Brevibacillus parvus and application thereof

By using Bacillus lateralis and its microbial agents and fertilizers, the problems of soil acidification and soil-borne diseases have been solved, crop yield and quality have been improved, and the effects of promoting seedling growth and preventing root rot have been achieved.

CN120424801BActive Publication Date: 2026-02-10SINOFERT HOLDINGS +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510344262.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2026-02-10
Estimated Expiration
2045-03-21

AI Technical Summary

Technical Problem

Long-term application of chemical fertilizers leads to soil acidification and compaction, a decrease in the number of active microorganisms, low utilization of phosphorus and potassium, limited crop yield and quality, serious soil-borne diseases, and short-lived efficacy of chemical fungicides that pollute the environment.

Method used

We provide Bacillus laterosporus and its microbial agents, compound agents and microbial fertilizers for plant seedling growth promotion and root rot control. They contain a specific ratio of Bacillus laterosporus combined with other Bacillus species and are applicable to crops such as strawberries, tomatoes and corn.

Benefits of technology

It significantly improves crop yield and quality, reduces soil-borne diseases, promotes nutrient supply and soil improvement, and achieves long-term plant protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120424801B_ABST
    Figure CN120424801B_ABST
Patent Text Reader

Abstract

The application provides a Brevibacillus laterosporus and application thereof. The Brevibacillus laterosporus (Brevibacillus laterosporus LY15-1) is preserved in the China General Microbiological Culture Collection Center on February 8, 2025, and the preservation number is CGMCC No. 33504. The Brevibacillus laterosporus has excellent effects of promoting growth and preventing and treating root rot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a type of Bacillus lateralis and its applications. Background Technology

[0002] In my country's crop production, the long-term and excessive application of chemical fertilizers has led to soil acidification and compaction, a decrease in the number of active microorganisms, and low utilization rates of nutrients such as phosphorus and potassium. This makes it difficult to provide crops with the balanced and sufficient nutrition they need for growth, thus significantly limiting the improvement of crop yield and quality. At the same time, continuous cropping for many years has resulted in severe soil-borne diseases and other continuous cropping obstacles, seriously affecting the improvement of crop yield and quality. Devastating soil-borne diseases such as bacterial wilt, blight, and root rot are serious, often causing large-scale plant death. Currently, there are no effective control methods. Chemical fungicides have short-lived effects and cannot provide long-term protection for plants. Their environmental pollution and residues on fruits also affect human health.

[0003] Microbial fertilizers are preparations containing active beneficial microorganisms that can promote nutrient supply and absorption, regulate plant growth, enhance plant resistance to stress, improve the soil environment, and increase crop yield, playing an important role in crop cultivation and soil remediation. Bacillus laterosporus is one of the most widely used microorganisms in agricultural microbial agents, characterized by strong resistance to stress, high enzyme activity, and a broad antibacterial spectrum.

[0004] Further research is needed to find a Bacillus lateralis species that possesses excellent growth-promoting and root rot-controlling properties for application in biological control, plant growth promotion, and soil improvement. Summary of the Invention

[0005] This invention aims to at least partially solve one of the problems in related technologies. To this end, this invention provides an application of *Bacillus laterosporus* and its microbial agents, compound agents, and microbial fertilizers, which can simultaneously achieve positive effects in promoting plant seedling growth and controlling plant root rot.

[0006] The first aspect of this invention provides a *Brevibacillus laterosporus* LY15-1, which was deposited on February 8, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 33504, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The *Bacillus lateralis* strain provided by this invention is a pure strain isolated from the rhizosphere soil of corn in Yinan County, Linyi City, Shandong Province.

[0008] According to an embodiment of the present invention, the *Bacillus lateralis* has a 16S rRNA sequence as shown in SEQ ID NO:1.

[0009] A second aspect of the present invention provides a microbial agent, the microbial agent comprising the *Bacillus retroflexus* described in the first aspect.

[0010] According to an embodiment of the present invention, the effective viable count of *Bacillus laterosporus* in the microbial agent is at least 5.0 × 10⁻⁶. 10 CFU / g.

[0011] According to an embodiment of the present invention, the microbial agent is in the form of a dry powder.

[0012] A third aspect of the present invention provides a compound microbial agent, the compound microbial agent comprising the microbial agent described in the second aspect.

[0013] According to an embodiment of the present invention, the compound microbial agent includes a first microbial agent and a second microbial agent. The first microbial agent is the microbial agent described in the second aspect. The first microbial agent includes Bacillus lateralis. The second microbial agent includes at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus belye, and Bacillus amyloliquefaciens.

