Microbacteria for improving formaldehyde tolerance and utilization capability of monocarbon compound and construction thereof
Patent Information
- Application Number
- CN202380054714.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-08-05
AI Technical Summary
In the prior art, formaldehyde accumulates during the bioavailability of methanol, resulting in inhibition of cell growth and death, becoming a bottleneck that hinders the efficient bioavailability of methanol.
By manipulating the bacteria's cell division system, micro cells without genomic DNA are obtained, and methanol assimilation pathway is introduced to enhance the utilization ability of methyltrophic bacteria to a carbon compound. Specific methods include using CRISPR gene editing technology, replacing the phosphate acetyltransferase gene, overexpressing the cell division protein ftsZ, knocking out the Z-loop localization system minCDE and other genes, and introducing the RuMP pathway.
It significantly improves the tolerance of microbacterials to formaldehyde and the utilization ability of one-carbon compounds, enhances the stability of the cell membrane, reduces the flowability of the cell membrane, and thus improves the tolerance to formaldehyde and the utilization efficiency of methanol.
Smart Images

Figure CN120435561A_ABST
Abstract
Description
Microbacteria and their construction for improving formaldehyde tolerance and one-carbon compound utilization Technical Field
[0001] The present invention belongs to the field of biotechnology, particularly to the field of microbial synthetic biology, and specifically to a microbacterium capable of improving formaldehyde tolerance and one-carbon compound utilization capacity and its construction. Background Art
[0002] Methanol, a cheap and widely available organic carbon feedstock, can be produced primarily from coal and natural gas. Renewable methanol can be obtained by reacting carbon dioxide from biogas or municipal solid waste with hydrogen generated by electrolysis (Martens JA et al., 2017; Olah GA et al., 2009; Zhang M et al., 2019). Compared to traditional sugar-based feedstocks, methanol has a higher reducing capacity and can be used as a carbon source to produce high-value-added chemicals, including long-chain alcohols, organic acids, and hydrocarbons (Schrader J et al., 2009; Zhang W et al., 2018).
[0003] A large number of methylotrophic microorganisms exist in nature, using methanol as their sole carbon source. Their unique metabolic mechanisms enable them to synthesize the substances and energy required for cell growth using methanol as their sole carbon and energy source (Chistoserdova L et al., 2018; Cui J et al., 2016). However, limitations such as incomplete genetic backgrounds, relatively few genetic tools, and low methanol utilization efficiency have hindered the widespread application and development of these naturally occurring methylotrophic bacteria. In recent years, remodeling the metabolic networks of model microorganisms, which are more easily genetically manipulated and engineered, into synthetic methylotrophic cell factories capable of synthesizing high-value-added chemicals using methanol as a carbon source has become a key development direction. Existing research primarily utilizes model microorganisms (such as Escherichia coli, Corynebacterium glutamicum, and Saccharomyces cerevisiae) by introducing the methanol assimilation pathways of naturally occurring methylotrophic microorganisms (Chistoserdova L et al., 2011).
[0004] However, whether using natural or synthetic methylotrophic bacteria, methanol bioutilization produces formaldehyde, an intermediate metabolite that is highly toxic to cells. Formaldehyde accumulation can severely inhibit cell growth and even cause cell death, becoming a bottleneck hindering the efficient bioutilization of methanol (Figure 2) (Stingele J et al., 2014).
[0005] Current research suggests that formaldehyde's primary cytotoxic mechanism is the cross-linking of DNA and proteins within microbial cells. Furthermore, formaldehyde can severely damage microbial cell membranes. As crucial sites for material transport and energy metabolism, damage to these membranes can severely impair these functions and even cause cell death. Therefore, strengthening microbial cell membranes and developing strains with high formaldehyde tolerance is an important strategy for combating formaldehyde toxicity.
[0006] Summary of the Invention
[0007] To address the above technical problems, the present invention aims to provide a microbacterium and its construction that improves formaldehyde tolerance and one-carbon compound utilization. By manipulating the bacterial cell division system, the present invention produces microcells that are free of genomic DNA, thereby enhancing formaldehyde tolerance. Furthermore, by introducing a methanol assimilation pathway, the ability of methylotrophic bacteria to utilize one-carbon compounds is enhanced.
[0008] Specifically, the present invention uses CRISPR gene editing technology to replace the gene pta encoding phosphate acetyltransferase in the host bacteria MG1655 (DE3) with the cell division protein encoding gene ftsZ, and uses an artificial promoter strategy to upregulate the expression of ftsZ, wherein the artificial promoter element is M1-93; based on the obtained bacteria, CRISPR gene editing technology is used to further knock out minCDE to obtain miniature cells; based on the miniature cells, CRISPR gene editing technology is used to further knock out frmA, rpiA, rpiB, and cyaA to obtain chassis cells for methanol utilization; the RuMP pathway is introduced into the chassis cells to construct a cell factory, and the obtained cell factory has significantly improved formaldehyde tolerance and one-carbon compound utilization ability.
[0009] The object of the present invention is achieved through the following technical solutions:
[0010] <First aspect>:
[0011] Application of miniature cells without genomic DNA in improving formaldehyde tolerance and one-carbon compound bioutilization ability; the miniature cells without genomic DNA are produced by regulating the cell division system of bacteria.
[0012] Regulation of the bacterial cell division system is achieved by overexpressing the cell division protein FtsZ and its homologs, and / or inhibiting the Z ring localization system minCDE and its homologs.
