the deletion of the PsiD and PsiM genes.

[0377] g. Inactivate the PsiH and PsiK genes using CRISPR-Cas9

[0378] Four sgRNAs were used, two sgRNAs were specific for the PsiH gene and two sgRNAs were specific for the PsiK gene, which were designed on a computer using the above-described computational program. The sequences of the sgRNAs are given above. Any of the sequences represented by SEQ ID NOs: 18 - 21 can be used for PsiK gene inactivation, and any of the sequences represented by SEQ ID NOs: 27 - 31 can be used for PsiH gene inactivation.

[0379] Prepare protoplasts of the Psilocybe species as described above. As previously described, four sgRNAs (2 μg of each sgRNA) were simultaneously transformed into the protoplasts. The transformed protoplasts were plated. Colonies were selected and screened for the presence of two antibiotic resistance markers (one for each knocked-out gene), and then PCR sequencing was performed to verify the deletion of the PsiH and PsiK genes.

[0380] h. Inactivate the PsiH and PsiM genes using CRISPR-Cas9

[0381] Four sgRNAs are used, two sgRNAs are specific for the PsiH gene and two sgRNAs are specific for the PsiM gene, which are designed on a computer using the above-described computational program. The sequences of the sgRNAs are given above. Any of the sequences represented by SEQ ID NO: 22-26 can be used for PsiM gene inactivation, and any of the sequences represented by SEQ ID NO: 27-31 can be used for PsiH gene inactivation.

[0382] Protoplasts of the Psilocybe species are prepared as above. As described previously, four sgRNAs (2 μg of each sgRNA) are simultaneously transformed into the protoplasts. The transformed protoplasts are plated. Colonies are selected and screened for the presence of two antibiotic resistance markers (one for each gene to be knocked out), and then PCR sequencing is performed to verify the deletion of the PsiH and PsiM genes.

[0383] i. Inactivate the PsiK and PsiM genes using CRISPR-Cas9

[0384] Four sgRNAs are used, two sgRNAs are specific for the PsiK gene and two sgRNAs are specific for the PsiM gene, which are designed on a computer using the above-described computational program. The sequences of the sgRNAs are given above. Any of the sequences represented by SEQ ID NO: 18-21 can be used for PsiK gene inactivation, and any of the sequences represented by SEQ ID NO: 22-26 can be used for PsiM gene inactivation.

[0385] Protoplasts of the Psilocybe species are prepared as above. As described previously, four sgRNAs (2 μg of each sgRNA) are simultaneously transformed into the protoplasts. The transformed protoplasts are plated. Colonies are selected and screened for the presence of two antibiotic resistance markers (one for each gene to be knocked out), and then PCR sequencing is performed to verify the deletion of the PsiK and PsiM genes.

[0386] j. Inactivate the PsiD and PsiK genes using CRISPR-Cas9

[0387] Four sgRNAs are used, two sgRNAs are specific for the PsiD gene and two sgRNAs are specific for the PsiK gene, which are designed on a computer using the above-described computational program. The sequences of the sgRNAs are given above. Any of the sequences represented by SEQ ID NO: 18-21 can be used for PsiK gene inactivation, and any of the sequences represented by SEQ ID NO: 13-17 can be used for PsiD gene inactivation.

[0388] Prepare protoplasts of the Psilocybe species as described above. As previously described, four sgRNAs (2 μg of each sgRNA) were simultaneously transformed into the protoplasts. The transformed protoplasts were plated. Colonies were selected and screened for the presence of two antibiotic resistance markers (one for each gene to be knocked out), and then PCR sequencing was performed to verify the deletion of the PsiD and PsiK genes.

[0389] k. Inactivate the PsiD, PsiH and PsiK genes using CRISPR-Cas9

[0390] Six sgRNAs were used, two sgRNAs were specific for the PsiD gene, two sgRNAs were specific for the PsiH gene, and two sgRNAs were specific for the PsiK gene, which were designed on a computer using the above-described computational program. The sequences of the sgRNAs are given above. Any of the sequences represented by SEQ ID NO: 18-21 can be used for PsiK gene inactivation, any of the sequences represented by SEQ ID NO: 27-31 can be used for PsiH gene inactivation, and any of the sequences represented by SEQ ID NO: 13-17 can be used for PsiD gene inactivation.

[0391] Prepare protoplasts of the Psilocybe species as described above. As previously described, six sgRNAs (2 μg of each sgRNA) were simultaneously transformed into the protoplasts. The transformed protoplasts were plated. Colonies were selected and screened for the presence of three antibiotic resistance markers (one for each gene to be knocked out), and then PCR sequencing was performed to verify the deletion of the PsiD, PsiH, and PsiK genes.

[0392] l. Inactivate the PsiH, PsiK and PsiM genes using CRISPR-Cas9

[0393] Six sgRNAs were used, two sgRNAs were specific for the PsiH gene, two sgRNAs were specific for the PsiK gene, and two sgRNAs were specific for the PsiM gene, which were designed on a computer using the above-described computational program. The sequences of the sgRNAs are given above. Any of the sequences represented by SEQ ID NO: 18-21 can be used for PsiK gene inactivation, any of the sequences represented by SEQ ID NO: 27-31 can be used for PsiH gene inactivation, and any of the sequences represented by SEQ ID NO: 22-26 can be used for PsiM gene inactivation.

[0394] Prepare protoplasts of the Psilocybe species as described above. As previously described, six sgRNAs (2 μg of each sgRNA) were simultaneously transformed into the protoplasts. The transformed protoplasts were plated. Colonies were selected and screened for the presence of three antibiotic resistance markers (one for each gene to be knocked out), and then PCR sequencing was performed to verify the deletion of the PsiH, PsiK, and PsiM genes.

[0395] m. Inactivate the PsiK, PsiM and PsiD genes using CRISPR-Cas9

[0396] Six sgRNAs are used, two sgRNAs are specific for the PsiK gene, two sgRNAs are specific for the PsiM gene, and two sgRNAs are specific for the PsiD gene, and they are designed on a computer using the above computational program. The sequences of the sgRNAs are given above. Any one of the sequences represented by SEQ ID NO: 18 - 21 can be used for PsiK gene inactivation, any one of the sequences represented by SEQ ID NO: 13 - 17 can be used for PsiD gene inactivation, and any one of the sequences represented by SEQ ID NO: 22 - 26 can be used for PsiM gene inactivation.

[0397] Protoplasts of the Psilocybe species are prepared as above. As described above, six sgRNAs (2 μg of each sgRNA) are simultaneously transformed into the protoplasts. The transformed protoplasts are plated. Colonies are selected and screened for the presence of three antibiotic resistance markers (one for each knockout gene), and then PCR sequencing is performed to verify the deletion of the PsiK, PsiD, and PsiM genes.

[0398] n. Inactivate the PsiD, PsiH, PsiK and PsiM genes using CRISPR-Cas9

[0399] Eight sgRNAs are used, two sgRNAs are specific for the PsiD gene, two sgRNAs are specific for the PsiH gene, two sgRNAs are specific for the PsiK gene, and two sgRNAs are specific for the PsiM gene, and they are designed on a computer using the above computational program. Any one of the sequences represented by SEQ ID NO: 18 - 21 can be used for PsiK gene inactivation, any one of the sequences represented by SEQ ID NO: 27 - 31 can be used for PsiH gene inactivation, any one of the sequences represented by SEQ ID NO: 22 - 26 can be used for PsiM gene inactivation, and any one of the sequences represented by SEQ ID NO: 13 - 17 can be used for PsiD gene inactivation.

[0400] Protoplasts of the Psilocybe species are prepared as above. As described above, eight sgRNAs (2 μg of each sgRNA) are simultaneously transformed into the protoplasts. The transformed protoplasts are plated. Colonies are selected and screened for the presence of four antibiotic resistance markers (one for each knocked - out gene), and then PCR sequencing is performed to verify the deletion of the PsiK, PsiH, PsiM, and PsiD genes.

[0401] Example 2: Gene inactivation of the psilocybin pathway in mushrooms using siRNA

[0402] Double-stranded RNA (dsRNA), which is transcribed from cellular genes or infecting pathogens or artificially introduced into cells, is processed in the cytoplasm by a special ribonuclease (RNase) III-like enzyme called Dicer into smaller dsRNA molecules. Such short dsRNA molecules are called siRNAs, which have 21-23 nucleotides and have 3'-two-nucleotide overhangs. The siRNAs interact with the RNA-induced silencing complex (RISC) and activate the RISC. The endonuclease argonaute 2 (AGO2) component of the RISC cleaves the passenger strand (sense strand) of the siRNA, while the guide strand (antisense strand) remains associated with the RISC. Subsequently, the guide strand directs the active RISC to its target mRNA for cleavage by AGO2. Since the guide strand binds only to the mRNA that is completely complementary to it, siRNAs cause specific gene silencing. The psilocybin biosynthetic pathway can be blocked by using siRNAs, which in turn can silence genes necessary for psilocybin production such as PsiD, PsiK, PSiM, and PsiH.