[0014] According to an embodiment of the present invention, the compound microbial agent comprises 20-50 parts by weight of the first microbial agent and 20-50 parts by weight of the second microbial agent; wherein the second microbial agent is selected from at least one of the following:

[0015] 20-50 parts by weight of Bacillus subtilis;

[0016] 20-50 parts by weight of Bacillus licheniformis;

[0017] 20-50 parts by weight of Bacillus belye;

[0018] 20-50 parts by weight of Bacillus amyloliquefaciens.

[0019] According to an embodiment of the present invention, the compound microbial agent includes Bacillus lateralis and at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus belye, and Bacillus amyloliquefaciens;

[0020] in,

[0021] The effective viable count of the *Bacillus laterosporus* is at least 5.0 × 10⁻⁶. 10 CFU / g;

[0022] The effective viable count of the Bacillus subtilis is at least 1.0 × 10⁻⁶. 11 CFU / g;

[0023] The effective viable count of the *Bacillus licheniformis* is at least 1.0 × 10⁻⁶. 11 CFU / g;

[0024] The effective viable count of the *Bacillus belyssus* is at least 1.0 × 10⁻⁶. 11 CFU / g;

[0025] The effective viable count of the *Bacillus amyloliquefaciens* is at least 1.0 × 10⁻⁶. 11 CFU / g.

[0026] The fourth aspect of this invention provides a microbial fertilizer, which includes Bacillus lateralis as described in the first aspect, microbial agents as described in the second aspect, or compound microbial agents as described in the third aspect. The Bacillus lateralis and the microbial agents and compound microbial agents containing it provided by this invention can play a positive role in the preparation of microbial fertilizers.

[0027] According to an embodiment of the present invention, the microbial fertilizer is a solid fertilizer, and the number of effective viable microorganisms contained in the microbial fertilizer is at least 1.8 × 10⁻⁶. 8 CFU / g; or, the microbial fertilizer is a liquid fertilizer, and the effective viable count of the microorganisms contained in the microbial fertilizer is at least 1.8 × 10⁻⁶. 8 CFU / mL.

[0028] According to an embodiment of the present invention, the microbial fertilizer further includes a base fertilizer, which includes at least one selected from compound fertilizer, organic fertilizer, and organic-inorganic fertilizer.

[0029] The fifth aspect of the present invention provides a method for fertilizing crops, comprising: applying at least one of Bacillus retroflexus, microbial agent, compound microbial agent, and microbial fertilizer to the crop, wherein the Bacillus retroflexus is the Bacillus retroflexus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the compound microbial agent is the compound microbial agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0030] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0031] The sixth aspect of the present invention provides a method for promoting crop seedling growth or preventing crop root rot, comprising: applying at least one of Bacillus retroflexus, microbial agent, compound microbial agent, and microbial fertilizer to the crop, wherein the Bacillus retroflexus is the Bacillus retroflexus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the compound microbial agent is the compound microbial agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0032] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0033] The *Bacillus lateralis* strain of this invention has excellent effects in promoting growth and preventing root rot, and is an innovative strain independently screened by the applicant.

[0034] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

[0035] Preservation information:

[0036] Strain name: Brevibacillus laterosporus

[0037] Deposit date: February 8, 2025

[0038] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0039] Accession number: CGMCC No. 33504 Attached Figure Description

[0040] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0041] Figure 1 The image shows the colony morphology of strain LY15-1 on the culture medium;

[0042] Figure 2 The image shows a Gram-stained photograph of strain LY15-1;

[0043] Figure 3 A schematic diagram of the phylogenetic tree of strain LY15-1 is shown;

[0044] Figure 4 This invention demonstrates the IAA standard curve obtained. Detailed Implementation

[0045] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limitations on the elements of the embodiments or as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0046] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0047] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0048] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0049] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this invention, but do not exclude other aspects.

[0050] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0051] The first aspect of this invention provides a strain of *Brevibacillus laterosporus* LY15-1, deposited on February 8, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 33504. This microorganism was isolated from the rhizosphere soil of maize in Yinan County, Linyi City, Shandong Province. Based on morphological, physiological, biochemical, and molecular biological analyses, this strain was identified as *Brevibacillus laterosporus*.

[0052] According to an embodiment of the present invention, the colonies of the *Bacillus lateralis* LY15-1 of the present invention are round, small, off-white, with neat edges, a moist and smooth surface, no wrinkles, opaque, Gram-positive, with rod-shaped cells, boat-shaped lateral spores, elliptical, and enlarged sporangia.

