Primer and method for identifying purity of zucchini hybrid hanxiao longqing based on ssr marker

Abstract

The application discloses a primer and a method for identifying the purity of a Lagenaria leucantha Hanxiuchangqing hybrid based on an SSR marker, and belongs to the field of vegetable breeding and molecular detection technologies. The primer sequence is two pairs of SSR primers designed based on SSR marker site information, the primer sequences are HZ047 and HZ100, and the nucleotide sequences are shown as SEQ ID NO. 1-2, 3-4. Any one of the primers is subjected to PCR amplification, and the band type obtained is the complementary band type of the parents. The application further discloses a method for identifying the purity of the Lagenaria leucantha Hanxiuchangqing hybrid by using the primer. The method can effectively distinguish the Hanxiuchangqing hybrid and its maternal parent and paternal parent. The method has the advantages of rapidness, accuracy, stability and simple operation, and can replace the traditional field purity identification method of a Lagenaria hybrid, and has strong application value.

Description

Technical Field

[0001] This invention belongs to the field of vegetable breeding and molecular detection technology, and in particular relates to a primer and method for identifying the purity of the Hanxiu Changqing hybrid of bottle gourd based on SSR markers. Background Technology

[0002] Traditional methods for determining seed purity rely on field observations of plant morphology after sowing, examining the agronomic traits of the F1 hybrid to determine if it is a false hybrid. This method is time-consuming, labor-intensive, costly, and easily affected by environmental and climatic factors, leading to inaccurate results. Currently, incidents of significant yield and income reduction for farmers due to seed purity issues occur frequently each year, severely impacting agricultural production and farmers' income. Therefore, developing rapid and accurate methods for determining hybrid purity has become one of the most pressing concerns for seed research institutions and enterprises.

[0003] With the development of modern molecular biology techniques, novel methods for identifying the purity of hybrids based on DNA molecular marker technology have emerged, offering advantages such as simplicity, speed, and accuracy. Commonly used molecular marker technologies include AFLP, RFLP, SRAP, SCAR, SSR, and SSR. SSR (Single Nucleotide Polymorphisms) refer to variations in a single nucleotide on the genome, primarily including genetic markers formed by transitions and transversions. These markers are numerous, widely distributed, and exhibit codominance and high polymorphism. Currently, SSR markers are widely considered the most promising third-generation molecular markers after RFLP and SSR.

[0004] Bottle gourd (Lagenaria siceraria) is an important cucurbit vegetable in my country and is highly favored by consumers. Currently, the annual planting area of ​​bottle gourd in my country reaches 2 million mu (approximately 133,333 hectares). With the breeding of new bottle gourd varieties and the promotion and application of cultivation models and high-quality, high-efficiency cultivation techniques, the sales period of bottle gourd in my country has been greatly extended, and its quality and economic benefits have been continuously improved, leading to a continuous expansion of the planting area. Growing bottle gourd has become an important source of income for farmers in some regions and a growth point for rural economies. However, due to pollen mixing and mechanical factors during the hybridization process of bottle gourd seed production, false hybrids often occur, leading to a decrease in seed genetic purity and causing huge economic losses to agricultural production.

[0005] The commercial variety 'Hanxiu Changqing' is a bottle gourd variety bred by the Vegetable Research Institute of Wuhan Academy of Agricultural Sciences, and it was registered as a scientific and technological achievement in Hubei Province in 2022. To date, there have been no reports on using SSR markers to identify the hybrid purity of the bottle gourd 'Hanxiu Changqing'. Summary of the Invention

[0006] This invention provides primers for identifying the purity of the *Hanxiu Changqing* hybrid of *Gourd* based on SSR markers, the primer sequences of which are shown in SEQ ID NO.1-2 or SEQ ID NO.3-4.

[0007] The present invention also provides a primer combination for identifying the purity of the Hanxiu Changqing hybrid of bottle gourd based on SSR markers, the primer combination comprising primers with sequences as shown in SEQ ID NO.1-2 and SEQ ID NO.3-4.

[0008] This invention also provides the application of the above primers in the purity identification of *Hanxiu Changqing* gourd.

[0009] This invention also provides the application of the above primers in the breeding of the Chinese bottle gourd Hanxiu Changqing variety.

[0010] This invention also provides the application of the above primer combination in the purity identification of *Hanxiu Changqing* gourd.

[0011] This invention also provides the application of the above primer combination in the breeding of the Chinese bottle gourd Hanxiu Changqing.

[0012] This invention also provides the application of the above primers or combinations of primers in the preparation of a product for purity identification of *Houttuynia cordata*.

[0013] In one embodiment of the present invention, the product is a reagent or a kit.