[0403] Synthetic siRNA target candidates designed using the computer methods described elsewhere (see Chaudhary et al., Development of a software tool and criteria evaluation for efficient design of small interfering RNA, Biochem Biophys Res Commun, 404 (2011), pp. 313 - 320; Zhong et al., Computational detection and suppression of sequence - specific off - target phenotypes from whole genome RNAi screens Nucleic Acids Res, 42 (2014), pp. 8214 - 8222; Naito et al., siRNA design software for a target gene - specific RNA interference, Front. Genet., 11 June 2012) were transformed into the protoplasts of Psilocybe mushrooms according to the protocol disclosed in Example 1. Initial experiments were performed using Cy3 - labeled siRNA molecules to test the uptake of siRNA molecules targeting the target genes (PsiD, PsiM, PsiK, and PsiH) by the protoplasts. Subsequently, unlabeled siRNA was used for subsequent experiments. Controls were generated using protoplasts treated with irrelevant siRNA and cultures without added siRNA. The supernatant (0.5 ml) of the miRNA - treated cultures and control cultures was sampled regularly and tested for the presence of psilocybin using Keller's reagent (glacial acetic acid containing ferric chloride and concentrated sulfuric acid). Psilocybe cultures in which psilocybin production has been silenced by miRNA candidates will not show a clear blue or purple Keller reaction, while cultures that are controls with irrelevant miRNAs or untreated cultures will show the presence of blue, indicating the presence of psilocybin.

[0404] a. Inactivate the PsiD gene using siRNA

[0405] The siRNA specific for the PsiD gene was designed on a computer using the computational program as described above. The sequences of the siRNA candidates are shown below.

[0406] Exemplary siRNA oligonucleotides for PsiD inactivation:

[0407]

[0408] Prepare protoplasts of the Psilocybe species as described above. As previously described, transform the siRNA into the protoplasts. Plate the transformed protoplasts. Randomly select colonies and subculture them. Sample the cultures at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that do not exhibit an obvious blue or purple reaction are identified as cultures in which the production of psilocybin has been silenced. b. Inactivate the PsiH gene using siRNA

[0409] Design siRNA specific to the PSiH gene on a computer using the computational program described above. The sequences of the siRNA candidates are shown below.

[0410] Exemplary siRNA oligonucleotides for PsiK inactivation:

[0411]

[0412] Prepare protoplasts of the Psilocybe species as described above. As previously described, transform the siRNA into the protoplasts. Plate the transformed protoplasts. Randomly select colonies and subculture them. Sample the cultures at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that do not exhibit an obvious blue or purple reaction are identified as cultures in which the production of psilocybin has been silenced. c. Inactivate the PsiM gene using siRNA

[0413] Design siRNA specific to the PSiM gene on a computer using the computational program described above. The sequences of the siRNA candidates are shown below.

[0414] Exemplary siRNA oligonucleotides for PsiM:

[0415]

[0416] Prepare protoplasts of the Psilocybe species as described above. As previously described, transform the siRNA into the protoplasts. Plate the transformed protoplasts. Randomly select colonies and subculture them. Sample the cultures at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that do not exhibit an obvious blue or purple reaction are identified as cultures in which the production of psilocybin has been silenced. d. Inactivating the PsiK gene using siRNA

[0417] Design siRNA specific to the PsiK gene on a computer using the computational program described above. The sequences of the siRNA candidates are shown below.

[0418] Exemplary siRNA oligonucleotides for PsiH:

[0419]

[0420]

[0421] Protoplasts of the Psilocybe species were prepared as above. As described previously, siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not exhibit an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. e. Inactivating the PsiD and PsiH genes using siRNA

[0422] Using two different siRNAs, siRNAs specific for the PsiD gene and siRNAs specific for the PsiH gene were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO: 52 - 56 can be used for PsiD gene inactivation, and any of the sequences represented by SEQ ID NO: 67 - 71 can be used for PsiH gene inactivation.

[0423] Protoplasts of the Psilocybe species were prepared as above. As described previously, siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals using the Keller reaction to check for the presence of psilocybin. Cultures that did not exhibit an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced.

[0424] f. Inactivating the PsiD and PsiM genes using siRNA

[0425] Using two different siRNAs, siRNAs specific for the PsiD gene and siRNAs specific for the PsiM gene were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO: 52 - 56 can be used for PsiD gene inactivation, and any of the sequences represented by SEQ ID NO: 62 - 66 can be used for PsiM gene inactivation.

[0426] Protoplasts of the Psilocybe species were prepared as above. As described previously, siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not exhibit an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. g. Inactivating the PsiH and PsiK genes using siRNA

[0427] Two different siRNAs were used. siRNAs specific for the PsiH gene and specific for PsiK were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO:57 - 59, 61 can be used for PsiK gene inactivation, and any of the sequences represented by SEQ ID NO:67 - 71 can be used for PsiH gene inactivation.

[0428] Protoplasts of the Psilocybe species were prepared as described above. As previously described, the siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not show an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. h. Inactivating the PsiH and PsiM genes using siRNA

[0429] Two different siRNAs were used. siRNAs specific for the PsiH gene and specific for PsiM were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO:62 - 66 can be used for PsiM gene inactivation, and any of the sequences represented by SEQ ID NO:67 - 71 can be used for PsiH gene inactivation.

[0430] Protoplasts of the Psilocybe species were prepared as described above. As previously described, the siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not show an obvious blue or purple reaction were determined to be cultures in which the production of psilocybin was silenced. i. Inactivating the PsiK and PsiM genes using siRNA

[0431] Two different siRNAs were used. siRNAs specific for the PsiK gene and specific for PsiM were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO:62 - 66 can be used for PsiM gene inactivation, and any of the sequences represented by SEQ ID NO:57 - 59, 61 can be used for PsiK gene inactivation.

[0432] Protoplasts of the Psilocybe species were prepared as above. As described previously, siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not show an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. j. Inactivating the PsiD and PsiK genes using siRNA

[0433] Using two different siRNAs, siRNAs specific for the PsiD gene and siRNAs specific for PsiK were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO: 52 - 56 can be used for PsiD gene inactivation, and any of the sequences represented by SEQ ID NO: 57 - 59, 61 can be used for PsiK gene inactivation.

[0434] Protoplasts of the Psilocybe species were prepared as above. As described previously, siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not show an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. k. Inactivating the PsiD, PsiH and PsiK genes using siRNA

[0435] Using three different siRNAs, siRNAs specific for the PsiD gene, siRNAs specific for the PsiH gene, and siRNAs specific for PsiK were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO: 52 - 56 can be used for PsiD gene inactivation, any of the sequences represented by SEQ ID NO: 67 - 71 can be used for PsiH gene inactivation, and any of the sequences represented by SEQ ID NO: 57 - 59, 61 can be used for PsiK gene inactivation.

[0436] Protoplasts of the Psilocybe species were prepared as above. As described previously, siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not show an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. l. Inactivating the PsiH, PsiK and PsiM genes using siRNA

[0437] Three different siRNAs were used. PsiH gene-specific siRNA, PsiK gene-specific siRNA, and PsiM-specific siRNA were designed on a computer using the computational program described above. The sequences of the siRNA candidates were given above. Any of the sequences represented by SEQ ID NO:62 - 66 can be used for PsiM gene inactivation, any of the sequences represented by SEQ ID NO:67 - 71 can be used for PsiH gene inactivation, and any of the sequences represented by SEQ ID NO:57 - 59, 61 can be used for PsiK gene inactivation.

[0438] Protoplasts of the Psilocybe species were prepared as described above. As previously described, the siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not show an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. m. Inactivating the PsiK, PsiM and PsiD genes using siRNA

[0439] Three different siRNAs were used. PsiK gene-specific siRNA, PsiM gene-specific siRNA, and PsiD-specific siRNA were designed on a computer using the computational program described above. The sequences of the siRNA candidates were given above. Any of the sequences represented by SEQ ID NO:52 - 56 can be used for PsiD gene inactivation, any of the sequences represented by SEQ ID NO:62 - 66 can be used for PsiM gene inactivation, and any of the sequences represented by SEQ ID NO:57 - 59, 61 can be used for PsiK gene inactivation.

[0440] Protoplasts of the Psilocybe species were prepared as described above. As previously described, the siRNA was transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals to check for the presence of psilocybin using the Keller reaction. Cultures that did not show an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced. n. Inactivating the PsiD, PsiH, PsiK and PsiM genes using siRNA

[0441] Four different siRNAs were used. siRNAs specific for the PsiD gene, siRNAs specific for the PsiH gene, siRNAs specific for the PsiK gene, and siRNAs specific for PsiM were designed on a computer using the computational program described above. The sequences of the siRNA candidates are given above. Any of the sequences represented by SEQ ID NO: 52-56 can be used for PsiD gene inactivation, any of the sequences represented by SEQ ID NO: 62-66 can be used for PsiM gene inactivation, any of the sequences represented by SEQ ID NO: 67-71 can be used for PsiH gene inactivation, and any of the sequences represented by SEQ ID NO: 57-59, 61 can be used for PsiK gene inactivation.

