Application of tobacco male sterility related gene NtCYP704B1 and method for creating sterile line

The tobacco male sterility gene NtCYP704B1 was double mutations through CRISPR/Cas9 technology, creating a tobacco male sterile line, solving the problem of insufficient resources of sterile line in tobacco breeding, and achieving improvements in breeding efficiency and seed quality.

CN120424960AActive Publication Date: 2025-08-05YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510568398.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-05
Estimated Expiration
2045-04-30

AI Technical Summary

Technical Problem

The lack of excellent sterile lines in tobacco breeding leads to low purity, poor consistency of inbred line planting varieties, high production costs, and low resource utilization rate of existing sterile lines, making it difficult to achieve hybrid advantage utilization.

Method used

CRISPR/Cas9 technology was used to mutate the two paralogic genes NtCYP704B1-T and NtCYP704B1-S of tobacco male sterility-related genes NtCYP704B1 to simultaneously inhibit their expression and create tobacco male sterility materials.

Benefits of technology

Tobacco male sterility has been achieved, sterile material resources have been enriched, and the problems of single and high cost of sterile lines in tobacco breeding have been solved, which has improved breeding efficiency and consistent seed quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120424960A_ABST
    Figure CN120424960A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of plant biotechnology breeding, and particularly relates to application of a tobacco male sterility related gene NtCYP704B1 and a method for creating a sterile line. According to the gene mutant, two para-line homologous genes NtCYP704B1-T and NtCYP704B1-S of a tobacco male sterility related gene NtCYP704B1 are subjected to simultaneous mutation; in the gene mutant, the nucleotide sequence of an NtCYP704B1-T mutant gene is as shown in SEQ ID NO. 5; the nucleotide sequence of the NtCYP704B1-S mutant gene is as shown in SEQ ID NO. 6; the amino acid sequences coded by the NtCYP704B1-T mutant gene and the amino acid sequences coded by the NtCYP704B1-S mutant gene are respectively as shown in SEQ ID NO. 7 and SEQ ID NO. 8. According to the invention, through a CRISPR / Cas9 gene editing technology, two para-line homologous genes of NtCYP704B1 are simultaneously subjected to site-directed mutagenesis in common tobacco, and the NtCYP704B1-T / S mutant is created, and the mutant can cause complete male sterility. The invention further provides a method for creating the tobacco male sterile line, and the method has important application value in tobacco male sterile line cultivation and hybrid seed production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology breeding, and particularly relates to the application of tobacco male sterility-related gene NtCYP704B1 and a method for creating a sterile line. Background Art

[0002] Tobacco is a major cash crop, but the tobacco seed industry currently faces the following challenges: First, due to factors such as the lack of fundamental breakthroughs in basic research on tobacco male sterility, intellectual property protection for tobacco inbred lines is difficult. This has led to a long-standing phenomenon of follow-up and imitative breeding in the tobacco seed industry in recent years, and the efficiency of selecting and breeding major new varieties has been slow. Second, the cultivation of tobacco inbred lines is plagued by the problem of farmers retaining their own seeds, resulting in an unregulated production of cultivated varieties. The resulting tobacco leaves are of low purity and poor consistency, impacting the application of tobacco industry formulas and the stability of cigarette product quality. Third, the tobacco seed production industry remains labor-intensive and relies primarily on artificial pollination, which is costly, resource-intensive, and difficult to guarantee seed quality.

[0003] Compared to other model plants like rice and maize, tobacco still lags behind in the utilization of heterosis, primarily due to a lack of high-quality male sterility lines. Male sterility lines, primarily cytoplasmic male sterility (CMS) and nuclear male sterility (GMS), are crucial materials for harnessing heterosis and hybrid seed production in crops. CMS, controlled by both mitochondrial and nuclear genes, has been applied in tobacco breeding and hybrid production, but currently only one cytoplasmic male sterility line is available. This leads to problems such as low resource utilization, a single cytoplasmic male sterility line, and disease susceptibility. GMS, controlled solely by nuclear genes, can overcome the shortcomings of CMS, but it is difficult to mass-produce homozygous male sterile lines through conventional breeding methods. Recent advances in biotechnology have led to the development of tobacco multi-functional male sterility technologies and universal dominant male sterility techniques, developed through a combination of genetic engineering and molecular design breeding. These technologies have effectively addressed the maintenance and propagation of recessive nuclear male sterile lines in tobacco. A crucial prerequisite for the application of these technologies is the availability of a large number of GMS genes with well-defined functions that control male development in tobacco and the corresponding male sterile materials. Compared with the model plant Arabidopsis thaliana and the model crop rice, there are no reports on the cloning, identification and creation of GMS genes in tobacco. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention provides an application of the tobacco male sterility-related gene NtCYP704B1 and a method for creating sterile lines. The present invention uses CRISPR / Cas9 technology to edit the tobacco male sterility-related gene NtCYP704B1 and create male sterile materials, enriching the tobacco sterility material resources.