[0014] This invention also provides a method for identifying the purity of the *Hanxiu Changqing* gourd, comprising the following steps:

[0015] Using the cotyledon genomic DNA of the bottle gourd to be tested as a template, PCR amplification was performed using the primers described in claim 1. When the primer sequence is as shown in SEQ ID NO. 1-2, if there are two amplified bands, one of 235 bp and the other of 231 bp, the bottle gourd to be tested is identified as Hanxiu Changqing. When the primer sequence is as shown in SEQ ID NO. 3-4, if there are two amplified bands, one of 285 bp and the other of 290 bp, the bottle gourd to be tested is identified as Hanxiu Changqing.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] This invention provides two pairs of SSR marker primers. The experimental operation is simple, requiring only the most basic molecular experimental instruments and conditions. It does not require toxic polyacrylamide gel electrophoresis and silver nitrate color development. The detection results are accurate and efficient, and can effectively distinguish the adulteration of maternal and paternal seeds in the seed production process of bottle gourd 'Hanxiu Changqing' hybrid. It can replace the traditional method of field purity identification of bottle gourd hybrids and has strong application value. Attached Figure Description

[0018] Figure 1 The image shows the polymorphism detection of primers HZ047 and HZ100 in the maternal and paternal parents of 'Hanxiu Changqing' in Example 1. In the image, after DNA was amplified by PCR with primer HZ047, a specific band of 231 bp was generated in the maternal parent of 'Hanxiu Changqing' (A1), and a specific band of 235 bp was generated in the paternal parent (A2). After DNA was amplified by PCR with primer HZ100, a specific band of 290 bp was generated in the maternal parent of 'Hanxiu Changqing' (B1), and a specific band of 285 bp was generated in the paternal parent (B2).

[0019] Figure 2 The image shows the detection of primer HZ047 in the 'Hanxiu Changqing' sample from Example 1. In the image, the DNA was amplified by PCR using primer HZ047, resulting in two bands of 231bp and 235bp in the 'Hanxiu Changqing' sample.

[0020] Figure 3 The image shows the detection of primer HZ100 in the 'Hanxiu Changqing' sample from Example 1. In the image, the DNA was amplified by PCR using primer HZ100, resulting in two bands of 285bp and 290bp in the 'Hanxiu Changqing' sample. Detailed Implementation

[0021] Example 1

[0022] The process of obtaining SSR molecular marker primers for determining the purity of hybrid seeds of bottle gourd 'Hanxiu Changqing' is as follows:

[0023] The bottle gourd EST sequence was downloaded from the CuGenDB public database (http: / / cucurbitgenomics.org / ). The Samtools tool (http: / / samtools.sourceforge.net) was used to align the EST sequence to the bottle gourd genome sequence (http: / / cucurbitgenomics.org / organism / 13 / / ) and perform SSR site lookup. Primers were designed using the SSRs program. The selected primers were screened for PCR polymorphism, and finally two pairs of polymorphic primers, namely HZ047 and HZ100, were obtained.

[0024] The nucleotide sequence of primer combination HZ047 is as follows:

[0025] HZ047-F (SEQ ID NO.1): 5'- CGATGCGATTGGGGGTTAGA-3' (HZ ID-1);

[0026] HZ047-R (SEQ ID NO. 2): 5'-GCACCGACATTGGAAGTTGG-3' (HZ ID-2).

[0027] The nucleotide sequence of primer combination HZ100 is as follows:

[0028] HZ100-F (SEQ ID NO.3): 5'- GCATGTCGAGAGTGATGCTT -3' (HZ ID-3);

[0029] HZ100-R (SEQ ID NO.4): 5'-AGGGGCGAGTCATCAATCAT-3' (HZ ID-4).

[0030] After PCR amplification using primer HZ047, a specific band of 231 bp was generated in the maternal parent HLB11 of 'Hanxiu Changqing', and a specific band of 235 bp was generated in the paternal parent HLB14 of 'Hanxiu Changqing'.

[0031] After PCR amplification with primer HZ100, a specific band of 290bp was generated in the maternal parent of 'Hanxiu Changqing' and a specific band of 285bp was generated in the paternal parent of 'Hanxiu Changqing'.

[0032] The DNA of 'Hanxiu Changqing' produced specific bands of 231bp and 235bp after PCR amplification with primer HZ047, and specific bands of 285bp and 290bp after PCR amplification with primer HZ100.

[0033] The detection bands of the two primer pairs are clear and reproducible. Therefore, HZ047 and HZ100 can be combined to identify 'Hanxiu Changqing'.

[0034] Example 2

[0035] The method for germplasm identification of bottle gourd 'Hanxiu Changqing' using primers HZ047 and HZ100 includes the following steps:

[0036] (1) DNA extraction from bottle gourd: Genomic DNA was extracted from the cotyledons of bottle gourd using the CTAB method. The cotyledons were ground with liquid nitrogen or crushed with steel balls, lysed with 2×CTAB lysis buffer, extracted with chloroform, precipitated with isopropanol and washed with 70% ethanol. Finally, the DNA precipitate was dissolved in 20 μL TE solution.