[0053] According to an embodiment of the present invention, the *Bacillus lateralis* has a 16S rRNA sequence as shown in SEQ ID NO:1.

[0054] A second aspect of the present invention provides a microbial agent, the microbial agent comprising the *Bacillus retroflexus* described in the first aspect.

[0055] According to an embodiment of the present invention, the effective viable count of the *Bacillus laterosporus* strain in the microbial agent is at least 5.0 × 10⁻⁶. 10 CFU / g.

[0056] According to an embodiment of the present invention, the microbial agent is in the form of dry powder, and the microbial agent is prepared by the following steps: liquid fermentation culture of the Bacillus lateralis, collection of fermentation broth and spray drying to obtain the microbial agent.

[0057] According to an embodiment of the present invention, the culture medium for the liquid fermentation culture comprises, by weight:

[0058] 1 to 7 parts by weight of corn starch,

[0059] 1 to 7 parts by weight of soybean meal powder,

[0060] 0.2 to 1 part by weight of calcium carbonate,

[0061] 0.5 to 5 parts by weight of glucose,

[0062] 0.1–0.4 parts by weight of potassium dihydrogen phosphate,

[0063] 0.1–0.4 parts by weight of dipotassium hydrogen phosphate,

[0064] 0.1 to 0.3 parts by weight of magnesium sulfate,

[0065] 0.01 to 0.05 parts by weight of manganese sulfate.

[0066] According to an embodiment of the present invention, the indoleacetic acid (IAA) yield of the *Bacillus lateralis* or the microbial agent of the present invention reaches 92.65 mg / L.

[0067] A third aspect of the present invention provides a compound microbial agent, the compound microbial agent comprising the microbial agent described in the second aspect.

[0068] According to an embodiment of the present invention, the compound microbial agent includes a first microbial agent and a second microbial agent. The first microbial agent is the microbial agent described in the second aspect. The first microbial agent includes Bacillus lateralis. The second microbial agent includes at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus belye, and Bacillus amyloliquefaciens.

[0069] According to an embodiment of the present invention, the compound microbial agent comprises 20-50 parts by weight of the first microbial agent and 20-50 parts by weight of the second microbial agent; wherein the second microbial agent is selected from at least one of the following:

[0070] 20-50 parts by weight of Bacillus subtilis;

[0071] 20-50 parts by weight of Bacillus licheniformis;

[0072] 20-50 parts by weight of Bacillus belye;

[0073] 20-50 parts by weight of Bacillus amyloliquefaciens.

[0074] According to an embodiment of the present invention, the compound microbial agent includes Bacillus lateralis and at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus belye, and Bacillus amyloliquefaciens.

[0075] According to an embodiment of the present invention,

[0076] The effective viable count of the *Bacillus laterosporus* is at least 5.0 × 10⁻⁶. 10 CFU / g;

[0077] The effective viable count of the Bacillus subtilis is at least 1.0 × 10⁻⁶. 11 CFU / g;

[0078] The effective viable count of the *Bacillus licheniformis* is at least 1.0 × 10⁻⁶. 11 CFU / g;

[0079] The effective viable count of the *Bacillus belyssus* is at least 1.0 × 10⁻⁶. 11 CFU / g;

[0080] The effective viable count of the *Bacillus amyloliquefaciens* is at least 1.0 × 10⁻⁶. 11 CFU / g.

[0081] The fourth aspect of this invention provides a microbial fertilizer, which includes Bacillus retroflexus as described in the first aspect, and / or the microbial agent as described in the second aspect, and / or the compound microbial agent as described in the third aspect. The Bacillus retroflexus and the microbial agents and compound microbial agents containing it provided by this invention can play a positive role in the preparation of microbial fertilizers.

[0082] According to an embodiment of the present invention, the microbial fertilizer is a solid fertilizer, and the number of effective viable microorganisms contained in the microbial fertilizer is at least 1.8 × 10⁻⁶. 8 CFU / g; or, the microbial fertilizer is a liquid fertilizer, and the effective viable count of the microorganisms contained in the microbial fertilizer is at least 1.8 × 10⁻⁶. 8 CFU / mL.

[0083] According to an embodiment of the present invention, the microbial fertilizer further includes a base fertilizer, which includes at least one selected from compound fertilizer, organic fertilizer, and organic-inorganic fertilizer.