[0013] The nucleotide sequence of the gene encoding the cell division protein FtsZ is shown in any one of SEQ ID NO.1 to SEQ ID NO.16.
[0014] The nucleotide sequence of the gene minCDE encoding the Z ring positioning system is shown in any one of SEQ ID NO.19 to SEQ ID NO.29.
[0015] <Second aspect>:
[0016] Application of the cell division protein ftsZ in improving formaldehyde tolerance and one-carbon compound utilization ability.
[0017] The nucleotide sequence of the gene encoding the cell division protein ftsZ is shown in any one of SEQ ID NO. 1 to SEQ ID NO. 16.
[0018] <Third Aspect>:
[0019] The present invention provides a miniature recombinant bacterium with improved formaldehyde tolerance and one-carbon compound utilization ability. The recombinant Escherichia coli is obtained by replacing the phosphate acetyltransferase gene pta with the cell division protein ftsZ, and overexpressing the cell division protein ftsZ. The nucleotide sequence encoding the cell division protein ftsZ is shown in any one of SEQ ID NO. 1 to SEQ ID NO. 16.
[0020] The nucleotide sequence of the gene encoding phosphate acetyltransferase pta is shown in SEQ ID NO.17.
[0021] The Escherichia coli is E. coli MG1655 (DE3).
[0022] Overexpression of the cell division protein ftsZ is achieved by upregulating the expression of ftsZ through an artificial promoter element, wherein the artificial promoter element is M1-93; the nucleotide sequence of the M1-93 is shown in SEQ ID NO.18.
[0023] The artificial regulatory element M1-93 was manipulated using CRISPR gene editing technology.
[0024] <Fourth aspect>:
[0025] The present invention provides a miniature recombinant bacterium, which is obtained by knocking out the Z ring positioning system minCDE on the basis of the recombinant Escherichia coli. The miniature recombinant Escherichia coli is denoted as MiniCell.
[0026] The nucleotide sequence of the gene minCDE encoding the Z ring positioning system is shown in any one of SEQ ID NO.19 to SEQ ID NO.29.
[0027] <Fifth Aspect>:
[0028] The present invention provides a chassis cell for improving the ability to utilize one-carbon compounds, which is obtained by knocking out the frmA gene encoding formaldehyde dehydrogenase and at least one of the following genes based on the above-mentioned mini-recombinant Escherichia coli:
[0029] rpiA gene encoding ribose phosphate isomerase A;
[0030] rpiB gene encoding ribose phosphate isomerase B;
[0031] The cyaA gene encodes adenylate cyclase.
[0032] The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30; the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31; the nucleotide sequence of the rpiB gene encoding ribose phosphate isomerase B is shown in SEQ ID NO.32, and the nucleotide sequence of the cyaA gene encoding adenylate cyclase is shown in SEQ ID NO.33.
[0033] As one embodiment of the present invention, the chassis cell is obtained by knocking out the frmA gene encoding formaldehyde dehydrogenase, the rpiA gene encoding ribose phosphate isomerase A, the rpiB gene encoding ribose phosphate isomerase B, and the cyaA gene encoding adenylate cyclase on the basis of the mini recombinant Escherichia coli.
[0034] Knocking out related genes will divert more carbon metabolism flow from methanol to the TCA cycle, thereby further improving the utilization efficiency of methanol.
[0035] <Sixth Aspect>:
[0036] The present invention provides a cell factory for improving the formaldehyde tolerance and one-carbon compound utilization ability of recombinant bacteria, wherein the RuMP pathway is introduced into the chassis cells, including the mdh gene from Copperobacterium necrotizingum, the hps gene and phi gene from Bacillus methanolicus, and the nudF protein from Escherichia coli.
[0037] The nucleotide sequence of the mdh gene is shown in SEQ ID NO.34; the nucleotide sequence of the hps gene is shown in SEQ ID NO.35; the nucleotide sequence of the phi gene is shown in SEQ ID NO.36; and the nucleotide sequence encoding the nudF protein is shown in SEQ ID NO.37.
[0038] The method for constructing the cell factory comprises the following steps:
[0039] 1. The mdh gene from Copperobacterium necrotizingum, the hps and phi genes from Bacillus methanolica, and the nudF protein from Escherichia coli were assembled into the pCDFduet-1 plasmid (purchased from Novagen) to obtain the highly active methanol utilization pathway plasmid pCDF-mdh-nudF-hps-phi, namely the pCDF-RuMP plasmid;
[0040] 2. The pCDF-RuMP plasmid is transferred into the chassis cells to construct a cell factory for utilizing one-carbon compounds.