[0005] In order to achieve the above technical objectives, the present invention provides the following technical solutions:

[0006] Application of tobacco male sterility-related gene NtCYP704B1: simultaneous mutation of two paralogous genes NtCYP704B1-T and NtCYP704B1-S of tobacco male sterility-related gene NtCYP704B1 to inhibit the expression of NtCYP704B1 gene in tobacco, so as to achieve tobacco male sterility;

[0007] The nucleotide sequence of the NtCYP704B1-T gene is shown in SEQ ID NO.1.

[0008] The nucleotide sequence of the NtCYP704B1-S gene is shown in SEQ ID NO.2.

[0009] A gene mutant for controlling tobacco male sterility, wherein the gene mutant is obtained by simultaneously mutating two paralogous genes NtCYP704B1-T and NtCYP704B1-S of the tobacco male sterility-related gene NtCYP704B1;

[0010] Among the gene mutants, the nucleotide sequence of the NtCYP704B1-T mutant gene is shown as SEQ ID NO.5; the nucleotide sequence of the NtCYP704B1-S mutant gene is shown as SEQ ID NO.6.

[0011] Furthermore, the amino acid sequences encoded by the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

[0012] The invention discloses an application of a tobacco male sterile gene mutant and an application of the gene mutant in creating a tobacco male sterile line.

[0013] A method for creating a tobacco male sterile line, comprising: using the CRISPR / Cas9 method to simultaneously perform gene editing on two paralogous genes of the NtCYP704B1 gene, NtCYP704B1-T and NtCYP704B1-S, to obtain a gene editing vector; and using Agrobacterium-mediated transfection to obtain a NtCYP704B1-T / S double-mutant male sterile line in which both the NtCYP704B1-T gene and the NtCYP704B1-S gene are edited.

[0014] Among them, after gene editing using the CRISPR / Cas9 method, the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown as SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0015] Furthermore, when using the CRISPR / Cas9 method for gene editing, CRISPR / Cas9 vector editing target sites with nucleotide sequences as shown in SEQ ID NO.9 and SEQ ID NO.10 were designed at the first exon and homologous regions of the NtCYP704B1-T gene and the NtCYP704B1-S gene.

[0016] Furthermore, the constructed gene editing vector is PKSE401-GFP-NtCYP704B1, and the basic vector of the gene editing vector is PKSE401-GFP.

[0017] Furthermore, an upstream primer NtCYP704B1-TF and a downstream primer NtCYP704B1-TR were designed for detecting the target site of the NtCYP704B1-T gene. The sequences of the upstream primer NtCYP704B1-TF and the downstream primer NtCYP704B1-TR are shown in SEQ ID NO. 15 and SEQ ID NO. 16, respectively.

[0018] An upstream primer NtCYP704B1-SF and a downstream primer NtCYP704B1-SR were designed to detect the target site of the NtCYP704B1-S gene. The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR are shown as SEQ ID NO.17 and SEQ ID NO.18, respectively.

[0019] Application of NtCYP704B1-T / S double-mutant sterile line in hybrid breeding and seed production.

[0020] Furthermore, the application in hybrid breeding and seed production refers to using the NtCYP704B1-T / S double-mutant sterile line as the female parent to hybridize with other male parents to obtain fertile hybrid seeds F1, and using the hybrid seeds F1 for production and planting.

[0021] The beneficial effects of the present invention are:

[0022] This invention, for the first time, achieves tobacco male sterility by inhibiting the expression of the NtCYP704B1 gene in tobacco. The discovery that two paralogous genes of NtCYP704B1, NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664), and their encoded proteins, regulate tobacco male reproductive development is not previously disclosed. By utilizing CRISPR / Cas9 to simultaneously mutate the tobacco genes NtCYP704B1-T and NtCYP704B1-S, the present invention discovered that simultaneous mutations in both NtCYP704B1 paralogs, NtCYP704B1-T and NtCYP704B1-S, cause tobacco male sterility.