[0084] The fifth aspect of the present invention provides a method for fertilizing crops, comprising: applying an effective amount of at least one of Bacillus retroflexus, microbial agent, compound microbial agent, and microbial fertilizer to the crop, wherein the Bacillus retroflexus is the Bacillus retroflexus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the compound microbial agent is the compound microbial agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0085] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0086] The sixth aspect of the present invention provides a method for promoting crop seedling growth or preventing crop root rot, comprising: applying at least one of Bacillus retroflexus, microbial agent, compound microbial agent, and microbial fertilizer to the crop, wherein the Bacillus retroflexus is the Bacillus retroflexus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the compound microbial agent is the compound microbial agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0087] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0088] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0089] Example 1: Isolation and Identification of Bacillus Laterosporus LY15-1

[0090] Step 1: Isolation of Bacillus laterosporus LY15-1

[0091] Bacillus retroflexus LY15-1 was isolated from rhizosphere soil using a dilution-spreading method, specifically including the following steps:

[0092] 10g of rhizosphere soil from a cornfield in Yinan County, Linyi City, Shandong Province was placed in 90mL of sterile water, thoroughly shaken and dispersed, and allowed to stand at room temperature for 30 minutes to separate into layers. 1ml of the upper layer was taken and added to 9mL of sterile water, and then diluted sequentially to a 10:1 ratio. -4 10 -5 10 -6 Concentration. The dilution plate method was used to dilute 10... -4 10 -5 10 -6 The concentration of the diluted solution was taken, and 0.1 mL was evenly spread on LB plates. The plates were incubated at 37°C for 24 hours. Strains with different colony morphologies were selected and purified twice by streaking on LB plates to obtain strain LY15-1, which was then stored at 4°C for later use.

[0093] Step 2: Identification of Bacillus laterosporus LY15-1

[0094] The strain LY15-1 obtained in step one was identified in terms of morphological characteristics, physiological and biochemical characteristics, and molecular biological characteristics, as follows:

[0095] (1) Morphological characteristics

[0096] On LB agar plates, colonies are small, round, off-white, with neat edges, a moist and smooth surface, no wrinkles, and are opaque. Figure 1 As shown; Gram-positive, microscopic examination reveals rod-shaped cells with boat-shaped lateral spores, elliptical in shape, and enlarged sporangia, as... Figure 2 As shown.

[0097] (2) Physiological and biochemical characteristics

[0098] The fatty acid composition of strain LY15-1 was determined by analyzing the microbial fatty acid rapid identification system (MIDI). The main fatty acid of this strain is C. 15:0anteiso, C 15:0 iso,C 16:0 iso and C 16:0 The contents of these fatty acids were 57.19%, 23.05%, 3.67%, and 1.90%, respectively, and the specific fatty acid results are shown in Table 1. The strain of this invention conforms to the major cellular fatty acid characteristics of Brevibacillus.

[0099] Table 1. Fatty acid data for strain LY15-1

[0100]

[0101]

[0102] The carbohydrate metabolism capacity of this patented strain was detected using API 50CH, and the results are shown in Table 2. Positive reactions included glycerol, ribose, galactose, glucose, fructose, arbutin, aesculin, and maltose; weakly positive reactions included mannose, amygdalin, cellobiose, trehalose, and geraniol; negative reactions included control, erythrose, D-arabinose, L-arabinose, D-xylose, L-xylose, azirmonol, β-methyl-D-xylosylglycoside, sorbitol, rhamnose, eugenol, inositol, mannitol, sorbitol, α-methyl-D-mannoglycoside, and α-methyl-D-glucosylglycoside. The test results showed that the patented strain conformed to the biochemical metabolic characteristics of the genus *Brevibacillus*. The test included glycosides, N-acetylglucosamine, salicylate, lactose, melibiose, sucrose, inulin, pinealose, raffinose, starch, glycogen, xylitol, D-pinebiose, D-lysose, D-tagatose, D-rockose, L-rockose, D-arabinitol, L-arabinitol, gluconate, 2-keto-gluconate, and 5-keto-gluconate.

[0103] Table 2. API 50CH data for strain LY15-1

[0104]

[0105]

[0106] Note: + indicates positive; - indicates negative; w indicates weak positive.

[0107] (3) Molecular biological characteristics

[0108] The 16S rRNA gene sequence was determined using universal primers 27F and 1492R, yielding a 1386 bp gene fragment.