[0041] As one embodiment of the present invention, the present invention also provides a method for constructing a micro-recombinant bacterium with enhanced one-carbon compound utilization ability, comprising the following steps:
[0042] (1) According to the gene pta to be replaced and the M1-93-ftsZ artificial regulatory element to be integrated, the corresponding pEcgRNA plasmid and Donor DNA are constructed;
[0043] (2) Construct the corresponding pEcgRNA plasmid and Donor DNA according to the gene minCDE to be knocked out;
[0044] (3) The pEcgRNA plasmid and Donor DNA in step (1) are transformed into competent Escherichia coli containing the pEcCas plasmid by electroporation (other transformation methods in the prior art, such as chemical transformation, may also be used); inducing sgRNA transcription on the pEcCas plasmid, eliminating the pEcgRNA plasmid, and screening for successfully genetically modified strains;
[0045] (4) Transforming the pEcgRNA plasmid and Donor DNA in step (2) into the strain obtained in step (3), inducing the transcription of sgRNA on the pEcCas plasmid, eliminating the pEcgRNA plasmid and screening the strain with successful genetic modification;
[0046] (5) Eliminating the pEcCas plasmid to obtain a reduced-size E. coli, i.e., a recombinant micro E. coli;
[0047] (6) Construct the corresponding pEcgRNA plasmid and Donor DNA according to the genes to be knocked out, frmA, rpiA, and rpiB;
[0048] (7) The pEcgRNA plasmid and Donor DNA required for knocking out frmA in step (6) are transformed into competent Escherichia coli containing the pEcCas plasmid by electroporation; sgRNA transcription is induced on the pEcCas plasmid, the pEcgRNA plasmid is eliminated, and the strain with successful genetic modification is screened;
[0049] (8) The pEcgRNA plasmid and Donor DNA required for knocking out rpiA in step (6) are transformed into the strain obtained in step (7), the transcription of the sgRNA on the pEcCas plasmid is induced, the pEcgRNA plasmid is eliminated, and the strain with successful genetic modification is screened;
[0050] (9) The pEcgRNA plasmid and Donor DNA required for knocking out rpiB in step (6) are transformed into the strain obtained in step (8), the transcription of the sgRNA on the pEcCas plasmid is induced, the pEcgRNA plasmid is eliminated, and the strain with successful genetic modification is screened;
[0051] (10) Elimination of the pEcCas plasmid;
[0052] (11) Based on the gene cyaA to be knocked out, the corresponding FRT-Kan-FRT (FKF) fragment was constructed;
[0053] (12) The FKF fragment was transformed into the strain obtained in step (10) containing the pKD46 plasmid by electroporation;
[0054] (13) Induce transcription of the pKD46 plasmid and screen the strains with successful genetic modification;
[0055] (14) Eliminate the pKD46 plasmid to obtain chassis cells for one-carbon compound utilization.
[0056] As an embodiment of the present invention, in steps (3) and (12), the competent Escherichia coli containing the pEcCas plasmid and the pKD46 plasmid is to transform the plasmids pEcCas plasmid and the pKD46 plasmid into the cells to obtain recipient bacteria containing the pEcCas plasmid and the pKD46 plasmid.
[0057] As an embodiment of the present invention, in step (3), what is transformed is the pEcgRNA plasmid and Donor DNA according to the artificial regulatory element M1-93-ftsZ to be integrated; in step (4), what is transformed is the gene minCDE to be knocked out, and the corresponding pEcgRNA plasmid and Donor DNA are constructed; in step (7), what is transformed is the gene frmA to be knocked out, and the corresponding pEcgRNA plasmid and Donor DNA are constructed; in step (8), what is transformed is the gene rpiA to be knocked out, and the corresponding pEcgRNA plasmid and Donor DNA are constructed; in step (9), what is transformed is the gene rpiB to be knocked out, and the corresponding pEcgRNA plasmid and Donor DNA are constructed.
[0058] As an embodiment of the present invention, in step (1), when constructing the pEcgRNA plasmid, according to the gene pta to be replaced, a suitable N20 nucleotide sequence is found on the website (https: / / www.benchling.com), and the plasmid pEcgRNA is used as a template and whole plasmid PCR is performed.
[0059] As an embodiment of the present invention, in step (1), when constructing the Donor DNA, the upstream and downstream homology arms of the artificial regulatory element M1-93-ftsZ to be integrated are further homologously recombined and integrated with M1-93 and ftsZ respectively to obtain the Donor DNA.
[0060] As an embodiment of the present invention, in steps (2) and (6), when constructing the Donor DNA, it is further constructed by homologous recombination and integration based on the upstream and downstream homologous arms of the gene to be knocked out.
[0061] As one embodiment of the present invention, L-arabinose is used for induction in steps (3), (4), (7), (8), (9), and (13).
[0062] As an embodiment of the present invention, in steps (3), (4), (7), (8), and (9), the engineered bacteria are obtained by screening on spectinomycin (final concentration 50 μg / mL) resistance plates and kanamycin (final concentration 50 μg / mL) resistance plates; in step (13), the engineered bacteria are obtained by screening on carbenicillin (final concentration 50 μg / mL) and kanamycin (final concentration 50 μg / mL) resistance plates.
[0063] As one embodiment of the present invention, in step (5), the strain constructed in step (4) is cultured overnight at 37° C. without adding any antibiotics to eliminate the pEcCas plasmid; in step (14), the strain constructed in step (13) is cultured overnight at 42° C. without adding any antibiotics to eliminate the pKD46 plasmid.
[0064] In this study, the cell division protein ftsZ polymerizes to form a Z ring, and the MinCDE system regulates its formation and location. If the Z ring is generated at the cell poles rather than in the middle, abnormal cell division occurs, resulting in the formation of miniature cells. Miniature cells lack a genome and have a high cardiolipin content in their cell membranes, which reduces membrane fluidity and enhances formaldehyde tolerance in Escherichia coli.
[0065] The present invention also provides an application of the cell factory in utilizing the one-carbon compound methanol.