[0023] The present invention obtains a gene editing vector by utilizing the CRISPR / Cas9 gene editing method, and then obtains the NtCYP704B1-T / S double-mutant sterile line in which both the NtCYP704B1-T gene and the NtCYP704B1-S gene are edited through Agrobacterium-mediated transfection, thereby being applicable to tobacco hybrid breeding and seed production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The phenotype of the wild-type flower of the tobacco inbred line K326 of the present invention;

[0025] Figure 2 The phenotypes of the male buds and stigmas of the wild-type tobacco inbred line K326 of the present invention are:

[0026] Figure 3 The results of the pollen viability test of the wild-type tobacco inbred line K326 in the present invention are as follows;

[0027] Figure 4 The phenotype of the flower of the NtCYP704B1-T / S double-stranded sterile line in the embodiment of the present invention;

[0028] Figure 5 The phenotypes of the male buds and stigmas of the NtCYP704B1-T / S double-stranded sterile line in the embodiment of the present invention are shown;

[0029] Figure 6 The results of the pollen viability test of the mutant of the NtCYP704B1-T / S double-sterile line in the embodiment of the present invention are shown;

[0030] Figure 7 The anthers are those of the NtCYP704B1-T / S double-male sterile line in the examples of the present invention;

[0031] Figure 8 The inner wall of the anther of the NtCYP704B1-T / S double-stranded sterile line in the embodiment of the present invention;

[0032] Figure 9 The anthers are wild-type anthers of the tobacco inbred line K326 of the present invention;

[0033] Figure 10 It is the anther inner wall of the wild type tobacco inbred line K326 in the present invention. DETAILED DESCRIPTION

[0034] The following examples are used to illustrate the present invention, but do not limit the scope of the present invention. Without departing from the spirit and essence of the present invention, the modifications or replacements made to the method, steps or conditions of the present invention are within the scope of the present invention. Unless otherwise specified, the primers used in the examples were completed by Beijing Qingke Biotechnology Co., Ltd., and sequencing was completed by Quintiles (Wuhan) Biotechnology Co., Ltd. Other biochemical reagents are conventional commercial reagents unless otherwise specified, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0035] Example 1: Functional Study of the Tobacco Ntcyp704b1 Gene and Creation of Tobacco Male Sterile Lines Using CRISPR / Cas9 Method:

[0036] In the tobacco database (National Center for Biotechnology Information (nih.gov)), it was found that tobacco NtCYP704B1 has two paralogous genes, namely NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664). In the tobacco inbred line K326, the nucleotide sequences of the NtCYP704B1-T gene and the NtCYP704B1-S gene are shown in SEQ ID NO.1 and SEQ ID NO.2; the NtCYP704B1-T (LOC107791425) gene is functionally annotated as cytochrome P450704B1-like, and its encoded protein contains 510 amino acids, the sequence of which is shown in SEQ ID NO. NO.3; the NtCYP704B1-S (LOC107809664) gene function is annotated as cytochrome P450704B1-like, and its encoded protein contains 519 amino acids, and the sequence is shown in SEQ ID NO.4.

[0037] There is no published research data on the actual function of the Ntcyp704b1 gene in tobacco. To clarify the functions of tobacco NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) genes in tobacco, the present invention uses CRISPR / Cas9 gene editing to mutate the NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) gene sequences and knock out the function of the gene in tobacco.

[0038] The present invention uses the tobacco inbred line K326 as the receptor material for gene editing. Construction of the CRISPR / Cas9 gene editing vector for NtCYP704B1: The gene editing vector of the present invention is PKSE401-GFP-Ntcyp704b1, which uses the base vector PKSE401-GFP and the intermediate vector pCBC mT1T2 to provide gRNA. The present invention designs target sites on primers, then uses PCR to obtain MT-sgRNA, which is then ligated into the base vector via enzyme digestion. The specific construction process is as follows:

[0039] (1) The gene sequence of NtCYP704B1 (including two paralogous genes, NtCYP704B1-T and NtCYP704B1-S) was input into http: / / targetDesign(scau.edu.cn) for target design. The nucleotide sequences of the CRISPR / Cas9 vector editing targets shown in SEQ ID NO. 9 and SEQ ID NO. 10 were designed in the first exon and homologous regions of the NtCYP704B1-T and NtCYP704B1-S genes. The sgRNA backbone sequence of the present invention was directly amplified from the intermediate vector pCBC mT1T2.