[0442] Protoplasts of the Psilocybe species were prepared as described above. As previously described, the siRNAs were transformed into the protoplasts. The transformed protoplasts were plated. Colonies were randomly selected and subcultured. The cultures were sampled at different time intervals using the Keller reaction to check for the presence of psilocybin. Cultures that did not exhibit an obvious blue or purple reaction were identified as cultures in which the production of psilocybin was silenced.

[0443] Example 3: Gene inactivation in the psilocybin pathway in mushrooms using miRNA

[0444] MicroRNA (miRNA) is a class of conserved small non-coding RNAs that assemble with Argonaute proteins into miRNA-induced silencing complexes (miRISCs) to direct the post-transcriptional silencing of complementary mRNA targets. Silencing is accomplished through a combination of translational repression and mRNA destabilization, with the latter contributing to most of the steady-state repression in cell cultures (see Quévillon Huberdeau M, Simard MJ. 2019, A guide to microRNA-mediated gene silencing. FEBS J. 2019 Feb;286(4):642-652.). Degradation of the mRNA target is initiated by deadenylation, followed by decapping and 5'-3' exonucleolytic decay. Degradation of the miRNA target is catalyzed by enzymes involved in the 5'-to-3' mRNA decay pathway. In this pathway, the mRNA is first deadenylated, then decapped, and finally degraded from the 5' end. (See Jonas, S., Izaurralde, E. Towards a molecular understanding of microRNA-mediated gene silencing. Nat Rev Genet. 16, 421-433 (2015).).

[0445] Computer algorithms were applied to predict miRNA targets that bind to and inhibit genes (PsiD, PsiH, PsiM, and PsiK) involved in the psilocybin biosynthetic pathway. Algorithms generally use miRNA sequence annotations obtained from databases such as miRbase. miRNA-target interactions were then predicted based on seed pairing and scored according to other features such as binding free energy and site conservation. (See Witkos et al., (2011) Practical aspects of microRNA target prediction. Curr Mol Med 11, 93-109; Riffo-Campos et al., 2016, Tools for sequence-based miRNA target prediction: what to choose? Int J Mol Sci. 17, pii: E1987.).

[0446] Computer-selected miRNA target candidates that target the psilocybin biosynthetic pathway were then synthesized using commercial vendors such as Dharmacon or Integrated DNA technologies. The miRNA target candidates thus obtained were transformed into protoplasts of Psilocybe mushrooms according to the protocol disclosed in Example 1. Initial experiments were performed using Cy3-labeled miRNA molecules to test the uptake of miRNA molecules targeting the target genes (PsiD, PsiM, PsiK, and PsiH) by the protoplasts. Subsequent experiments were then performed using unlabeled miRNAs. Controls were generated using protoplasts treated with irrelevant miRNAs and cultures without added miRNAs.

[0447] Supernatants (0.5 mL) of both miRNA-treated and control cultures were sampled regularly and tested for the presence of psilocybin using Keller's reagent (glacial acetic acid containing ferric chloride and concentrated sulfuric acid). Psilocybe cultures in which psilocybin production has been silenced by miRNA candidates will not show a clear blue or purple Keller reaction, while cultures that are controls with irrelevant miRNAs or untreated cultures will show the presence of blue, indicating the presence of psilocybin. Cultures that do not show a distinct blue or purple Keller reaction were collected and propagated to produce large numbers of knockout mushrooms for extract preparation.

[0448] Example 4: Genome editing in Psilocybe cubensis, selection of gene disruption

[0449] In this example, stable, fertile, and truly reproductive mushrooms (fruiting bodies and monokaryotic and dikaryotic mycelia) of Psilocybe cubensis (Psicub) are generated by genome editing without producing psilocybin or psilocin. Mushrooms are produced using the strategy of introducing gene editing enzymes described herein that target disruption of the coding frame of the first exon of non-essential PsiK or PsiM psilocybin synthesis genes. To create genetic markers, we simultaneously disrupted the first exon of the essential metabolic genes fsy1 or pyrG for uracil synthesis that are genetically unlinked and that become positive and negative selectable genes when deleted. The mushroom is used for genetic and biochemical analysis of the specialized metabolism of unique natural drug-like molecules such as indoleamine derivatives, including 4-hydroxytryptophan, 4-hydroxytryptamine, β-carbolines such as harmane, and their metabolites. The safety and bioactivity of key metabolites stably produced by the modified mushroom are also identified, as well as means for their genetic and environmental control. All metabolites can be targeted by this method starting from indoleamine derivatives. By implementing this example, a sustainable and medically suitable source of mushroom-derived compounds is generated that can be individually tested for safety and bioactivity for use in cosmetics, nutraceuticals, or food supplements. In some embodiments, the safety and efficacy of a carefully calibrated combination of a standardized extract with purified therapeutic psilocybin or psilocin are tested in clinical trials. The demand for this method is expected to be significant, especially in cases where these molecules are approved for therapeutic use and where therapists and consumers prefer to use whole mushroom products rather than isolated active compounds.

[0450] a. Modification of psilocybin biosynthesis pathway genes

[0451] Inactivation of PsiK and PsiM genes by CRISPR-Cas9 using a single unique crRNA with a common tracrRNA is delivered as an active nuclear-targeting highly specific Cas9 ribonucleoprotein (RNP) complex to protoplasts by polyethylene glycol treatment (PEG - with or without TritonX-100) or electroporation. The RNA will be synthesized by IDT (Integrated DNA Technologies, Coralville, IA, US), which is chemically modified and delivered with the vector DNA recommended by the manufacturer (we have verified that the sequence of this vector DNA has no similarity to any sequence in any publicly available Psicub genome: Fricke, Janis, et al. 2017. “Enzymatic Synthesis of Psilocybin.” Angewandte Chemie 56(40):12352-55, McKernan, Kevin, et al. 2021. “A Whole Genome Atlas of 81 Psilocybe Genomes as a Resource for Psilocybin Production.” f1000 Research, July. doi.org / 10.12688 / f1000research.55301.2). The resulting mono- or dikaryotic homozygous and dikaryotic compound heterozygous loss-of-function strains will be whole-genome sequenced by Oxford Nanopore or Illumina technologies and compared to publicly available whole-genome assemblies (Mycocosm and NCBI: Fricke, J., et al. 2017, “Enzymatic Synthesis of Psilocybin.” Angewandte Chemie 56(40):12352–55; McKernan, Kevin, et al. 2021. “A Whole Genome Atlas of 81 Psilocybe Genomes as a Resource for Psilocybin Production.” f1000 Research, July. doi.org / 10.12688 / f1000research.55301.2) to identify any off-target induced mutations and to identify the recovered genetic variants by polymerase chain reaction (PCR) amplification and Sanger chain-termination DNA sequencing.

[0452] By comparing sequences from JGI Mycocosm (Fricke et.al. 2017) and NCBI GenBank (Boyce G. and Kasson, M.T., Ohio State University, direct submissions MH483013.1, MH483014.1; McKernan, Kevin, et.al. 2021. “A Whole Genome Atlas of 81 Psilocybe Genomes as a Resource for Psilocybin Production.” f1000 Research, July. doi.org / 10.12688 / f1000research.55301.2), the following table of variants in P. cubensis is generated, which, in some embodiments, can be used to determine the success or failure of oligonucleotide-targeted gene editing and gene silencing, PCR analysis of gene modifications, and qRT-PCR analysis of the inhibition of these gene modifications on mRNA, according to the teachings herein and general knowledge in the art.

[0453] The first table below shows intraspecific SNPs and small sequence variants in the P. cubensis PsiK gene by strain; the second table below shows intraspecific variations in the PsiM gene by strain, and the PsiM gene is incorporated into the target oligonucleotide design strain by strain.

[0454] The first table below shows intraspecific SNPs and small sequence variants in the P. cubensis PsiK gene by strain, which are incorporated into the target oligonucleotide design strain by strain:

[0455]

[0456]

[0457] The second table below shows intraspecific variations in the P. cubensis PsiM gene by strain, and the mutations are incorporated into the target oligonucleotide design strain by strain:

[0458]

[0459]

[0460]

[0461] b. Select strains with successful gene editing

[0462] Successful introduction of active and targeted Cas9 is achieved by disrupting the coding exon sequences of one or both of the two genes, encoding cytosine deaminase EC 3.5.4.1 of the uracil biosynthetic pathway fsy1 and pyrG encoding orotate 5'-phosphate decarboxylase EC 4.1.1.23, by crRNA-Cas9 RNP cleavage. Mononuclear mycelial colonies from edited protoplasts are selected and identified on 5-FC and 5-FOA media that selectively kill fungal mycelia with unedited wild-type fsy1 and pyrG genotypes. Then, by PCR amplification and gel electrophoresis, the following PCR primer pairs are used to identify those with coding sequence disrupting deletions in the fsy1, pyrG, PsiK, and PsiM genes in colony samples of washed, heat-lysed (85 °C) mycelia.