[0066] Compared with the prior art, the present invention has the following beneficial effects:
[0067] 1. The present invention uses CRISPR gene editing technology to overexpress the Escherichia coli cell division protein ftsZ and knock out the Z ring positioning system MinCDE to obtain mini recombinant Escherichia coli, effectively improving the formaldehyde tolerance of Escherichia coli.
[0068] 2. The strains E and F of the present invention have improved tolerance to formaldehyde.
[0069] 3. The strains H, J, L and N of the present invention have improved the ability to utilize one-carbon compounds. BRIEF DESCRIPTION OF THE DRAWINGS
[0070] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:
[0071] FIG1 is a schematic diagram showing that methylotrophic bacteria containing miniature cells improve formaldehyde tolerance and one-carbon compound utilization capabilities;
[0072] Figure 2 shows the toxicity of different C1 substrates to E. coli: (A) Growth of E. coli under different concentrations of methanol, formic acid, and formaldehyde; (B) Formaldehyde is a central metabolite in natural, modified, and synthetic methylotrophic metabolic pathways; (C) Formaldehyde dissimilation pathway;
[0073] Figure 3 is a diagram showing the steps for eliminating pEcgRNA and pEcCas plasmids;
[0074] Figure 4 is the pEcgRNA of pta in Example 2;
[0075] Figure 5 is the pEcgRNA of minCDE in Example 3;
[0076] Figure 6 is the pEcgRNA of frmA in Example 4;
[0077] Figure 7 is the pEcgRNA of rpiA in Example 5;
[0078] Figure 8 is the pEcgRNA of rpiB in Example 6;
[0079] Figure 9 is a plasmid map of pKD46 in Example 7;
[0080] Figure 10 is a schematic diagram of the construction of the recombinant mini-strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE: (A) Formaldehyde-tolerant mini-cells were obtained by overexpressing ftsZ and knocking out minCDE; (B) Relative expression level test of ftsZ in the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ; (C) Cell diameter of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE; (D) Scanning electron microscopy test of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE; (E) Transmission electron microscopy test of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE;
[0081] Figure 11 shows the tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to different C1 compounds, methanol, formaldehyde, and formic acid: (A) Tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to formaldehyde; (B) Fluorescence microscopy observation results of the cell number of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE under different formaldehyde concentrations; (C) Tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to methanol; (D) Tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to formic acid;
[0082] Figure 12 shows the tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to other aldehydes (furfural, vanillin, HMF): (A) Tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to furfural; (B) Tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to vanillin; (C) Tolerance of the recombinant strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE to HMF;
[0083] FIG13 is a cell membrane fluidity test of the constructed recombinant strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDE;
[0084] FIG14 is a test of the relative content of cell membrane phospholipid components of the recombinant strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDE;
[0085] Figure 15 is a plasmid map of pCDF-RuMP;
[0086] Figure 16 is a test of the methanol and xylose utilization ability of the constructed control strain E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA and the engineered strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB ΔcyaA: (A) Schematic diagram of the RuMP pathway; (B) Schematic diagram of genetic manipulation in methylotrophic bacterial cells (C): The constructed control strain E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA and the engineered strain E. coli (D) Growth and methanol and xylose consumption of the constructed control strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA when cultured in a 50 mL centrifuge tube (methanol starting concentration 450 mM, xylose starting concentration 50 mM); (E) Growth and methanol and xylose consumption of the constructed control strain E. coli MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiBΔcyaA when cultured in a 50 mL centrifuge tube (methanol starting concentration 900 mM, xylose starting concentration 50 mM); (F) Growth curves of MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiBΔcyaA and the engineered strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA under conditions of higher methanol concentrations and 50 mM xylose;
[0087] Figure 17 is a test of intracellular formaldehyde content in the constructed control strain E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA and the engineered strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB ΔcyaA: the upper figure is the test result of the control strain, and the lower figure is the test result of the engineered strain;
[0088] Figure 18 is an analysis of the metabolic pattern of the constructed engineered strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB ΔcyaA: (A) Growth and methanol and xylose consumption of the constructed engineered strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB ΔcyaA in a 250 mL baffled shake flask (methanol starting concentration 450 mM, xylose starting concentration 50 mM); (B) (C) Growth of the engineered strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA in a 250 mL baffled shake flask (methanol starting concentration 0 mM, xylose starting concentration 50 mM); (D) Intracellular metabolites of the engineered strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA in a 250 mL baffled shake flask (methanol starting concentration 0 mM, xylose starting concentration 50 mM, glucose 10 g / L). 13 C marks the abundance; (E) The amino acid abundance in the cells of the constructed engineered strain E. coli MG1655 (DE3) Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA 13 C-labeled abundance;