[0040] (2) MT-sgRNA was obtained by designing target sites on primers and then PCR amplification. Primers Ntcyp704b1-MT1-BsF, Ntcyp704b1-MT1-F0, Ntcyp704b1-MT1-R0, and Ntcyp704b1-MT1-BsR were used to amplify the intermediate vector pCBCmT1T2. Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. -BsF / -BsR are normal primer concentrations; -F0 / -R0 are diluted 20-fold. The fragments used to obtain sgRNA were all 626 bp in length. The PCR system and conditions were as follows: 2 μL template DNA (intermediate vector pCBCmT1T2 ≥ 30 ng / μL); 1 μL each of primers BsF, F0 / BsR, and R0; 1 μL enzyme; 1 μL dNTP; 25 μL buffer; 17 μL sterile ddH2O; PCR temperature program: ① 95°C for 5 minutes; ② 95°C for 30 seconds; ③ 58°C for 30 seconds; ④ 72°C for 35 seconds; ⑤ 34 cycles from ② to ④; ⑥ 72°C for 10 minutes; ⑦ 25°C for 10 minutes. The PCR product was recovered.

[0041] Among them, the sequences of the primers Ntcyp704b1-MT1-BsF, Ntcyp704b1-MT1-F0, Ntcyp704b1-MT1-R0, and Ntcyp704b1-MT1-BsR required for vector construction are as follows:

[0042] Ntcyp704b1-MT1-BsF:5'-ATATATGGTCTCGATTGCATACATTGGCCTATTATTGTT-3'(SEQID NO.11)

[0043] Ntcyp704b1-MT1-F0:5'-TGCATACATTGGCCTATTATTGTTTTAGAGCTAGAAATA GC-3'(SEQ ID NO.12)

[0044] Ntcyp704b1-MT1-R0:5'-AACAAGTTGTAGACCACGTTGGCAATCTCTTAGTCGA CTCTAC-3'(SEQ ID NO.13)

[0045] Ntcyp704b1-MT1-BsR:5'-ATTATTGGTCTCGAAACAAGTTGTAGACCACGTTGG CAA-3'(SEQID NO.14)

[0046] (3) Enzyme digestion-ligation system: The PKSE401-GFP vector and the recovered target-carrying sgRNA fragment were digested with BsaI, and T4 ligase was added to connect the vector and sgRNA fragment. The 15 μL enzyme digestion and ligation system is as follows: sgRNA fragment: 2 μL, PKSE401-GFP vector (≥60 ng / μL): 2 μL, 10x NEB Buffer: 1.5 μL, 10x T4 DNA Ligase Buffer: 1.5 μL, BsaI endonuclease (product number: #R3733): 1 μL, T4 ligase (product number: EL0011): 1 μL, sterile ddH2O: 6 μL; the expression vector PKSE401-GFP-NtCYP704B1 was constructed; the expression vector includes the target (MT1) of the target gene NtCYP704B1-T (LOC107791425) and the target (MT1) of NtCYP704B1-S (LOC107809664), the marker gene Cas9 and the resistance Kana. Among them, from the left border to the right border of T-DNA are the expression cassette of resistance Kana; the expression cassette of nuclease encoding gene Cas9; 35S enhancer; the expression cassette of NtCYP704B1-T and NtCYP704B1-S gene target 1 (MT1); U6 promoter; GFP fluorescent protein tag; 35S promoter.

[0047] Agrobacterium-mediated genetic transformation of tobacco:

[0048] (1) Preparation of sterile seedlings

[0049] Place an appropriate amount of K326 seeds in a 2.0mL centrifuge tube and soak in 1.5mL of room-temperature distilled water for 12-24 hours. Wash away any unfilled seeds and impurities floating on the water surface. Sterilize the seeds in a laminar flow hood. First, add 1.5mL of 75% medical alcohol and invert the tube for 45 seconds. Allow the tube to settle and discard the alcohol with a pipette. Add 1.5mL of sterile water and invert the tube twice. Allow the tube to settle and discard the water with a pipette. Repeat this step twice. Then, add 1.5mL of 84 disinfectant (NaClO) and invert the tube for 4 minutes. Allow the tube to settle and discard the 84 disinfectant with a pipette. Add 1.5mL of sterile water and invert the tube twice. Allow the tube to settle and discard the water with a pipette. Repeat this step five times. Finally, the sterilized seeds were evenly spread on the MS plate (culture medium: MS + 30g / L sucrose + 7g / L agar + pH 5.8), the water on the surface of the MS plate was blown dry, and then the plate was sealed and placed in a 25°C light culture room for culture.