[0463] SEQ ID NO:118 - 125 The following are exemplary PCR primer pairs for detecting deletions in genomic DNA from mycelial colonies. The expected deletions make the products shorter than the indicated wild-type sequences:

[0464]

[0465]

[0466] Sequences SEQ ID NO:126 - 144 are exemplary single-targeting crRNA sequences for single gene editing or knockout of marker genes (fsy1 or pyrG) plus knockout of psilocybin synthesis genes (PsiK or PsiM), which have a high-fidelity Cas9 derivative RNP complex, shown as 5'→3' spacer DNA plus PAM (protospacer adjacent motif). For the purposes of the following SEQ ID NOs, it should be understood that the SEQ ID NO consists of the spacer sequence and PAM together.

[0467]

[0468]

[0469] In one example, SEQ ID NO:137 and 140 are paired PAM-out crRNA sequences (spacer DNA plus PAM) on opposite strands for use with a modified Cas9 nickase RNP complex that has a 71 bp between predicted DNA cleavage sites:

[0470] SEQ ID NO:137 PsiKcrRNA3 ACGGATGAGGATTTTAAGAT AGG SEQ ID NO:140 PsiKcrRNA6 ATGCTCGTATGACCTTGATA AGG

[0471] Introduction of gene-editing RNPs: Protoplasts of mycelia grown from plates to liquid cultures (3 - 5 days) at 25 - 30 °C were optimized for Psicub within the range achieved for several other tetrasporic bench-top mushrooms including Pleurotus ostreatus (Plo oyster mushroom, Boontawon, Tatpong, et al. 2021. “Efficient Genome Editing with CRISPR / Cas9 in Pleurotus Ostreatus.” AMB Express 11(1):30) and Lentinula edodes (Le, shiitake, Zhou, Chenli, et al.. 2017. “Establishment of Uracil Auxotrophic Dikaryotic Strains of Lentinula Edodes by Crossbreeding.” Breeding Science 67(2):135 - 39). 2-Mercaptoethanol and chitinase and pectinase such as snailase (Abbexa LLC, Sugar Land, TX, US) were used to generate protoplasts in 0.6 M potassium chloride, mannitol or sorbitol or similar osmoprotectant solutions having citrate or phosphate buffers optimized within the range of pH 5 - 7. Recovery of ice-cold, PEG-treated, vector DNA-transfected, RNP-transfected and similarly electroporated protoplasts was achieved in 0.6 M potassium chloride, mannitol or sorbitol media or similar osmoprotectant solutions having citrate and phosphate buffers optimized within the range of pH 5 - 7.

[0472] Mushroom recovery: Growth of mononuclear and dikaryotic mycelia and hybridization between spore-derived strains of compatible mating types will be carried out on 2% agar plates with potato dextrose PDA and yeast malt extract dextrose (YMD) plates, corresponding liquid media and rye or oat grain jars cooked in steam. 0.18 mM uracil and 20 mM uridine were used for growth of fsy1 and pyrG auxotrophic mutants respectively and 0.05 - 0.1% (w / v) 5-FC or 5-FOA to select these mutants and the non-deleted wild-type uracil prototrophic alleles for fsy1 and pyrG.

[0473] The use of unlinked markers was deliberate, with fsy1 on chromosome 11 and pyrG on chromosome 4, where the Psi psilocybin biosynthetic gene cluster is on chromosome 10. When we combined two monokaryons carrying different deletions in the same psi gene, we selected double-psi knockout dikaryons by complementing two uracil synthesis mutations on plates of minimal medium lacking uracil. This method can generally be used for unlinked knockouts and allows future exploration of targeted mutations in all genes of the psi cluster, including tryptophan decarboxylase PsiD, monooxygenase PsiH, basic HLH transcriptional regulator psiR, MFS transporters PsiT1 and PsiT2, and the tightly linked Psicub gene of casein kinase 1 type epsilon, which may be a circadian regulator.

[0474] Similarly, after sporulation, fsy1 and pyrG deletions can be selected on minimal medium without uracil to recover single psi deletions in monokaryons again.

[0475] Previously used selective growth conditions for Plo and Le (Boontawon, Tatpong, et al. 2021. “Efficiency genome editing with CRISPR / Cas9 in Pleurotus Ostreatus.” AMBExpress 11(1): 30, Zhou, Chenli, et al.. 2017. “Establishment of uracil auxotrophic dikaryotic strains of Lentinula edodes by crossbreeding” Breeding Science 67(2): 135 - 39) will be applicable to our isolated mycelia. Positive control fsy1 and pyrG auxotrophic mutants without gene editing will be generated from UV-irradiated protoplasts by selection on 5-FC or 5-FOA in medium supplemented with uracil and uridine and verified by colony PCR and Sanger sequencing. These strains will be used as growth controls on solid and 5-FC or 5-FOA selective media.

[0476] The dried monokaryotic and dikaryotic mycelia will be reactivated and frozen to establish backup storage at N2(l), 4 °C, and -80 °C.

[0477] Monokaryotic and dikaryotic colonies will be tested on plates, in liquid cultures, and in grain jars with Kovacs and DMACA indole reagents (Hardy Diagnostics, Santa Maria, CA, US) to ensure that these colonies grow under conditions where they do not produce more detectable indole compounds than commercially available mushrooms.

[0478] Healthy transcriptome: Quantitative reverse transcriptase polymerase chain reaction amplification (Q-RT-PCR or qRT-PCR) of a large number of mRNA transcripts using primer sequences that detect major P. cubensis act1, cis1, and tef1 mRNA transcripts will be used to assess healthy growth (see also, for example www.ncbi.nlm.nih.gov / probe / docs / techqpcr / ).

[0479] Primer sequences: SEQ ID NO: 145-150 are exemplary primers for qRT-PCR detection of abundant mRNA transcripts to assess the growth of gene-edited fungi containing deletions:

[0480]

[0481] Metabolites produced in mushrooms without psilocybin: Loss-of-function opposite mating type deletion monokaryons and compound heterozygous deletion dikaryons will be propagated in grain jars, tested for indole production with Kovacs and DMACA indole reagents, and if indole negative, grown to fruiting bodies (fruiting body production and sporulation) in lighted trays covered with peat moss sugarcane. Fruiting bodies will be tested daily with indole reagents and extracts will be submitted for metabolite identification by liquid chromatography mass spectrometry (LC-MS) against standards for all relevant metabolites, including L-tryptophan, 5-hydroxytryptophan, 4-hydroxytryptophan, tryptamine, kynurenine pathway metabolites, and β-carbolines (such as harmane: Blei F, S, Fricke J, Baldeweg F, Trottmann F, Komor A, Meyer F, Hertweck C, Hoffmeister D. Simultaneous Production of Psilocybin and a Cocktail of β-Carboline Monoamine Oxidase Inhibitors in ‘Magic’ Mushrooms. Chemistry. 2020;26(3):729-34). Any attached strongly indole-stained fungal material and media will be autoclaved and disposed of by incineration by the appropriate medical waste department without further investigation.

[0482] Media for auxotrophs: Potato Dextrose Agar (PDA): 200 g / L potato, 20 g / L dextrose, 20 g / L agar; Potato Dextrose Agar with uracil (PDAU): PDA containing 0.05 mmol / L uracil; Potato Dextrose (PD): 200 g / L potato, 20 g / L dextrose; Minimal Medium (MM): KH2PO3 1.0 g / L, (NH4)2HPO3 1.5 g / L, MgSO4·7H2O 0.3 g / L, thiamine HCl 500 μg / L, agar 15 g / L; Minimal Medium containing uracil (MMU): MM containing 0.05 mmol / L uracil; Minimal Medium containing uracil and 5-FOA (MMUF): MM containing 0.05 mmol / L uracil, 0.5 g / L 5-FOA. All media were sterilized at 121 °C for 15 minutes. 15 mL of each medium was poured into individual plastic Petri dishes with a 9 cm diameter. The mycelia were maintained at 25 °C in a dark room for 7 - 14 d. (See Zhou, Chenli, et al.. 2017. “Establishment of Uracil Auxotrophic Dikaryotic Strains of Lentinula Edodes by Crossbreeding.” Breeding Science 67(2):135 - 39.)

[0483] Media will be prepared by autoclaving or 0.2 micron filtration in disposable sterile plastic devices as appropriate. All plates and growth media will be autoclaved in separate autoclaves and then disposed of through appropriate laboratory waste services.

[0484] Example 5: Gene editing in the intergenic region

[0485] Exemplary sequences SEQ ID NO:151 - 158, from the public Psilocybe cubensis genome Psicub1_1 in an intergenic non - overlapping region, where gene - editing oligonucleotides can be used to target non - coding elements and thereby disrupt the transcription of these exemplary psilocybin - synthesizing genes PsiD, PsiH, PsiK, PsiM, their metabolite transporters PsiT1 and PsiT2, a candidate transcriptional regulator PsiR, and a candidate circadian expression regulator CSNK1E. Oligonucleotide targeting by sequence identity in CRISPR - Cas gene editing, TALEN, or zinc - finger nuclease gene editing, and siRNA or miRNA targeting non - coding regions of transcription is not limited to promoter and enhancer RNAs, 5' non - coding elements, 3' non - coding regions, and introns. The genomic sequence is from Fricke et al. 2017 and is annotated on the JGI Mycocosm platform mycocosm.jgi.doe.gov / Psicub1_1 / Psicub1_1.home.html.