[0089] Figure 19 is an analysis of the 3-HP synthesis ability of the constructed control strain E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA and the engineered strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB ΔcyaA: (A) Schematic diagram of RuMP and 3-HP synthesis; (B) Schematic diagram of gene manipulation in chassis cells of methylotrophic bacteria; (C) Growth, methanol and xylose consumption and 3-HP production of the constructed control strain E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA when cultured in a 250 mL baffled shake flask (methanol starting concentration 450 mM, xylose starting concentration 50 mM); (D) Schematic diagram of the constructed engineered strain E. coli Growth, methanol and xylose consumption, and 3-HP production of MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA in 250 mL baffled shake flasks (initial methanol concentration: 450 mM, initial xylose concentration: 50 mM); (E) Growth of the constructed control strain E. coli MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiBΔcyaA and the engineered strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA in 250 mL baffled shake flasks (initial methanol concentration: 450 mM, initial xylose concentration: 50 mM);
[0090] Figure 20 is a pET-3-HP plasmid map;
[0091] Figure 21 is an analysis of the TAL synthesis ability of the constructed control strain E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA and the engineered strain E. coli MG1655 (DE3) Δpta:: M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB ΔcyaA: (A) Schematic diagram of RuMP and TAL synthesis; (B) Schematic diagram of gene manipulation in chassis cells of methylotrophic bacteria; (C) Growth, methanol and xylose consumption and TAL production of the constructed control strain E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA when cultured in a 250 mL baffled shake flask (methanol starting concentration 450 mM, xylose starting concentration 50 mM); (D) TAL production of the constructed engineered strain E. coli Growth, methanol and xylose consumption, and TAL production of MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA in 250 mL baffled shake flasks (initial methanol concentration: 450 mM, initial xylose concentration: 50 mM); (E) Growth of the constructed control strain E. coli MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiBΔcyaA and the engineered strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA in 250 mL baffled shake flasks (initial methanol concentration: 450 mM, initial xylose concentration: 50 mM);
[0092] Figure 22 is a plasmid map of pTrc99A-BktB. DETAILED DESCRIPTION
[0093] The specific embodiments of the present invention are described in further detail below in conjunction with the examples. The following examples are used to illustrate the present invention and will help those skilled in the art to further understand the present invention, but are not intended to limit the scope of the present invention. It should be noted that, for those of ordinary skill in the art, several changes and improvements can be made without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.
[0094] The present invention provides a micro-E. coli strain that improves formaldehyde tolerance and one-carbon compound utilization in E. coli, as well as its construction method and application. The micro-E. coli strain overexpresses a cell division protein and knocks out the Z-ring localization system, thereby comprehensively improving the E. coli's formaldehyde tolerance and one-carbon compound utilization ability. The recombinant strain has the following characteristics: A. Overexpression of the cell division protein ftsZ; B. Knockout of the Z-ring localization system minCDE; C. Introduction of the RuMP pathway; D. Unlike previous modifications, the micro-E. coli strain significantly improves formaldehyde tolerance and one-carbon compound utilization ability by reducing cell volume.
[0095] FIG1 is a schematic diagram showing how methylotrophic bacteria containing microcells improve formaldehyde tolerance and one-carbon compound utilization capabilities.
[0096] Specifically, the E. coli CRISPR system consists of two basic plasmids: pEcCas (purchased from Addgene) and pEcgRNA (purchased from Addgene). The pEcCas plasmid is an E. coli episomal plasmid containing the L-arabinose-inducible Red recombinase element, the Cas9 protein encoding gene Cas9, the sgRNA used in the pTargetF induction elimination plasmid, and the kanamycin resistance gene KanR. The pEcgRNA plasmid is an E. coli episomal plasmid containing the spectinomycin resistance gene aadA and the promoter pJ23119 for transcribing the sgRNA.
[0097] According to the sequence of the target editing site, a primer containing a 20-base sequence (N20) matching the target site is set. Using a commercial pEcgRNA plasmid (purchased from Addgene) as a template, the pEcgRNA plasmid backbone is obtained by PCR amplification. The pEcgRNA plasmid backbone is then self-circularized using a recombinase to obtain the target gene knockout plasmid. Secondly, the plasmid pEcCas is transformed into host cells to induce the expression of the λ-Red recombination system to prepare competent cells. The knockout plasmid pEcgRNA and Donor DNA are then transformed into competent cells for gene editing and recombination. Transformants are obtained by plating and culture, and the genome recombination is verified by sequencing. Then, the plasmid repair system on the pEcCas plasmid in the strain is induced to cut the pEcgRNA knockout plasmid, completing a round of genetic modification. The above steps can be performed sequentially to modify multiple gene sites in the host genome to achieve gene deletion or insertion. Finally, the cells are cultured at 37°C to eliminate the pEcCas plasmid.
[0098] Table 1 Plasmids used in the present invention
[0099] Table 2 Strains used in the present invention
[0100] Example 1 Construction of the E. coli MG1655 (DE3) CRISPR system
[0101] (1) The basic plasmid pEcCas was transformed into Escherichia coli by heat shock transformation
[0102] Competent Escherichia coli E. coli MG1655 (DE3) was prepared, and the plasmid pEcCas was transformed into the cells to obtain recipient bacteria E. coli MG1655 (DE3) / pEcCas containing the pEcCas plasmid, namely E. coli strain A.
[0103] (2) Preparation of competent cells for electroporation of recipient bacteria
[0104] a. Inoculate E. coli strain A into liquid LB medium (containing kanamycin at a final concentration of 50 μg / mL) and culture at 37°C and 220 rpm / min until the logarithmic phase.
[0105] b. Inoculate the culture medium with 1% (v / v) in a 50 mL Erlenmeyer flask containing 20 mL LB medium (containing kanamycin at a final concentration of 50 μg / mL) and culture at 30°C and 200 rpm / min until the OD 600 When the OD value was 0.2-0.3, L-arabinose inducer with a final concentration of 10 mmol / L was added to induce the full expression of the λ-Red recombinase on pEcCas. 600 When the pH value is 0.4-0.5, the culture is stopped (2-3h).