[0050] After the seeds germinate and begin to grow true leaves (about 2 weeks), the tobacco plants are transferred to tissue culture boxes for cultivation. When the tobacco seedlings have 10 cotyledons (about 4 weeks) in the tissue culture boxes, they can be used for infection.

[0051] (2) Preparation of bacterial solution

[0052] Remove the transformed strain from -80°C and inoculate it into 5 mL of triple-antibody (rifampicin, gentamicin, and kanamycin) LB medium. Incubate at 28°C in a shaker (180 rpm) for 24 hours. Inoculate 1 mL of the bacterial suspension into a 50 mL LB flask containing triple-antibody LB medium. Incubate at 28°C until the OD600 is approximately 0.6-0.8 (4-6 hours). Pour the mixture into a culture dish and set aside.

[0053] (3) Pre-culture

[0054] Select the fully expanded and strong leaves in the middle of the sterile tobacco seedlings, cut off the leaf margins, main veins and petioles, cut the leaves into 0.8cm × 0.8cm size, place the leaves with the back facing up on the pre-culture medium, the composition of the pre-culture medium is the same as the co-culture medium, 6-8 leaves per dish, and pre-culture at 28℃ in the dark for 3 days.

[0055] (4) Agrobacterium infection.

[0056] Place the pre-cultured leaves into the prepared Agrobacterium solution and soak for 8-10 minutes. During this time, gently shake the culture dish several times to ensure full contact between the bacterial solution and the material. Take out the leaves and place them on sterile filter paper to absorb excess bacterial solution.

[0057] (5) Co-cultivation.

[0058] Inoculate the leaves onto the co-culture medium with the back of the leaves facing upwards, and co-culture at 28°C in the dark for 2 days.

[0059] (6) Screening and differentiation.

[0060] The leaves were transferred to screening medium for screening and differentiation of resistant buds, and the medium was replaced every 15 days.

[0061] (7) Rooting culture.

[0062] When the leaves on the screening medium grow obvious resistant buds, cut the resistant buds and transfer them to the rooting medium for rooting culture. After the roots grow, transfer them to nutrient pots for hardening. After one month, transfer them to the greenhouse. After 3-4 months, harvest the offspring seeds.

[0063] Detection of CRISPR / Cas9 mutation results in T0 generation plants: To determine the CRISPR / Cas9 mutation results in T0 generation plants, the following steps were taken:

[0064] First, the CTAB method was used to extract tobacco leaf DNA: 2 cm long seedling leaves were cut and placed in a 2 mL centrifuge tube filled with steel balls; the centrifuge tube containing the leaves was immersed in liquid nitrogen for 5 minutes, and then the leaf samples were broken up using a grinder; 700 μL of CTAB extraction buffer (containing 1% β-mercaptoethanol) was vigorously shaken and mixed, and preheated in a constant temperature water bath at 65°C for 20-30 minutes (during which time, the tube was taken out and inverted 1-2 times, and attention was paid to the correspondence of the experimental sample number); after the centrifuge tube was cooled to room temperature, 700 μL of chloroform: isoamyl alcohol (24:1) extraction solution was added, and after vigorous shaking for 30 seconds, it was allowed to stand for a while at room temperature; at 4°C, centrifuged at 12000 rpm for 5 minutes, and 500 μL of the supernatant after centrifugation was taken into a new 1.5 mL centrifuge tube; an equal volume of isopropanol was added to the centrifuge tube containing the supernatant and gently shaken to mix, and allowed to stand at room temperature for about 10 minutes; then the centrifuge tube containing the sample was placed in a 4°C centrifuge, centrifuged at 12000 rpm for 10 minutes, and the supernatant was gently aspirated, the supernatant was discarded, and the precipitate was retained; 800 μL Wash the precipitate twice with 75% ethanol, centrifuge at 10,000 rpm for 5 minutes, and discard the supernatant. Allow the sample to dry naturally at room temperature for 2-4 hours to obtain a DNA precipitate. Dissolve the DNA in sterile water and gently shake until the DNA is fully dissolved. Store the DNA sample at -20°C.