[0486] Below, potential transcription factor binding sites in the predicted Promoter or Enhancer elements are indicated by Bold underline ; predicted transcription start sites ( TSS ) are highlighted in gray and Italic double underline ; the canonical ATG translation start codon is shown in bold italic.

[0487]

[0488]

[0489]

[0490]

[0491] Annotation of non - coding sequences used several prediction methods to leverage nucleotide sequence databases and consensus DNA - binding sites for eukaryotic and prokaryotic transcription start sites, promoter and enhancer elements, and fungal transcription factor proteins:

[0492] (1)Predict promoters in prokaryotic and eukaryotic promoter sequences from the free energy of nucleic acid sequence hybridization, using PromPredict nucleix.mbu.iisc.ac.in / prompredict / prompredict.html, see Kanhere A, Bansal M 2005a Structural properties of promoters: similarities and differences between prokaryotes and eukaryotes; Nucleic Acids Res. 33:3165-3175.

[0493] (2)TSSFinder sucest-fun.org / wsapp / TSSFinder / , see Mauro de Medeiros Oliveira, 2021. TSSFinder—fast and accurate ab initio prediction of the core promoter in eukaryotic genomes. Briefings Bioinfor., vol. 22, Issue 6, Nov. 2021, bbab198, doi.org / 10.1093 / bib / bbab198.

[0494] (3)Neural network eukaryotic promoter prediction, using fruitfly.org / cgi-bin / seq_tools / promoter.pl, see Reese MG, 2001. Application of a time-delay neural network to promoter annotation in the Drosophila melanogaster genome, Comput. Chem. 26(1), 51-6.

[0495] (4)Manual sequence inspection of transcription factor binding sites found in enhancer and promoter elements in fungi and other eukaryotes. See, for example, Piscitelli 2011, P. ostreatus laccase genes doi:10.2174 / 138920211795564331, and epd.epfl.ch / promoter_elements.php.

[0496] Some elements found in the non-coding region of the psilocybin synthesis cluster:

[0497]

[0498]

[0499] Example 6: Preparation of mushroom extracts

[0500] The psilocybin knockout mushrooms prepared based on the foregoing embodiments were freeze-dried (ScanVac CoolSafe Pro, Labogene, Lynge, Denmark) and stored in a sealed vacuum-sealed plastic bag at 4°C.

[0501] Preparation of mushroom extracts

[0502] The dried mushroom samples were finely ground using one or more of a blender, a grinder, an ultrasonic vibrator, or a food processor to produce mushroom powder. The powder was extracted using one or more of three different extractants: distilled water, 50% (v / v) ethanol, and a solvent such as ether.

[0503] For water extraction (WE), the powdered sample (10 g) was boiled in water (500 mL) for 30 minutes and centrifuged at 12,000 revolutions per minute (rpm) for 15 minutes; then, the supernatant was filtered through Whatman No. 4 filter paper using a Buchner funnel, and the filtrate was collected. The resulting extract was concentrated under vacuum at 40°C using a rotary evaporator (Rotavapor R-124; Buchi Labortechnic; Flawil, Switzerland), then 100 mL of distilled water was added, mixed well, transferred to a dark plastic bottle, and stored at 20°C until analysis.

[0504] For 50% (v / v) ethanol extraction (50% EE), each powdered sample (10 g) was mixed with 100 ml of 50% (v / v) ethanol and shaken at 150 rpm at room temperature for 24 hours, then centrifuged at 12,000 rpm for 15 minutes. The supernatant was filtered through Whatman No. 4 filter paper using a Buchner funnel, and the filtrate was collected. The residue was extracted again under the same conditions. The resulting extract was concentrated under vacuum at 40°C using a rotary evaporator, and 50% EE (100 mL) was added, mixed well, transferred to a dark plastic bottle, and stored at 20°C until analysis.

[0505] For diethyl ether extraction (DE), each powdered sample (10 g) mixed with 100 mL of diethyl ether was shaken at 150 rpm for 24 h at room temperature and then centrifuged at 12,000 rpm for 15 min. The supernatant was filtered through a Buchner funnel using Whatman No. 4 filter paper and the filtrate was collected. The residue was extracted again under the same conditions. The combined diethyl ether extracts were transferred to a dark plastic bottle, concentrated by flushing with 99.995% nitrogen, and stored at 20 °C until analysis. When the dried diethyl ether extract was used for analysis, 100 ml of diethyl ether was added and mixed well before analysis (see S. Boonsong et al., Antioxidant activities of extracts from five edible mushrooms using different extractants, Agriculture & Natural Resources 50 (2016) 89 - 97; US - 3,183,172 - A).

[0506] In some preferred embodiments of the non - hallucinogenic psychedelic fungi disclosed herein, when compared to extracts from wild - type mushrooms, mushroom extracts prepared from such fungi will have no or substantially no hallucinogenic effects when ingested, because the psilocybin biosynthetic pathway has been inhibited or otherwise disrupted. The extract contains phytochemicals with anti - inflammatory properties. The extract contains compounds that cause redox (reducing the amount of reactive oxygen species), and thus can be used as a free - radical scavenger. The extract also has effective antibacterial activity. The extract thus prepared can be used as a nutritional product capable of reducing inflammation, allergies, enhancing immunity, reducing fatigue and depression. The following assays illustrate methods for characterizing the amounts of phenolics, flavonoid content, and their therapeutic properties such as anti - inflammatory and antibacterial properties.

[0507] Quantitative analysis of psilocybin in mushroom extracts

[0508] The amount of psilocybin present in the mushroom extract can be determined by using LC - MS / MS methods known in the art. Analytical standards for both natural and deuterated psilocybin and psilocin were purchased from Cerilliant (TX, USA). An initial sample weight of 100 mg of freshly homogenized Psilocybe mushroom of the present invention with one or more genes of the psilocybin biosynthetic pathway (PsiD, PSiM, PsiH, and PsiK) knocked out or silenced was extracted in 10 ml of methanol and vortexed. The mushroom matrix was further extracted overnight at 4 °C. Deuterated internal standards were added to each vial.

[0509] Then, the mushroom extract was diluted to a dilution factor of 1:40,000. An unmodified Psilocybe mushroom of the same species in which the psilocybin biosynthetic pathway was intact was used as a control sample. The control mushroom extract was prepared by the same method as described above (see Gambaro et al., 2015, Identification of Hallucinogenic Mushrooms Seized on the Illegal Market Using a DNA-Based Approach and LC-MS / MS Determination of Psilocybin and Psilocin. J Anal BioAnal Tech. 6(6), 578-585.). 2 μL injection volume was separated on a Phenomenex Luna Omega Polar C18 (4.6 μm x 150 mm) using a mobile phase of formic acid, water and acetonitrile at a flow rate of 1.2 mL / min. (Mobile phase A: aqueous solution of 0.1% formic acid; Mobile phase B: acetonitrile solution of 0.1% formic acid).

[0510] The fractions separated by liquid chromatography were analyzed using an SCIEX Triple Quad 3500 mass spectrometry system with positive polarity in MRM mode. The following source parameters were optimized for analysis:

[0511] Source parameters Optimized values Curtain gas 40 Ion spray voltage 3500 CAD gas 11 Heater temperature 600 Nebulizing gas (GS1) 50

[0512] A psilocybin calibration curve was generated according to standard protocols known in the art. The results of the mass spectrometry and the calibration curve were used to determine the concentration of psilocybin. The control sample with an unmodified psilocybin biosynthetic pathway was expected to show 1-2 mg / ml of psilocybin, which would correspond to approximately 1-2 wt% of the mushroom extract. Similarly, the mushroom extract of the present invention was expected to show less than 0.1 mg / ml, which would correspond to approximately 0.1 wt% of the mushroom extract. Thus, the mushroom extract of the present invention will have little or negligible amounts of psilocybin and will not cause any hallucinogenic effects when consumed (see Oetjen et al., Quantification of Psilocybin and Psilocin in Mushroom by LC-MS / MS, SCIEX, USA, 2020.).

[0513] Analysis of phenolic compounds in mushroom extracts

[0514] The total phenolic compounds of the mushroom extract were determined according to Turkoglu et al. (Turkoglu, et al., 2007, Antioxidant and antimicrobial activities of Laetiporus sulphureus (Bull.) Murrill. Food Chem. 101, 267e273) with slight modifications. First, a volume of the extract (1 mL) was diluted with distilled water (46 mL). Folin-Ciocalteu reagent (1 mL) was added, and the contents of the reaction mixture were mixed thoroughly for 3 minutes; then, Na2CO3 2% v / v, 3 mL) was added. The mixture was left to stand for 90 minutes at room temperature with intermittent shaking. The absorbance of each mixture was measured at 760 nm. The concentration of total phenolic compounds was measured by plotting a calibration curve of gallic acid standards, which was determined in mg gallic acid equivalents / g dry mushroom.