[0037] (2) PCR amplification: PCR amplification of the genomic DNA of 'Hanxiu Changqing' and its parents was performed using primers HZ047 or HZ100. The PCR reaction system consisted of 6 μL 2× Taq PCR Master Mix, 4 μL ddH2O2 sterile water, 0.5 μL forward primer (concentration of 2.5 nM), 0.5 μL reverse primer (concentration of 2.5 nM), and 1 μL of the extracted bottle gourd DNA to be tested.

[0038] The PCR amplification program was as follows: pre-denaturation at 94 ℃ for 5 min; amplification cycles: denaturation at 94 ℃ for 30 sec, annealing at 58 ℃ for 30 sec, annealing at 72 ℃ for 30 sec, for 32 cycles; final extension at 72 ℃ for 5 min; and final storage at 4 ℃.

[0039] (4) Capillary electrophoresis was performed on the PCR amplification products.

[0040] (5) Analysis of test results.

[0041] The DNA sample that produces specific bands of 231bp and 235bp after PCR amplification with primer HZ047 is 'Hanxiu Changqing'; the DNA sample that produces specific bands of 285bp and 290bp after PCR amplification with primer HZ100 is 'Hanxiu Changqing'.

[0042] Example 3

[0043] Application of primers HZ047 and HZ100 in germplasm identification of bottle gourd 'Hanxiu Changqing':

[0044] Samples to be tested: 5 male plants of 'Hanxiu Changqing', 5 female plants of 'Hanxiu Changqing'; 108 individual plants of 'Hanxiu Changqing' to be tested.

[0045] The DNA of the above samples was tested using the method described in Example 2.

[0046] The experimental results of primer HZ047 are as follows Figure 2 As shown: After primer PCR amplification, a specific band of 231 bp was generated in the maternal parent of 'Hanxiu Changqing', and a specific band of 235 bp was generated in the paternal parent of 'Hanxiu Changqing'. DNA from 'Hanxiu Changqing' was amplified by primer HZ047 PCR, producing specific bands of 231 bp and 235 bp.

[0047] Among the 108 tested 'Hanxiu Changqing' individual plants, lane 70 showed the same banding pattern as the maternal parent, with only a 231bp specific band; while the other samples all showed two specific bands. Therefore, the sample in lane 70 was determined to be a false 'Hanxiu Changqing'. The purity of the 108 tested samples was identified as 99.07% using primer HZ047, which was consistent with the field identification results.

[0048] The experimental results of primer HZ100 are as follows: Figure 3 As shown: After PCR amplification using primer HZ100, a specific band of 290 bp was generated in the maternal parent of 'Hanxiu Changqing', and a specific band of 285 bp was generated in the paternal parent of 'Hanxiu Changqing'. Among the 108 tested 'Hanxiu Changqing' individual plants, lane 70 showed the same banding pattern as the maternal parent, with only a 290 bp specific band; while the other samples all showed two specific bands. Therefore, the sample in lane 70 was determined to be a false 'Hanxiu Changqing'. The purity of the 108 tested samples, identified by primer HZ100, was 99.07%, consistent with the field identification results.

[0049] Field planting revealed that sample No. 70 was indeed the parent material, while the remaining samples to be tested were all 'Hanxiu Changqing'.

[0050] In summary, both primer combinations HZ047 and HZ100 can identify the same pseudohybrids in 'Hanxiu Changqing', indicating that the primers and detection method of this invention can effectively distinguish bottle gourd hybrids from their parent plants, and have the advantages of being fast, accurate, stable and easy to operate.

[0051] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer for identifying the purity of the *Gourd Hanxiu Changqing* hybrid based on SSR markers, characterized in that, The primer sequences are shown in SEQ ID NO.1-2 or SEQ ID NO.3-4.

2. A primer combination for identifying the purity of the *Gourd Hanxiu Changqing* hybrid based on SSR markers, characterized in that, The primer combination includes primers with sequences as shown in SEQ ID NO.1-2 and SEQ ID NO.3-4.

3. The application of the primers described in claim 1 in the purity identification of *Gnaphalium affine*.

4. The application of the primers described in claim 1 in the breeding of *Gourd Hanxiu Changqing*.

5. The application of the primer combination according to claim 2 in the purity identification of *Gnaphalium affine*.

6. The application of the primer combination described in claim 2 in the breeding of *Gourd Hanxiu Changqing*.

7. The application of the primers of claim 1 or the primer combination of claim 2 in the preparation of a product for purity identification of *Gnaphalium affine*.

8. The application according to claim 7, characterized in that, The product is a reagent or kit.

9. A method for identifying the purity of the "Hanxiu Changqing" variety of bottle gourd, characterized in that, Includes the following steps: Using the cotyledon genomic DNA of the bottle gourd to be tested as a template, PCR amplification was performed using the primers described in claim 1. When the primer sequence is as shown in SEQ ID NO. 1-2, if there are two amplified bands, one of 235 bp and the other of 231 bp, the bottle gourd to be tested is identified as Hanxiu Changqing. When the primer sequence is as shown in SEQ ID NO. 3-4, if there are two amplified bands, one of 285 bp and the other of 290 bp, the bottle gourd to be tested is identified as Hanxiu Changqing.

Images