[0109] GGTTACCTCACCGACTTCGGGTGTTGCAAACTCCCGTGGTGTGACGGGCG

[0110] GTGTGTACAAGGCCCGGGAACGTATTCACCGCGGCATGCTGATCCGCGATT

[0111] ACTAGCGATTCCGACTTCATGTAGGCGAGTTGCAGCCTACAATCCGAACTG

[0112] AGATTGGTTTTAAGAGATTAGCATCTTCTCGCGAAGTAGCATCCCGTTGTAC

[0113] CAACCATTGTAGCACGTGTGTAGCCCAGGTCATAAGGGGCATGATGATTTG

[0114] ACGTCATCCCCGCCTTCCTCCGTCTTGTCGACGGCAGTCTCTCTAGAGTGC

[0115] CCAACTGAATGCTGGCAACTAAAGATAAGGGTTGCGCTCGTTGCGGGACTT

[0116] AACCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCA

[0117] CCACTGCCCCGAAGGGAAGCTCTATCTCTAGAGCGGTCAGTGGGATGTCAA

[0118] GACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCG

[0119] CTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACTCTTGCGAGCGTACTC

[0120] CCCAGGCGGAGTGCTTATTGCGTTAGCTGCGGCACTAAGGGTATTGAAACC

[0121] CCTAACACCTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATC

[0122] CTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAG

[0123] TCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACAC

[0124] GTGGAATACCACTTTCCTCTCCTGCACTCAAGCTACACAGTTTCCAATGCG

[0125] AACCGAGGTTGAGCCTCGGGCTTTAACATCAGACTTACATAGCCACCTGCG

[0126] CGCGCTTTACGCCCAATAATTCCGGACAACGCTTGCCACCTACGTATTACCG

[0127] CGGCTGCTGGCACGTAGTTAGCCGTGGCTTTCTCGTTAGGTACCGTCAAGG

[0128] TGCTACCTTATTTAAATAGCACTGTTTCTTCCCTAACAACAGAACTTTACGA

[0129] CCCGAAAGCCTTCATCGTTCACGCGGCGTTGCTCCATCAGACTTTCGTCCA

[0130] TTGTGGAAAATTCCCTACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTC

[0131] AGTCCCAGTGTGGCCGGTCACCCTCTCAGGTCGGCTACGCATCGTCGCCTT

[0132] GGTGAGCCGTTACCTCACCAACTAGCTAATGCGCCGCAGGCCCATCTGTAA

[0133] GTGATAGCTTGCGCCATCTTTCCGTTTCGCTTCAGGCGAAGCAAAACCCTAT

[0134] CCGGTATTAGCATAAGTTTCCCTATGTTATCCCAGTCTCACAGGCAGGTTGC

[0135] CTACGTGTTACTCACCCGTCCGCCGCTAGGGTCCGAAGACCCTCGCTCGACTGC (SEQ ID NO: 1)

[0136] The 16S rRNA sequence of the patented strain was analyzed by BLAST in NCBI, and a phylogenetic tree was constructed as follows: Figure 3 As shown. The results showed that the patented strain was similar to Brevibacillus laterosporus DSM 25. T They clustered into the same branch with 100% support.

[0137] Based on comprehensive morphological characteristics, physiological and biochemical properties, and molecular biological identification analysis, the patented strain was identified as *Brevibacillus laterosporus*.

[0138] Example 2: Determination of the synthetic ability of indoleacetic acid (IAA) in LY15-1

[0139] Weigh out indoleacetic acid (IAA) standard and prepare IAA standard solutions with concentrations of 10, 20, 40, 60, 80, and 100 mg / L using double-distilled water. Mix these solutions with Salkowski colorimetric solution at a 1:1 volume ratio, incubate at room temperature in the dark for 30 min, and then measure the OD values ​​at 530 nm for each concentration. Plot the OD values ​​at each concentration on the x-axis and the IAA standard solution concentration on the y-axis to obtain the IAA standard curve: y = 167.49x - 7.5123. (See...) Figure 4 .

[0140] The preserved LY15-1 strain was picked with an inoculation loop and inoculated into LB liquid medium. The culture was prepared by shaking at 37℃ and 200 rpm for 12 h to obtain a seed culture. The seed culture was then inoculated into sterilized fermentation medium (7% soybean meal, 5% corn starch, 0.5% calcium carbonate, 1.5% glucose, 0.3% potassium dihydrogen phosphate, 0.3% dipotassium hydrogen phosphate, 0.2% magnesium sulfate, 0.03% manganese sulfate, 0.1% L-tryptophan, pH adjusted to 7.6). The culture was continued at 37℃ and 200 rpm for 48 h, followed by centrifugation at 10000 rpm for 10 min. The supernatant was collected. 2 mL of the supernatant was mixed with an equal volume of Salkowski colorimetric reagent (1 mL of 0.5 mol / L FeCl3·6H2O added to 50 mL of 35% (v / v) HClO4). The mixture was incubated at room temperature in the dark for 30 min. The OD of the reaction solution was measured at 530 nm, and the OD was 0.598.