[0065] PCR primers were designed based on the NtCYP704B1-T (LOC107791425) gene sequence to detect the target MT1. The designed primers include the upstream primer NtCYP704B1-TF and the downstream primer NtCYP704B1-TR for detecting the NtCYP704B1-T gene target site. The primer sequences are as follows:

[0066] NtCYP704B1-T upstream primer: CACAGCATGCAAAGACTGTTGA (SEQ ID NO.15)

[0067] NtCYP704B1-T downstream primer: TCCCCACCGAAAGAATAACAA (SEQ ID NO.16)

[0068] PCR primers were designed based on the NtCYP704B1-S (LOC107809664) gene sequence to detect the target MT1. The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR were designed to detect the target site of the NtCYP704B1-S gene. The primer sequences are as follows:

[0069] NtCYP704B1-S upstream primer: TGAGGTGTGTTGTGGAAGTCA (SEQ ID NO.17)

[0070] NtCYP704B1-S downstream primer: AGTTGTAGACCACGTTGGGAC (SEQ ID NO.18)

[0071] In order to detect gene mutations in transgenic positive plants and their offspring with high throughput, high-throughput self-built library sequencing was performed. The experimental principle is to perform sequencing after two rounds of PCR: (1) Use site-specific primers (SSP) to perform the first round of PCR amplification on the DNA fragment containing the target site; the designed specific primers need to add common bridging sequences at their 5' end: the 5' end of the F primer adds: 5'-ggagtgagtacggtgtgc-3', and the 5' end of the R primer adds: 5'-gagttggatgctggatgg-3'; (2) Use a set of universal barcoding primers for the second round of amplification; (3) The second round amplification products from different plants are mixed in equal amounts, tested, and sent to the company for double-end 150bp second-generation sequencing; (4) The mutation sequence is decoded and analyzed online on the Hi-TOM website (http: / / www.hi-tom.net / hi-tom / ) to determine the mutation type of each plant at each target site.

[0072] Through high-throughput detection, it was determined whether gene editing occurred in the target region. Ultimately, it was found that the target region sequences of both genes in one T0 transformation event had changed, and a gene mutant was determined to have been produced. The gene mutant was a simultaneous mutation of two paralogous genes, NtCYP704B1-T and NtCYP704B1-S, of the tobacco male sterility-related gene NtCYP704B1. In the gene mutant, the nucleotide sequence of the NtCYP704B1-T mutant gene is shown in SEQ ID NO.5; the nucleotide sequence of the NtCYP704B1-S mutant gene is shown in SEQ ID NO.6.

[0073] The Ntcyp704b1 double mutant, NtCYP704B1-T / S-Cas9, is a homozygous double mutant of NtCYP704B1. The wild-type NtCYP704B1-T (WT-NtCYP704B1-T) gene is 1533 bp long, comprising six exons and five introns. The wild-type NtCYP704B1-S (WT-NtCYP704B1-S) gene is 1560 bp long, comprising six exons and five introns. The Ntcyp704b1 double mutant contains a four-base deletion of TATT at 99-102 bp in the first exon of NtCYP704B1-T and a single T insertion at 100 bp in the first exon of NtCYP704B1-S.

[0074] Comparison and analysis of the amino acid sequences of the two genes in the NtCYP704B1-T / S-Cas9 mutant revealed that compared with the unedited WT, the NtCYP704B1-T gene in the mutant underwent an insertion mutation at target 1, and the NtCYP704B1-S gene underwent a deletion mutation at target 1. These mutations caused frameshift mutations in their amino acids, and the subsequent amino acids terminated prematurely. Therefore, the functions of the proteins of the two NTCYP704B1 genes in this mutant were both lost.

[0075] Genotyping of F1 generation plants: Since the stigma and anther development of T0 generation tobacco plants grown in the greenhouse are often uncoordinated, and when the edited gene is related to male development, it will also affect fertility, therefore, in order to reproduce T0 generation plants and pass on the obtained gene editing type, the present invention uses wild-type pollen of the tobacco inbred line K326 to pollinate the T0 generation plants of NtCYP704B1-T / S-Cas9 obtained above, and then obtains F1 generation seeds, and the grown plants are F1 generation plants.

[0076] The F1 generation plants include two segregation types, one is Cas9-positive plants (transgenic plants), and the other is Cas9-negative plants (non-transgenic plants). In order to avoid the continuous editing of the K326 wild-type allele introduced by hybrid pollination by sgRNA and Cas9, thereby causing the complexity of mutation types, it is necessary to select plants that do not contain the Cas9 gene but contain the T0 generation mutation type from the F1 generation plants through genotyping. After self-pollination, these plants can obtain the non-transgenic F2 generation.

[0077] The genotyping steps for F1 plants are as follows:

[0078] After leaf DNA was extracted using the CTAB method, PCR amplification was performed using the Cas9 gene-specific primers Cas9-F (SEQ ID NO. 19) and Cas9-R (SEQ ID NO. 20).