[0515] Analysis of total flavonoid content in mushroom extracts

[0516] The flavonoid content of the mushroom extract was measured according to the method of Turkoglu et al. (2007). The extract (1 mL) was diluted with 4.3 mL of 80% (v / v) aqueous ethanol containing 0.1 mL of 10% (v / v) aluminum nitrate and 0.1 mL of 1 M aqueous potassium acetate, and left to stand for 40 minutes at room temperature. The absorbance was measured spectrophotometrically at 415 nm. The total alkaloid content was measured by plotting a calibration curve of quercetin standards, which was determined in mg quercetin equivalents per gram of dry mushroom.

[0517] Analysis of antioxidant activity in mushroom extracts

[0518] a. Determination of 2,2-diphenyl-1-picrylhydrazyl radical scavenging activity

[0519] The free radical scavenging activity of the mushroom extracts was determined using the method of Devi et al. (Devi et al., 2008. Bioprotective properties of seaweeds: in vitro evaluation of antioxidant activity and antimicrobial activity against food borne bacteria in relation to polyphenolic content. BMC. Complement. Altern. Med. 8, 38). 3 mL of each mushroom extract at different concentrations (50 mg / mL, 100 mg / mL, 150 mg / mL, 250 mg / mL, 500 mg / mL) was mixed with 1 mL of a methanol solution of DPPH (0.1 mM). The mixture was shaken vigorously and allowed to stand in the dark at room temperature for 30 minutes, and then the absorbance was measured against a blank at 517 nm using a quartz glass cuvette (Hellma; Mullheim, Germany) in a UV-visible spectrophotometer (Pharma Spec UV-1700; Shimadzu; Kyoto, Japan). A low absorbance of the reaction mixture indicates high free radical scavenging activity. BHA and α-tocopherol were used as positive controls. The ability to scavenge DPPH free radicals was calculated using Equation (1):

[0520] DPPH scavenging effect (%) = (A 空白 - A 样品 ) / A 空白 X 100 (1)

[0521] where A 空白 and A 样品 are the absorbances of the control reaction (containing all reagents except the test extract) and the test extract, respectively.

[0522] b. Reducing power determination

[0523] The reducing power of the mushroom extracts was determined according to the modified method of Barros et al. (Barros et al., I.C.F.R., 2008, Antioxidant activity of Agaricus sp. mushrooms by chemical, biochemical and electrochemical assays. Food Chem. 111, 61-66). Mushroom extracts (2.5 mL) at various concentrations (50 mg / mL, 100 mg / mL, 150 mg / mL, 250 mg / mL, 500 mg / mL) were mixed with sodium phosphate buffer (2.5 mL, 0.2 M, pH 6.6) and 2.5 mL of 1% (v / v) potassium ferricyanide. The mixture was incubated at 50 °C for 20 min, and 2.5 mL of 10% (v / v) trichloroacetic acid was added to the mixture and centrifuged at 1000 rpm for 8 min. The upper layer solution (5 mL) was mixed with distilled water (5 mL) and 1 mL of 0.1% (v / v) ferric chloride (FeCl3). The absorbance of the test extract was measured at 700 nm; a higher absorbance would indicate the presence of higher reducing power. BHA and atocopherol were used as positive controls.

[0524] c. Determination of superoxide anion radical scavenging activity

[0525] The superoxide radical of the mushroom extracts was determined according to the method of Elmastasa et al. (Elmastasa et al., 2007. Determination of antioxidant activity and antioxidant compounds in wild edible mushrooms. J. Food Compost. Anal. 20, 337-345). Each extract (1 mL) at different concentrations (50 mg / mL, 100 mg / mL, 150 mg / mL, 250 mg / mL, 500 mg / mL) was mixed with 1 mL of phosphate buffer (0.05 M; pH 7.8), riboflavin (1 mL; 3×10−6 M), methionine (1 mL; 1×10−2 M) and nitroblue tetrazolium (NBT; 1 mL; 1×10−4 M). The photo-induced reaction was carried out in an aluminum foil-lined box with two fluorescent lamps (20 W), and the distance between the reactants and the lamps was adjusted until the light intensity reached 4000 lx, and the reactants were illuminated at 25 °C for 25 min. The photochemical reduction of riboflavin would generate O2−, which would reduce NBT to form blue formazan. The absorbance of the reaction mixture was measured at 560 nm. BHA and α-tocopherol were used as positive controls. The scavenging rate was calculated using equation (2):

[0526] % Clearance = (A 对照 - A 样品 ) / A 对照 x 100 (2),

[0527] where A 对照 and A 样品 are the absorbance of the unirradiated reaction mixture and the absorbance of the mushroom extract added to the reaction mixture, respectively.

[0528] d. Ferrous ion activity assay

[0529] The chelation of ferrous ions in the mushroom extract was estimated using the method of Yaltirak et al. (Yaltirak, et al., 2009. Antimicrobial and antioxidant activities of Russula delica Fr. Food Chem. Toxicol. 47, 2052 - 2056). Each extract (1 mL) with different concentrations (50 mg / mL, 100 mg / mL, 150 mg / mL, 250 mg / mL, 500 mg / mL) was mixed with 3.7 mL of methanol and 0.1 mL of 2 mM ferrous chloride. The reaction was initiated by adding 0.2 ml of 5 mM ferrozine. The mixture was shaken vigorously and allowed to stand at room temperature for 10 minutes. The absorbance of the mixture was measured spectrophotometrically at 562 nm relative to the blank; ethylenediaminetetraacetic acid (EDTA) was used as a positive control. The results were expressed as the percentage inhibition of ferrozine - Fe 2+ complex formation, which was calculated using equation (3):

[0530] % Inhibition = (A 对照 - A 样品 ) / A 对照 X 100 (3)

[0531] where A 对照 and A 样品 are the absorbance of the ferrozine - Fe 2+ complex and the absorbance of the test extract, respectively.

[0532] e. Antibacterial activity

[0533] The antibacterial effects of the methanol extract of Psilocybe mushrooms against Gram-positive and Gram-negative bacteria were tested according to the procedure detailed in Sanches et al. The evaluation of the antibacterial activity against Psidium guajava (L.) (Braz Arch Biol Tech. 2005; 48(3): 429-436).). Since many plant phenolics have been found to be responsible for several biological properties, including antimicrobial properties (Yathirak et al., Antimicrobial and antioxidant activities of Russula delica Fr., Food Chem Toxicol. 2009 Aug; 47(8): 2052-6), the antimicrobial activity of the mushroom extract is expected to be related to its antioxidant compounds.

[0534] Unless otherwise indicated, the practice of the methods disclosed herein and the preparation and use of the compositions employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA, and related fields, as within the skill of the art. These techniques are well explained in the literature. See, for example: Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Lab. Press, 1989; 3d ed., 2001; Ausubel et al., Current Protocols In Molecular Biology, John Wiley & Sons, New York, 1987 & periodic updates; The series Methods In Enzymology, Acad. Press, San Diego; Wolfe, Chromatin Structure And Function, 3rd ed., Academic Press, San Diego, 1998; Methods In Enzymology, Vol. 304, “Chromatin” (P.M. Wassarman & A.P. Wolffe, eds.), Academic Press, San Diego, 1999; and Methods In Molecular Biology, Vol. 119, “Chromatin Protocols” (P.B. Becker, ed.) Humana Press, Totowa, 1999.

[0535] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by the following claims. Any combination of embodiments disclosed in any of the multiple dependent claims or examples is contemplated within the scope of the present disclosure.

[0536] Without departing from the true scope of the invention, the invention may be embodied in other specific forms than those of the exemplary embodiments herein. Any reference to "the invention" is intended to refer to its exemplary embodiments and should not be construed to refer to all embodiments of the invention unless the context otherwise requires. The described embodiments are to be considered in all respects only as illustrative and not restrictive.

[0537] The recitation of a list of elements in any definition of a variable herein includes defining the variable as any single element or combination (or sub - combination) of the listed elements. The recitation of an embodiment herein includes the embodiment as any single embodiment or in combination with any other embodiment or part thereof.

[0538] Additional embodiments were initially disclosed in U.S. Provisional Application No. 63 / 371,121, which was initially filed as a requirement. These claims and each of the embodiments they represent are also set forth herein again and are incorporated herein by reference as if fully set forth herein.

[0539] For purposes of explanation, the foregoing description uses specific nomenclature to provide a thorough understanding of the invention. However, it will be apparent to those skilled in the art that no specific details are required to practice the invention. Accordingly, the foregoing description is presented for purposes of illustration and description and is not intended to be exhaustive or to limit the invention to the precise form disclosed; many modifications and variations are possible in light of these teachings. The embodiments were chosen and described in order to best explain the principles of the invention and its practical application, and thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications suited to the particular uses contemplated when such uses are beyond the specific examples disclosed. Other embodiments are in the following claims. Accordingly, the scope of the invention should be defined only by the appended claims and their equivalents.

Claims

1. A non-hallucinogenic psychedelic fungus with reduced production of bioactive alkaloids, wherein the fungus has disrupted activity of one or more of the PsiD, PsiH, PsiK, or PsiM enzymes.

2. The non-hallucinogenic psychedelic fungus according to claim 1, wherein the bioactive alkaloid is tryptamine, 4-hydroxytryptamine, norbaeocystin, baeocystin, or psilocybin.