[0106] c. Transfer the culture medium to a 50 mL sterile centrifuge tube in a clean bench and place it on ice for 15 minutes.
[0107] d. Centrifuge the bacterial solution in the centrifuge tube at 4°C and 6000 rpm for 10 min.
[0108] e. Discard the supernatant, add 20 mL of pre-cooled ddH2O and gently resuspend the cells. Centrifuge at 6000 rpm at 4°C for 10 min. Repeat the procedure once more.
[0109] f. Discard the supernatant, add 20 mL of pre-chilled 10% glycerol and gently resuspend the cells. Centrifuge at 6000 rpm at 4°C for 10 min.
[0110] e. Discard the supernatant and resuspend the cells in 5 mL of pre-cooled 10% glycerol. Aliquot 50-80 μL of competent cells (competent cells of E. coli strain A) into 1.5 mL centrifuge tubes and place on ice for later use.
[0111] (3) Transformation of the pEcgRNA plasmid (pEcgRNA-pta) required for pta knockout (see Example 2 for construction) and Donor DNA-pta (SEQ ID NO. 45) (see Example 2);
[0112] a. Add the Donor DNA-pta and pEcgRNA-pta to be transformed into the E. coli strain A competent cells prepared in step e above, mix well, and place on ice for 30 minutes;
[0113] b. Transfer the mixture into a pre-cooled 2mm electroporation cuvette and place on ice for at least 2 minutes before electroporation.
[0114] c. Turn on the electroporator and set the parameter to 2.5kV;
[0115] d. Remove the electroporation cuvette from the ice, wipe off the surface moisture with a paper towel, and place it in the sample chamber for electroporation. Immediately after electroporation, add room-temperature LB medium to suspend the cells. Allow to recover at 37°C for 2 hours. Spread the cells on an LB plate containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin, and incubate at 37°C overnight.
[0116] e. Pick the clones grown on the plate and perform colony PCR verification using verification primers (for editing the pta site, the verification primers are pta-L-up1: TGAGCGTTGACGCAATCA SEQ ID NO. 38 & pta-R-down1: GATCCTGAGGTTAATCCTTCAAA SEQ ID NO. 39) to obtain the correct gene-edited strain B (knockout gene pta);
[0117] (4) Elimination of pEcgRNA plasmid
[0118] a. Inoculate the verified gene-edited strain B into 5 mL of LB medium (containing kanamycin at a final concentration of 50 μg / mL), add rhamnose at a final concentration of 10 mM to induce transcription of the sgRNA on the plasmid pEcCas. Incubate at 37°C for 12-16 hours. Use an inoculation loop to dip an appropriate amount of bacterial solution and streak it on an LB plate containing kanamycin at a final concentration of 50 μg / mL.
[0119] b. Pick 20-30 isolated single colonies and spot them one by one on dual-antibiotic plates containing 50 μg / mL kanamycin, 50 μg / mL kanamycin, and 50 μg / mL spectinomycin. Incubate the plates at 37°C. Select a single colony that does not grow on the dual-antibiotic plates but grows on the kanamycin plates and expand it for seed preservation. This single colony is strain C that has been eliminated of the pEcgRNA plasmid but retains the pEcCas plasmid, as shown in Figure 3.
[0120] c. Transform the constructed other gene integration plasmids into strain C, screen and obtain gene integration strains, and then eliminate the knockout plasmids, thereby achieving cyclic genome editing.
[0121] For example, the pEcgRNA plasmid (pEcgRNA-M1-93-ftsZ) constructed based on M1-93-ftsZ and Donor DNA-M1-93-ftsZ (SEQ ID NO. 54) (construction process is the same as in Example 2) are first transformed into the competent Escherichia coli (strain C) in which the pta gene is knocked out but the pEcCas plasmid is retained, and then the pEcgRNA-M1-93-ftsZ plasmid is eliminated to obtain strain E;
[0122] Then, another pEcgRNA plasmid (pEcgRNA-minCDE) and Donor DNA-minCDE (SEQ ID NO.61) constructed based on minCDE (the construction process is the same as in Example 2) were transformed into strain E+pEcCas strain, and then the pEcgRNA-minCDE plasmid was eliminated; finally, the basic plasmid pEcCas was eliminated to obtain strain E. This example details the operation steps of CRISPR, and Examples 2-6 use CRISPR for specific operations.
[0123] (5) Elimination of basic plasmid
[0124] After genome editing is complete, the genome-edited strain containing only the pEcCas plasmid, strain A, is inoculated into LB medium and cultured overnight at 37°C without any antibiotics. An appropriate amount of bacterial solution is dipped into an inoculating loop and plated one colony at a time on an LB plate without any antibiotics (cultured at 37°C) and an LB plate containing a final concentration of 50 μg / mL kanamycin (cultured at 30°C). Single colonies that do not grow on the kanamycin LB plate but grow on the corresponding LB plate are picked. This single colony is the strain that has eliminated the basic plasmid pEcCas. Finally, streak the LB plate; dilute and spread it on the LB plate and culture at 37°C. Pick 20-30 isolated gene-edited strains that do not contain any plasmids, namely strains D, E, F, G, H, I, J, K, L, M, and N.