[0079] Cas9-F primer sequence: 5'-TGTCCCAGGATTAGAATGATTAGGC-3'

[0080] Cas9-R primer sequence: 5′-AGCCCTCTTCTTTCGATCCATCAAC-3′;

[0081] After the PCR products were subjected to agarose gel electrophoresis, Cas9-positive plants and Cas9-negative plants were distinguished based on the results.

[0082] Further sequencing was performed on the targets of the NtCYP704B1-T (LOC107791425) gene and the NtCYP704B1-S gene in the Cas9-negative plants; the inheritance of the T0 generation mutation type was determined based on the sequencing results.

[0083] Example 2: Phenotypic Analysis of the NtCYP704B1-T / S Double-Sterile Male Sterile Line

[0084] F2 seeds were obtained by self-pollinating F1 plants lacking the Cas9 gene identified in Example 1. A single target plant of the Ntcyp704b1 double mutant (NtCYP704B1-T / S-Cas9) was sown and phenotypic analysis was performed at maturity. The F2 lines showed a consistent segregation ratio of fertile to sterile plants of 15:1, further demonstrating that the sterility trait of the NtCYP704B1-T / S double-mutant sterile line is controlled by two recessive genes. Detailed phenotypic comparisons were then conducted between the stable, non-transgenic NtCYP704B1-T / S sterile lines obtained in the F2 generation and the wild type.

[0085] Observation of flower, anther, and pollen vitality: In terms of vegetative growth and flower development, the NtCYP704B1-T / S double-stranded sterile line (NtCYP704B1-T / S-Cas9) showed essentially no difference from the wild type. In terms of flower development, the wild type was able to bud normally, anthers could dehisce and shed pollen normally, and could set fruit normally after self-pollination (see Figure 1-Figure 2 ), while the NtCYP704B1-T / S double-stranded sterile line can bud normally, but the anther husk does not crack, the anther is obviously smaller, shrunken and not exposed (see Figure 4-Figure 5 ); further analysis of pollen from wild type and mutants with acetic acid carmine revealed that wild type pollen developed normally (see Figure 3 ), pollen grains are stained black, but the mutant has no pollen grains (see Figure 6This indicates that the NtCYP704B1-T and NtCYP704B1-S genes jointly control male development in tobacco. The NtCYP704B1-T / S double-stranded male sterile line created by gene editing is a pollen-free male sterile line, showing the characteristics of complete sterility.

[0086] Scanning electron microscopy (SEM) of anthers: To further characterize the cytological characteristics of the NtCYP704B1-T / S double-mutant sterile line, scanning electron microscopy (SEM) analysis of the inner and outer anther walls of wild-type and homozygous double mutant anthers was performed. Wild-type and mutant anthers at the mature stage (S13) were excised and immediately fixed in FAA solution (Coolaber, China), with the volume of the fixative at least 20 times the volume of the material being studied. For mutant anthers, the anther wall was perforated with a dissecting needle to enhance fixative penetration, or vacuum was repeatedly applied until the anther sank to the bottom of the fixative. After fixation at room temperature for 2 hours, the anthers were stored at 4°C or dehydrated in 50%, 60%, 70%, 80%, 90%, and 100% ethanol, with each gradient held for 15 minutes. The anthers were then placed in 70% ethanol overnight or stored. Dehydrated samples were critical point dried with carbon dioxide and then gold plated for observation.

[0087] Anthers of wild type WT and NtCYP704B1-T / S double-stranded sterile lines, such as Figure 7 and Figure 9 As shown, the anthers of the wild type are plump ( Figure 9 ), while the anthers of the NtCYP704B1-T / S double-stranded sterile line were shrunken; the inner wall of the wild-type anthers was covered with well-developed pollen grains (such as Figure 10 ); while the inner wall of anther of NtCYP704B1-T / S double-stranded sterile line has no mature pollen grains (as shown in Figure 8 shown).

[0088] The researchers also found that the anthers of the NtCYP704B1-T / S mutant had a smooth outer cuticle and failed to form a reticular cuticle, whereas the wild-type mutant formed a dense reticular cuticle. Similarly, the inner cuticle of the anthers of the NtCYP704B1-T / S mutant was smooth, lacking the dense, granular Wurtz bodies. The anther cuticle is an extracellular lipid layer covering the anther surface, protecting it from external abiotic stresses, internal tissue dehydration, and pathogen invasion. Wurtz bodies, located on the inner wall of the anther, are believed to transport sporopollenin precursors from the tapetum cells to the microspores. These results suggest that simultaneous mutations in both the NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) genes can impair anther cuticle formation and block the synthesis of pollenin precursors in the tapetum.