[0141] Substituting the OD value of 0.598 into the IAA standard curve, it can be seen that strain LY15-1 can generate 92.65 mg / L of indoleacetic acid (IAA) after 48 h of culture, demonstrating excellent IAA synthesis ability and growth-promoting effect.

[0142] Example 3: Preparation of Compound Microbial Agent and Verification of its Growth-Promoting Effect

[0143] This embodiment provides a compound microbial agent, which is prepared by the following method:

[0144] The preserved LY15-1 bacterial strain was sequentially inoculated into Erlenmeyer flasks containing 100 mL of LB broth (250 mL volume) and Erlenmeyer flasks containing 500 mL of LB broth (2000 mL volume), and incubated at 37℃ and 200 rpm in a shaking incubator for 12 h. The above bacterial culture was then inoculated into scale-up fermenters (50 L-500 L volume) and incubated at 37℃ for stepwise fermentation. The scale-up fermentation medium formula was: 7% soybean meal, 5% corn starch, 0.5% calcium carbonate, 1.5% glucose, 0.3% potassium dihydrogen phosphate, 0.3% dipotassium hydrogen phosphate, 0.2% magnesium sulfate, 0.03% manganese sulfate, and pH adjusted to 7.6. After mixing the fermentation broth with magnesium sulfate, it was spray-dried to obtain an effective viable count of 5.0 × 10⁻⁶ cells / mL. 10 CFU / g of Bacillus lateralis LY15-1 microbial inoculum.

[0145] Following the LY15-1 microbial inoculant preparation process, Bacillus subtilis inoculants (preservation number CGMCC No. 19584, effective viable count 1.0 × 10⁻⁶) were prepared using appropriate culture media and fermentation conditions. 11 CFU / g), Bacillus licheniformis inoculant (self-selected strain number LY9-1, effective viable count 1.0×10⁻⁶). 11 CFU / g), Bacillus belysin inoculum (preservation number CGMCC No. 25831, effective viable count 1.0×10⁻⁶). 11 CFU / g), Bacillus amyloliquefaciens inoculum (preservation number CGMCC No. 25835, effective viable count 1.0 × 10⁻⁶). 11 (CFU / g) The *Bacillus subtilis*, *Bacillus licheniformis*, *Bacillus belyss*, and *Bacillus amyloliquefaciens* strains mentioned above were all functional strains independently screened by the applicant. Two of these bacterial agents were each combined with *Bacillus laterosporus* in a 1:1:1 ratio to prepare three groups (T1: LY15-1 + *Bacillus subtilis* + *Bacillus licheniformis*; T2: LY15-1 + *Bacillus subtilis* + *Bacillus belyss*; T3: LY15-1 + *Bacillus subtilis* + *Bacillus amyloliquefaciens*). Simultaneously, a commercially available *Bacillus laterosporus* agent (with an effective viable count of 5.0 × 10⁻⁶) was also used.10 CFU / g) was mixed with self-made Bacillus subtilis inoculum and Bacillus amyloliquefaciens inoculum at a mass ratio of 1:1:1 to form CK2.

[0146] To verify the effectiveness of potted maize cultivation, each pot contained 7 kg of soil and 2 maize plants, with 15 pots per treatment group. After maize emergence, 20 mL of 8.3 × 10⁻⁶ solution was used. 7 The compound microbial agent (CFU / mL) was accurately weighed 1.0g and thoroughly mixed with 1L of sterile water for root irrigation. The control group CK1 was irrigated with normal water volume. The growth promotion results were tracked for 30 days. The growth promotion results of maize with the compound microbial agent are shown in Table 3.