3. The non-hallucinogenic psychedelic fungus according to claim 1, wherein the bioactive alkaloid is a hallucinogenic tryptamine.

4. The non-hallucinogenic psychedelic fungus according to claim 3, wherein the hallucinogenic tryptamine is psilocybin.

5. The non-hallucinogenic psychedelic fungus according to claim 1, wherein the fungus is a Psilocybe spp. fungus.

6. The non-hallucinogenic psychedelic fungus according to claim 5, wherein the Psilocybe spp. fungus is Psilocybe cubensis or Psilocybe cyanescens.

7. The non-hallucinogenic psychedelic fungus according to claim 1, having disrupted activity of the PsiD enzyme.

8. The non-hallucinogenic psychedelic fungus according to claim 1, having disrupted activity of the PsiH enzyme.

9. The non-hallucinogenic psychedelic fungus according to claim 1, having disrupted activity of the PsiK enzyme.

10. The non-hallucinogenic psychedelic fungus according to claim 1, having disrupted activity of the PsiM enzyme.

11. The non-hallucinogenic psychedelic fungus according to claim 1, wherein the disrupted activity is the result of disrupted expression of one or more of the PsiD, PsiH, PsiK, or PsiM genes.

12. The non-hallucinogenic psychedelic fungus according to claim 11, having disrupted expression of the PsiD gene.

13. The non-hallucinogenic psychedelic fungus according to claim 12, wherein the disrupted expression of the PsiD gene comprises downregulation of the PsiD gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR.

14. The non-hallucinogenic psychedelic fungus according to claim 13, when measured by qRT-PCR, does not contain a detectable transcript of the PsiD gene.

15. The non-hallucinogenic psychedelic fungus according to claim 12, wherein the PsiD gene expression is disrupted using siRNA.

16. The non-hallucinogenic psychedelic fungus according to claim 15, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO:52, 53, 54, 55, or 56 or its reverse complementary sequence.

17. The non-hallucinogenic psychedelic fungus according to claim 11, having disrupted expression of the PsiH gene.

18. The non-hallucinogenic psychedelic fungus according to claim 17, wherein the disrupted expression of the PsiH gene comprises downregulation of the PsiH gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR.

19. The non-hallucinogenic psychedelic fungus according to claim 18, which does not contain a detectable transcript of the PsiH gene when measured by qRT-PCR.

20. The non-hallucinogenic psychedelic fungus according to claim 17, wherein the PsiH gene expression is disrupted using siRNA.

21. The non-hallucinogenic psychedelic fungus according to claim 20, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO: 67, 68, 69, 70, or 71 or the reverse complementary sequence thereof.

22. The non-hallucinogenic psychedelic fungus according to claim 11, having disrupted expression of the PsiK gene.

23. The non-hallucinogenic psychedelic fungus according to claim 22, wherein the disrupted expression of the PsiK gene comprises downregulation of the PsiK gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR.

24. The non-hallucinogenic psychedelic fungus according to claim 23, which does not contain a detectable transcript of the PsiK gene when measured by qRT-PCR.

25. The non-hallucinogenic psychedelic fungus according to claim 23, wherein the PsiK gene expression is disrupted using siRNA.

26. The non-hallucinogenic psychedelic fungus according to claim 25, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a sequence selected from SEQ ID NO: 57, 58, 59, or 61 or the reverse complementary sequence thereof.

27. The non-hallucinogenic psychedelic fungus according to claim 11, having disrupted expression of the PsiM gene.

28. The non-hallucinogenic psychedelic fungus according to claim 27, wherein the disrupted expression of the PsiM gene comprises downregulation of the PsiM gene to a steady-state transcript level that is at least two-fold, at least three-fold, at least five-fold, or at least ten-fold lower than that of the unmodified strain under comparable growth conditions, as determined by qRT-PCR.

29. The non-hallucinogenic psychedelic fungus according to claim 28, which does not contain a detectable transcript of the PsiM gene when measured by qRT-PCR.

30. The non-hallucinogenic psychedelic fungus according to claim 27, wherein the PsiM gene expression is disrupted using siRNA.

31. The non-hallucinogenic psychedelic fungus according to claim 30, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 62, 63, 64, 65 or 66 or the reverse complementary sequence thereof.

32. The non-hallucinogenic psychedelic fungus according to claim 11, comprising a deletion of one or more of the PsiD, PsiH, PsiK and PsiM genes.

33. The non-hallucinogenic psychedelic fungus according to claim 32, comprising a deletion of the PsiD gene.

34. The non-hallucinogenic psychedelic fungus according to claim 33, wherein the PsiD gene is deleted using CRISPR / Cas9.

35. The non-hallucinogenic psychedelic fungus according to claim 34, wherein the deletion of the PsiD gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 13, 14, 15, 16 or 17 or the reverse complementary sequence thereof.

36. The non-hallucinogenic psychedelic fungus according to claim 32, comprising a deletion of the PsiH gene.

37. The non-hallucinogenic psychedelic fungus according to claim 36, wherein the PsiH gene is deleted using CRISPR / Cas9.

38. The non-hallucinogenic psychedelic fungus according to claim 37, wherein the deletion of the PsiH gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 27, 28, 29, 30 or 31 or the reverse complementary sequence thereof.

39. The non-hallucinogenic psychedelic fungus according to claim 32, comprising a deletion of the PsiK gene.

40. The non-hallucinogenic psychedelic fungus according to claim 39, wherein the PsiK gene is deleted using CRISPR / Cas9.

41. The non-hallucinogenic psychedelic fungus according to claim 40, wherein the deletion of the PsiK gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 18, 19, 20, 21, 22, 135, 136, 137, 138, 139 or 140 or the reverse complementary sequence thereof.

42. The non-hallucinogenic psychedelic fungus according to claim 32, comprising a deletion of the PsiM gene.

43. The non-hallucinogenic psychedelic fungus according to claim 42, wherein the PsiM gene is deleted using CRISPR / Cas9.

44. The non-hallucinogenic psychedelic fungus according to claim 43, wherein the deletion of the PsiM gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 22, 23, 24, 25, 26, 141, 142, 143 or 144 or the reverse complementary sequence thereof.

45. The non-hallucinogenic psychedelic fungus according to claim 11, wherein the disrupted activity or disrupted expression is caused by gene knockout of one or more of the PsiD, PsiH, PsiK, and PsiM genes.

46. The non-hallucinogenic psychedelic fungus according to claim 11, wherein the disrupted activity or disrupted expression is caused by gene knockout of two or more of the PsiD, PsiH, PsiK and PsiM genes.

47. The non-hallucinogenic psychedelic fungus according to claim 11, wherein the disrupted activity or disrupted expression is caused by gene knockout of three or more of the PsiD, PsiH, PsiK and PsiM genes.

48. The non-hallucinogenic psychedelic fungus according to claim 11, wherein the disrupted activity or disrupted expression is caused by gene knockout of all four PsiD, PsiH, PsiK and PsiM genes.

49. The non-hallucinogenic psychedelic fungus according to any one of claims 45-48, wherein the gene knockout is caused at least in part by homologous recombination.

50. The non-hallucinogenic psychedelic fungus according to any one of claims 45-48, wherein the gene knockout is caused at least in part by using zinc finger nucleases.

51. The non-hallucinogenic psychedelic fungus according to any one of claims 45-48, wherein the gene knockout is caused at least in part by using TALENs.

52. The non-hallucinogenic psychedelic fungus according to any one of claims 45-48, wherein the gene knockout is caused at least in part by using CRISPR / Cas9.

53. The non-hallucinogenic psychedelic fungus according to any one of claims 45-48, wherein the gene knockout is caused at least in part by using small interfering RNA (siRNA).

54. The non-hallucinogenic psychedelic fungus according to any one of claims 45-48, wherein the gene knockout is caused at least in part by using microRNA (miRNA).

55. The non-hallucinogenic psychedelic fungus according to any one of claims 45-48, wherein the disrupted activity or disrupted expression is not caused by the insertion of exogenous genetic material.

56. The non-hallucinogenic psychedelic fungus according to claim 4, wherein the production of psilocybin is reduced by more than 90%, more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99%, more than 99.5%, more than 99.9%, more than 99.95% or more than 99.99% compared to a comparable wild-type fungus.

57. The non-hallucinogenic psychedelic fungus according to claim 4, wherein the fungus contains less than 0.15, less than 0.10, less than 0.05, less than 0.001 or less than 0.005 weight / weight% of psilocybin when dried.

58. The non-hallucinogenic psychedelic fungus according to any one of claims 56 or 57, which does not contain detectable psilocybin.

59. The non-hallucinogenic psychedelic fungus according to claim 4, further comprising bioactive alkaloids other than psilocybin.

60. The non-hallucinogenic psychedelic fungus according to claim 59, wherein the bioactive alkaloids other than psilocybin are tryptamine, 4-hydroxytryptamine, norbaeocystin or baeocystin.

61. The non-hallucinogenic psychedelic fungus according to claim 59, wherein the bioactive alkaloids other than psilocybin have therapeutic or beneficial properties.