[0125] Example 2: Construction of E. coli MG1655 (DE3) Δpta (strain D) and E. coli MG1655 (DE3) Δpta::M1-93-ftsZ (strain E) strains
[0126] 1. Construction of pEcgRNA-pta knockout plasmid
[0127] Primers were designed based on the upstream and downstream sequences of the E. coli pta gene. Based on the E. coli genome sequence published on NCBI, the phosphate acetyltransferase pta sequence (Accession IDs: EG20173 (EcoCyc)) was found. The cleavage site N20 (GCTGATTCCGCTGCGGCCTT) was selected at the pta site. Bidirectional amplification primers for pEcgRNA whole plasmid PCR were designed to obtain the pEcgRNA-pta knockout plasmid, as shown in Figure 4. The primers are as follows:
[0128] pEcgRNA-pta-up:GCTGATTCCGCTGCGGCCTTgttttagagctagaaatagcaag SEQ ID NO.40
[0129] pEcgRNA-pta-down:AAGGCCGCAGCGGAATCAGCactagtattatacctaggactg SEQ ID NO.41
[0130] 2. The upstream and downstream homology arm primers for pta knockout were amplified by PCR as follows:
[0131] a) Primers for amplifying the upstream homology arms of the pta knockout gene, using the Escherichia coli K-12 substr.
[0132] MG1655(DE3) genome (NCBI accession number: ASM584v2):
[0133] pta-L up1:TGAGCGTTGACGCAATCA SEQ ID NO.38
[0134] pta-L-ko down:AGCTGCGGATGATGACGAGAGGTTTATCCTCTTTCGTTACCG SEQ ID NO.42
[0135] b) Primers for amplifying the downstream homology arms of the pta knockout gene, using the Escherichia coli K-12 substr. MG1655 (DE3) genome as the template:
[0136] pta-R-up1:TCTCGTCATCATCCGCAG SEQ ID NO.43
[0137] pta-R-down:GATCCTGAGGTTAATCCTTCAAA SEQ ID NO.44
[0138] c) amplifying the pta-knockout Donor DNA-pta fragment (the sequence is SEQ ID NO. 45), using the template as the recombinant fragment of the pta-knockout upstream homology arm in a and the downstream homology arm in b;
[0139] pta-L-up2:TGACCAAAGAGTCTGGCCT SEQ ID NO.46
[0140] pta-R-down2:GTCGTGAACAGCTGTACGC SEQ ID NO.47
[0141] 3. PCR was used to amplify the upstream homology arm, downstream homology arm, and artificial regulatory elements M1-93 and ftsZ replaced by M1-93-ftsZ. The primers are as follows:
[0142] d) Amplify the ftsZ replacement upstream homology arm using the Escherichia coli K-12 substr.MG1655(DE3) genome as the template:
[0143] pta-L-up1:TGAGCGTTGACGCAATCA SEQ ID NO.38
[0144] pta-L-down:GGTTTATCCTCTTTCGTTACCG SEQ ID NO.48
[0145] e) Amplify the artificial regulatory element M1-93 using a synthetic M1-93 sequence (GenWeiZhi Biotechnology Co., Ltd.) as the template. The sequence was referenced from the literature (Wenbo Hu et al, 2023):
[0146] M1-ftsZ-up:GTAACGAAAGAGGATAAACCTTATCTCTGGCGGTGTTG SEQ ID NO.49
[0147] M1-ftsZ-down:CCCAGTTCGATGCTGCTCATAGCTGTTTCCTGGTTTAAAC SEQ ID NO.50
[0148] f) Amplification of the ftsZ fragment using the Escherichia coli K-12 substr. MG1655 (DE3) genome as template:
[0149] ftsZ-up:atgTTTGAACCAATGGAACTTAC SEQ ID NO.51
[0150] ftsZ-down:CTGCGGATGATGACGAGAttaATCAGCTTGCTTACGCA SEQ ID NO.52;
[0151] g) Amplify the downstream homology arm of ftsZ replacement using the Escherichia coli K-12 substr.MG1655 (DE3) genome as template:
[0152] pta-R up:TCTCGTCATCATCCGCAG SEQ ID NO.53
[0153] pta-R down1:GATCCTGAGGTTAATCCTTCAAA SEQ ID NO.39;
[0154] h) Amplify the Donor DNA-M1-93-ftsZ (SEQ ID NO. 54) fragment, using the homologous recombination product of the four fragments as the template:
[0155] pta-L up2: TGACCAAAGAGTCTGGCCT
[0156] pta-R down2:GTCGTGAACAGCTGTACGC
[0157] One-step homologous recombination technology was used to recombine the upstream and downstream homology arms of the pta knockout, as well as the upstream and downstream homology arms and M1-93 for ftsZ replacement. After recombination, a round of PCR amplification was performed to recover the target fragments, respectively obtaining DonorDNA-pta and DonorDNA-M1-93-ftsZ. Subsequently, the pEcgRNA-pta knockout plasmid and the DonorDNA-pta fragment or the pEcgRNA-pta knockout plasmid and the DonorDNA-M1-93-ftsZ fragment were co-transformed into E. coli strain A. CRISPR technology was used to complete gene knockout or replacement, and the control strain E. coli MG1655 (DE3) Δpta, i.e., strain D, in which pta was successfully knocked out, or the engineered strain E. coli MG1655 (DE3) Δpta::M1-93-ftsZ, i.e., strain E, in which the artificial element M1-93-ftsZ was replaced, was screened. The specific transformation steps were the same as in Example 1.