[0147] Table 3 Results of the experiment on the growth promotion effect of compound microbial agent on maize

[0148] Plant height / cm Stem diameter / mm Average fresh weight / g Root length / cm Fresh root weight / g CK1 34.88 7.04 9.08 24.38 2.97 CK2 35.23 7.16 9.87 26.22 3.18 T1 39.25 7.51 11.84 29.88 3.90 T2 40.16 7.55 12.07 30.63 3.28 T3 39.63 7.92 12.35 31.16 4.02

[0149] The results showed that the compound microbial agent had a significant growth-promoting effect on potted maize. Among them, the T3 treatment had the best growth-promoting effect, increasing plant height, stem diameter, average fresh weight, root length, and root fresh weight by 13.62%, 12.50%, 36.01%, 27.81%, and 35.35%, respectively, compared with CK1. The T2 treatment was slightly better than T1, increasing plant height, stem diameter, average fresh weight, root length, and root fresh weight by 15.14%, 7.24%, and 32.9%, respectively, compared with CK1. The growth rates of T1, T2, and T3 were 3%, 25.64%, and 10.44%, respectively. Compared with CK1, T1 showed increases of 12.53%, 6.68%, 30.40%, 22.56%, and 31.31% in plant height, stem diameter, average fresh weight, root length, and root fresh weight, respectively. CK2 was significantly less effective than T1, T2, and T3, with increases of only 1.00%, 1.70%, 8.70%, 7.55%, and 7.07% in plant height, stem diameter, average fresh weight, root length, and root fresh weight, respectively. Therefore, the *Bacillus laterosporus* strain of this invention possesses excellent growth-promoting properties.

[0150] Example 4: Preparation and Application of Microbial Fertilizer

[0151] In the organic fertilizer and compound fertilizer coating process, the compound microbial agents CK2, T1, T2, and T3 prepared in Example 3 were mixed evenly with the anti-caking powder, and then added to the granular organic fertilizer (total nutrients ≥5%, organic matter ≥30%) and pure sulfur-based compound fertilizer 15-15-15 / S at a ratio of 3‰ by mass of the compound microbial agents. The resulting fertilizers are microbial fertilizers with a theoretical viable count of 2.5 × 10⁻⁶. 8 CFU / g, effective viable bacteria count ≥1.8×10 8 CFU / g.

[0152] The prepared microbial fertilizer was tested in the field to verify its effectiveness. Experiments were conducted in Linyi City, Shandong Province. A total of seven treatments were set up, including control groups CK1-3 and experimental groups T1-T6. Each treatment consisted of three plots, each plot measuring 40m². 2 The fertilizer application rate was 50 kg / mu of compound fertilizer or 30 kg / mu of compound fertilizer + 20 kg / mu of organic fertilizer. The control group CK1 was treated with pure sulfur-based compound fertilizer 15-15-15 / S, without the addition of microbial agents. The maize was harvested and the yield was measured after 120 days of the entire growth period. The specific treatments and effects are shown in Table 4.

[0153] Table 4. Experimental results of different treatments of microbial fertilizer

[0154]

[0155] The results showed that the yield of corn per mu (a Chinese unit of area, approximately 0.067 hectares) of organic fertilizer and compound fertilizer with added T1, T2 and T3 microbial agents in Example 3 was significantly better than that of control CK1 and organic fertilizer and compound fertilizer with added CK2 microbial agent in Example 3. This indicates that the organic fertilizer and compound fertilizer with added Bacillus laterosporus of the present invention achieved excellent growth-promoting effect under the growth-promoting effect of Bacillus laterosporus of the present invention.

[0156] Example 5: Effect of LY15-1 compound microbial agent on root rot control

[0157] Soil from areas affected by maize root rot was used to verify the disease resistance of potted maize. Each pot contained 7 kg of soil and 2 maize plants, with 15 pots per treatment group. At transplanting, the control group CK1 received normal fertilization and watering; the control group CK2 received the CK2 compound microbial agent (commercially available Bacillus laterosporus + Bacillus subtilis + Bacillus amyloliquefaciens) from Example 3, applied at 20 mL with a concentration of 8.3 × 10⁻⁶ at transplanting. 7 Root drenching was performed with a compound bacterial agent at a concentration of 8.3 × 10⁻⁶ CFU / mL. One week after transplanting, 20 mL of the agent at a concentration of 8.3 × 10⁻⁶ CFU / mL was used. 7 The compound microbial agent was applied twice via irrigation at a concentration of CFU / mL; experimental group T1 used the T3 compound microbial agent (LY15-1 + Bacillus subtilis + Bacillus amyloliquefaciens) from Example 3, with 20 mL of 8.3 × 10⁻⁶ CFU / mL at transplanting time. 7 The roots were drenched with a compound bacterial agent at a concentration of 8.3 × 10⁻⁶ CFU / mL; experimental group T2, based on T1, was drenched with 20 mL of a compound bacterial agent at a concentration of 8.3 × 10⁻⁶ CFU / mL one week after transplanting. 7 The compound bacterial agent at CFU / mL was applied twice via irrigation. After 60 days, the number of healthy plants, infected (but not dead) plants, and dead plants in each treatment were counted to calculate the mortality rate, disease incidence rate, and relative control efficacy. The results are shown in Table 5.