[0089] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For ordinary technicians in this field, they can still modify or improve the technical solutions described above, which all fall within the scope of protection of the present invention.

Claims

1. An application of tobacco male sterility-related gene NtCYP704B1, characterized in that: Simultaneously mutate two paralogous genes, NtCYP704B1-T and NtCYP704B1-S, of the tobacco male sterility-related gene NtCYP704B1 to inhibit the expression of the NtCYP704B1 gene in tobacco, thereby achieving tobacco male sterility; The nucleotide sequence of the NtCYP704B1-T gene is shown in SEQ ID NO. 1; The nucleotide sequence of the NtCYP704B1-S gene is shown in SEQ ID NO.

2.

2. A gene mutant for controlling tobacco male sterility, characterized in that: The gene mutant is obtained by simultaneously mutating two paralogous genes NtCYP704B1-T and NtCYP704B1-S of the tobacco male sterility-related gene NtCYP704B1; Among the gene mutants, the nucleotide sequence of the NtCYP704B1-T mutant gene is shown as SEQ ID NO.5; the nucleotide sequence of the NtCYP704B1-S mutant gene is shown as SEQ ID NO.

6.

3. A tobacco male sterile gene mutant according to claim 2, characterized in that: The amino acid sequences encoded by the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

4. The use of a tobacco male sterile gene mutant according to claim 2 or 3, characterized in that: The gene mutant is used in creating tobacco male sterile lines.

5. A method for creating a tobacco male sterile line, characterized in that: The method comprises: using a CRISPR / Cas9 method to simultaneously perform gene editing on two paralogous genes of the NtCYP704B1 gene, NtCYP704B1-T and NtCYP704B1-S, to obtain a gene editing vector; and using Agrobacterium-mediated transfection to obtain an NtCYP704B1-T / S double-mutant sterile line in which both the NtCYP704B1-T gene and the NtCYP704B1-S gene are edited. Among them, after gene editing using the CRISPR / Cas9 method, the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown as SEQ ID NO.5 and SEQ ID NO.6, respectively.

6. The method for creating a tobacco male sterile line according to claim 5, characterized in that: When using the CRISPR / Cas9 method for gene editing, a CRISPR / Cas9 vector editing target site with a nucleotide sequence as shown in SEQ ID NO.9 and SEQ ID NO.10 is designed at the first exon and homologous region of the NtCYP704B1-T gene and the NtCYP704B1-S gene.

7. The method for creating a tobacco male sterile line according to claim 5, characterized in that: The constructed gene editing vector is PKSE401-GFP-NtCYP704B1, and the basic vector of the gene editing vector is PKSE401-GFP.

8. The method for creating a tobacco male sterile line according to claim 5, characterized in that: An upstream primer NtCYP704B1-TF and a downstream primer NtCYP704B1-TR were designed for detecting the target site of the NtCYP704B1-T gene. The sequences of the upstream primer NtCYP704B1-TF and the downstream primer NtCYP704B1-TR are shown in SEQ ID NO. 15 and SEQ ID NO. 16, respectively. An upstream primer NtCYP704B1-SF and a downstream primer NtCYP704B1-SR were designed to detect the target site of the NtCYP704B1-S gene. The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR are shown as SEQ ID NO.17 and SEQ ID NO.18, respectively.

9. Use of the NtCYP704B1-T / S double-mutant sterile line prepared according to the method according to any one of claims 5 to 8 in hybrid breeding and seed production.

10. The use according to claim 9, characterized in that: The application in hybrid breeding and seed production refers to using the NtCYP704B1-T / S double-mutant sterile line as the female parent to hybridize with other male parents to obtain fertile hybrid seeds F1, and then using the hybrid seeds F1 for production and planting.

Citation Information

Patent Citations

  • CYP704B2 gene and protein coded by same

    CN101705239A

  • Related protein for regulating and controlling abortion of tobacco male flowers, coding gene and application thereof

    CN118530321A

  • nuclear male sterility encoded by mutation in cytochrome P450 oxidase

    DE102016015741A1

  • nuclear male sterility encoded by mutation in cytochrome P450 oxidase

    DE102016106656A1

  • Nucleus-Encoded Male Sterility Through Mutation In Cytochrome P450 Oxidase

    US20190194685A1