62. The non-hallucinogenic psychedelic fungus according to claim 61, wherein the therapeutic or beneficial properties are any one of antibacterial, antibiotic, antifungal, anti-cancer, immunosuppressive, immunostimulatory, anti-inflammatory, hypoglycemic, antioxidant, antiviral, anti-neurodegenerative, anti-epileptic, neuroprotective, anti-angiogenic, anti-diabetic or cholesterol-lowering properties.

63. The non-hallucinogenic psychedelic fungus according to claim 59, contains an increased amount of bioactive alkaloids other than psilocybin relative to a comparable wild-type fungus.

64. The non-hallucinogenic psychedelic fungus according to claim 63, wherein the increased amount is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300% or at least 500% increase relative to a comparable wild-type fungus.

65. A method for preparing a non-hallucinogenic psychedelic fungus with reduced production of bioactive alkaloids, comprising disrupting the activity of one or more of the PsiD, PsiH, PsiK or PsiM enzymes.

66. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 65, wherein the bioactive alkaloids are tryptamine, 4-hydroxytryptamine, norbaeocystin, baeocystin or psilocybin.

67. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 65, wherein the bioactive alkaloids are hallucinogenic tryptamines.

68. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 67, wherein the hallucinogenic tryptamine is psilocybin.

69. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 65, wherein the fungus is a Psilocybe spp. fungus.

70. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 69, wherein the Psilocybe spp. fungus is Psilocybe cubensis or Psilocybe cyanescens.

71. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 65, comprising disrupting the activity of the PsiD enzyme.

72. The method for preparing non-hallucinogenic psychedelic fungi according to claim 65, comprising disrupting the activity of PsiH enzyme.

73. The method for preparing non-hallucinogenic psychedelic fungi according to claim 65, comprising disrupting the activity of PsiK enzyme.

74. The method for preparing non-hallucinogenic psychedelic fungi according to claim 65, comprising disrupting the activity of PsiM enzyme.

75. The method for preparing non-hallucinogenic psychedelic fungi according to claim 65, wherein disrupting the activity comprises disrupting the expression of one or more of PsiD, PsiH, PsiK or PsiM genes.

76. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, comprising disrupting the expression of PsiD gene.

77. The method for preparing non-hallucinogenic psychedelic fungi according to claim 76, wherein the expression of PsiD gene is disrupted using siRNA.

78. The method for preparing non-hallucinogenic psychedelic fungi according to claim 77, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 52, 53, 54, 55 or 56 or its reverse complementary sequence.

79. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, comprising disrupting the expression of PsiH gene.

80. The method for preparing non-hallucinogenic psychedelic fungi according to claim 79, wherein the expression of PsiH gene is disrupted using siRNA.

81. The method for preparing non-hallucinogenic psychedelic fungi according to claim 80, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 67, 68, 69, 70 or 71 or its reverse complementary sequence.

82. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, comprising disrupting the expression of PsiK gene.

83. The method for preparing non-hallucinogenic psychedelic fungi according to claim 82, wherein the expression of PsiK gene is disrupted using siRNA.

84. The method for preparing non-hallucinogenic psychedelic fungi according to claim 83, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 57, 58, 59 or 61 or its reverse complementary sequence.

85. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, comprising disrupting the expression of PsiM gene.

86. The method for preparing non-hallucinogenic psychedelic fungi according to claim 85, wherein the expression of PsiM gene is disrupted using siRNA.

87. The method for preparing non-hallucinogenic psychedelic fungi according to claim 86, wherein the siRNA has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 62, 63, 64, 65 or 66 or its reverse complementary sequence.

88. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, comprising deleting one or more of the PsiD, PsiH, PsiK and PsiM genes.

89. The method for preparing non-hallucinogenic psychedelic fungi according to claim 88, comprising deleting the PsiD gene.

90. The method for preparing non-hallucinogenic psychedelic fungi according to claim 89, wherein the PsiD gene is deleted using CRISPR / Cas9.

91. The method for preparing non-hallucinogenic psychedelic fungi according to claim 90, wherein deleting the PsiD gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 13, 14, 15, 16 or 17 or its reverse complementary sequence.

92. The method for preparing non-hallucinogenic psychedelic fungi according to claim 88, comprising deleting the PsiH gene.

93. The method for preparing non-hallucinogenic psychedelic fungi according to claim 92, wherein the PsiH gene is deleted using CRISPR / Cas9.

94. The method for preparing non-hallucinogenic psychedelic fungi according to claim 93, wherein deleting the PsiH gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 27, 28, 29, 30 or 31 or its reverse complementary sequence.

95. The method for preparing non-hallucinogenic psychedelic fungi according to claim 88, comprising deleting the PsiK gene.

96. The method for preparing non-hallucinogenic psychedelic fungi according to claim 95, wherein the PsiK gene is deleted using CRISPR / Cas9.

97. The method for preparing non-hallucinogenic psychedelic fungi according to claim 96, wherein deleting the PsiK gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 18, 19, 20, 21, 22, 135, 136, 137, 138, 139 or 140 or its reverse complementary sequence.

98. The method for preparing non-hallucinogenic psychedelic fungi according to claim 88, comprising deleting the PsiM gene.

99. The method for preparing non-hallucinogenic psychedelic fungi according to claim 98, wherein the PsiM gene is deleted using CRISPR / Cas9.

100. The method for preparing non-hallucinogenic psychedelic fungi according to claim 99, wherein the deletion of the PsiM gene comprises using an sgRNA that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with a sequence selected from SEQ ID NO: 22, 23, 24, 25, 26, 141, 142, 143 or 144 or its reverse complementary sequence.

101. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, wherein disrupting the activity or disrupting the expression comprises knocking out one or more of the PsiD, PsiH, PsiK and PsiM genes.

102. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, wherein disrupting the activity or disrupting the expression comprises knocking out two or more of the PsiD, PsiH, PsiK and PsiM genes.

103. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, wherein disrupting the activity or disrupting the expression comprises knocking out three or more of the PsiD, PsiH, PsiK and PsiM genes.

104. The method for preparing non-hallucinogenic psychedelic fungi according to claim 75, wherein disrupting the activity or disrupting the expression comprises knocking out all four of the PsiD, PsiH, PsiK and PsiM genes.

105. The method for preparing non-hallucinogenic psychedelic fungi according to any one of claims 101-104, wherein knocking out one or more of the genes is at least partially accomplished using homologous recombination.

106. The method for preparing non-hallucinogenic psychedelic fungi according to any one of claims 101-104, wherein knocking out one or more of the genes is at least partially accomplished using zinc finger nucleases.

107. The method for preparing non-hallucinogenic psychedelic fungi according to any one of claims 101-104, wherein knocking out one or more of the genes is at least partially accomplished using TALENs.

108. The method for preparing non-hallucinogenic psychedelic fungi according to any one of claims 101-104, wherein knocking out one or more of the genes is at least partially accomplished using CRISPR / Cas9.

109. The method for preparing non-hallucinogenic psychedelic fungi according to any one of claims 101-104, wherein knocking out one or more of the genes is at least partially accomplished using small interfering RNA (siRNA).

110. The method for preparing non-hallucinogenic psychedelic fungi according to any one of claims 101-104, wherein knocking out one or more of the genes is at least partially accomplished using microRNA (miRNA).

111. The method for preparing non-hallucinogenic psychedelic fungi according to any one of claims 101-104, wherein disrupting the activity or disrupting the expression does not include inserting exogenous genetic material.

112. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 68, wherein the production of psilocybin is reduced by an amount greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, greater than 99.9%, greater than 99.95% or greater than 99.99% relative to a comparable wild-type fungus.

113. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 68, wherein the fungus contains less than 0.15, less than 0.10, less than 0.05, less than 0.001 or less than 0.005 weight / weight% of psilocybin when dried.

114. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 68, wherein the fungus does not contain detectable psilocybin.

115. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 68, wherein the fungus further contains bioactive alkaloids other than psilocybin.

116. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 115, wherein the bioactive alkaloids other than psilocybin are tryptamine, 4-hydroxytryptamine, norbaeocystin or baeocystin.

117. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 115, wherein the bioactive alkaloids other than psilocybin have therapeutic or beneficial properties.

118. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 117, wherein the therapeutic or beneficial properties are any one of antibacterial, antibiotic, antifungal, anticancer, immunosuppressive, immunostimulatory, anti-inflammatory, hypoglycemic, antioxidant, antiviral, anti-neurodegenerative, anti-epileptic, neuroprotective, anti-angiogenic, antidiabetic or cholesterol-lowering properties.

119. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 115, wherein the fungus contains an increased amount of bioactive alkaloids other than psilocybin relative to a comparable wild-type fungus.

120. The method for preparing a non-hallucinogenic psychedelic fungus according to claim 119, wherein the increased amount is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300% or at least 500% increase relative to a comparable wild-type fungus.

Citation Information

Patent Citations

  • Cannabis plants having modified expression of THCA synthase

    US10934554B2

  • Transgenic plants with enhanced agronomic traits

    US20090100536A1

  • Modulation of cannabinoid profile in cannabis

    US20220002742A1

  • Genetic modification of plants

    US20220356484A1

  • Obtaining psilocybin and psilocin from fungal material

    US3183172A