[0158] Table 5. Disease incidence of root rot in potted corn plants treated with LY15-1 compound microbial agent.

[0159] serial number Number of healthy plants Number of susceptible strains Number of dead plants case fatality rate Incidence rate Relative efficacy CK1 6 8 16 53.3% 80.0% / CK2 7 9 14 46.6% 76.6% 4.25% T1 14 8 8 26.7% 53.3% 33.38% T2 22 5 3 10.0% 26.7% 66.63%

[0160] Note: Mortality rate (%) = Number of dead plants / Total number of plants × 100%

[0161] Incidence rate (%) = (Number of infected plants + Number of dead plants) / Total number of plants × 100%

[0162] Relative efficacy (%) = (Control incidence rate - Treatment incidence rate) / Control incidence rate × 100%

[0163] The results showed that the incidence rate of maize plants in CK1 reached 80.0%, and the mortality rate was as high as 53.3%; the incidence rate of maize plants in CK2 reached 76.6%, and the mortality rate was as high as 46.6%; in the T1 treatment, the incidence rate was 53.3%, and the mortality rate was 26.7%; in the T2 treatment, the incidence rate was only 26.7%, and the mortality rate was 10.0%. The T1 and T2 treatments reduced the incidence and mortality rates of maize root rot, with relative control efficacy of 33.38% and 66.63%, respectively. The incidence and mortality rates of maize root rot in CK2 were slightly reduced, with a relative control efficacy of only 4.25%. This indicates that *Bacillus laterosporus* LY15-1 has a significant control effect on maize root rot.

[0164] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "implementation" refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0165] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A type of Laterospora brevispera ( Brevibacillus laterosporus It was deposited on February 8, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 33504.

2. A microbial inoculant, characterized in that, The microbial agent includes Bacillus retroflexus as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The effective viable count of *Bacillus laterosporus* in the microbial agent is at least 5.0 × 10⁻⁶. 10 CFU / g.

4. The microbial agent according to claim 3, characterized in that, The microbial agent is in the form of dry powder.

5. A compound microbial agent, characterized in that, The microbial agent comprising any one of claims 2-4.

6. The compound microbial agent according to claim 5, characterized in that, The effective viable count of *Bacillus laterosporus* in the compound microbial agent is at least 5.0 × 10⁻⁶. 10 CFU / g.

7. A microbial fertilizer, characterized in that, The microbial fertilizer includes Bacillus lateralis as described in claim 1, the microbial agent as described in any one of claims 2-4, or the compound microbial agent as described in any one of claims 5-6.

8. The microbial fertilizer according to claim 7, characterized in that, The microbial fertilizer is a solid fertilizer, and the effective viable count of microorganisms contained in the microbial fertilizer is at least 1.8 × 10⁻⁶. 8 CFU / g; Alternatively, the microbial fertilizer is a liquid fertilizer, and the number of effective viable microorganisms contained in the microbial fertilizer is at least 1.8 × 10⁻⁶. 8 CFU / mL.

9. The microbial fertilizer according to claim 8, characterized in that, The microbial fertilizer further includes a base fertilizer, which includes at least one selected from compound fertilizer, organic fertilizer, and organic-inorganic fertilizer.

10. A fertilization method for corn, characterized in that, include: The corn is treated with at least one of Bacillus lateralis, microbial agents, compound microbial agents, and microbial fertilizers, wherein the Bacillus lateralis is the Bacillus lateralis as described in claim 1, the microbial agents are the microbial agents as described in any one of claims 2-4, the compound microbial agents are the compound microbial agents as described in any one of claims 5-6, and the microbial fertilizers are the microbial fertilizers as described in any one of claims 7-9.

11. A method for promoting seedling growth or controlling root rot in maize, characterized in that, include: The corn is treated with at least one of Bacillus lateralis, microbial agents, compound microbial agents, and microbial fertilizers, wherein the Bacillus lateralis is the Bacillus lateralis as described in claim 1, the microbial agents are the microbial agents as described in any one of claims 2-4, the compound microbial agents are the compound microbial agents as described in any one of claims 5-6, and the microbial fertilizers are the microbial fertilizers as described in any one of claims 7-9.

Citation Information

Patent Citations

  • Brevibacillus laterosporus, microbial inoculum and application of brevibacillus laterosporus in biological medicine fertilizer

    CN114480197A