[0158] Example 3 Construction of E. coli MG1655 (DE3) Δpta::M1-93-ftsZΔminCDE strain (strain F)
[0159] 1. Construction of pEcgRNA-minCDE knockout plasmid
[0160] Primers were designed based on the upstream and downstream sequences of the E. coli minCDE gene. Based on the E. coli genome sequence published on NCBI, the Z-ring localization protein MinC / D / E sequence (Accession IDs: EG10596 (EcoCyc) / EG10597 (EcoCyc) / EG10598 (EcoCyc)) was found. The cleavage site N20 (TACTCGATTTCTTTCTCTCG) was selected from this sequence to design bidirectional amplification primers for pEcgRNA whole plasmid PCR. The pEcgRNA-minCDE knockout plasmid was obtained, as shown in Figure 5. The primers are as follows:
[0161] pEcgRNA-minCDE-up:TACTCGATTTCTTTCTCTCGgttttagagctagaaatagcaag SEQ ID NO.55
[0162] pEcgRNA-minCDE-down:CGAGAGAAAGAAATCGAGTAactagtattatacctaggactg SEQ ID NO.56
[0163] 2. The primers for the upstream homology arm and downstream homology arm of minCDE knockout were amplified by PCR as follows: a) The primers for the upstream homology arm of minCDE knockout were amplified using the Escherichia coli K-12 substr.MG1655 (DE3) genome as the template:
[0164] minCDE-L up1:ACCGTACAACACTTATGCTCAT SEQ ID NO.57
[0165] minCDE-L-ko down:GCGCTTTTACAGCGGGCCCTGGCCTTACTCAATTAGCTAT SEQ ID NO.58
[0166] b) Primers for amplifying the downstream homology arms of the minCDE knockout gene, using the Escherichia coli K-12 substr.MG1655 (DE3) genome as the template:
[0167] minCDE-R-up1:CTAATTGAGTAAGGCCAGGGCCCGCTGTAAAAGCGCATTTATC SEQ ID NO.59
[0168] minCDE-R-down:ATATACCAGGCAGCTATTAAAGCC SEQ ID NO.60
[0169] c) Amplify the minCDE knockout donor DNA fragment (the sequence is SEQ ID NO.61); the template is the recombinant fragment of the upstream and downstream homology arms of the minCDE knockout minCDE-L-up1:ACCGTACAACACTTATGCTCATT SEQ ID NO.57
[0170] minCDE-R-down:ATATACCAGGCAGCTATTAAAGCC SEQ ID NO.60
[0171] The pEcgRNA-minCDE knockout plasmid and the Donor DNA-minCDE (SEQ ID NO. 61) fragment were co-transformed into E. coli strain E containing the pEcCas plasmid. CRISP technology was used to complete gene knockout, and the engineered strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDE, which successfully knocked out minCDE, was screened and obtained, namely strain F. The specific transformation steps were the same as in Example 1.
[0172] Example 4: Construction of E. coli MG1655 (DE3) Δpta ΔfrmA (strain G) and E. coli MG1655 (DE3) Δpta::M1-93-ftsZ ΔminCDE ΔfrmA strain (strain F)
[0173] 1. Construction of pEcgRNA-frmA knockout plasmid
[0174] Primers were designed based on the upstream and downstream sequences of the E. coli frmA gene. Based on the E. coli genome sequence published on NCBI, the formaldehyde dehydrogenase sequence (Accession IDs: EG50010 (EcoCyc)) was found. The cleavage site N20 (CGTAGTCGCGGAAGTGTCTC) was selected from this sequence to design bidirectional amplification primers for pEcgRNA whole plasmid PCR. The pEcgRNA-frmA knockout plasmid was obtained, as shown in Figure 6. The primers are as follows:
[0175] pEcgRNA-frmA-up:CGTAGTCGCGGAAGTGTCTCgttttagagctagaaatagcaa SEQ ID NO.62
[0176] pEcgRNA-frmA-down:GAGACACTTCCGCGACTACGactagtattatacctaggactg SEQ ID NO.63
[0177] 2. The upstream and downstream homology arms of frmA knockout were amplified by PCR. The primers are as follows:
[0178] a) Primers for amplifying the upstream homology arms of the frmA knockout gene, using the Escherichia coli K-12 substr. MG1655 (DE3) genome as the template:
[0179] frmA-L up:AGCTCGTTGCGGATATAGT SEQ ID NO.64
[0180] frmA-L down:ATATTGAGGAAGAGCGAGAGTTTCCCGCAGGTTTACCCC SEQ ID NO.65
[0181] b) Primers for amplifying the downstream homology arms of the frmA knockout gene, using the Escherichia coli K-12 substr. MG1655 (DE3) genome as the template:
[0182] frmA-R-up:CTCTCGCTCTTCCTCAATATG SEQ ID NO.66
[0183] frmA-R-down:CCCTTTCCTCTTTGTTTTCCG SEQ ID NO.67
[0184] c) Amplify the frmA knockout Donor DNA-frmA fragment (SEQ ID NO. 68), the template is the recombinant fragment of the upstream and downstream homology arms of the frmA knockout
[0185] frmA-L-up:AGCTCGTTGCGGATATAGT SEQ ID NO.64
[0186] frmA-R-down:CCCTTTCCTCTTTGTTTTCCG SEQ ID NO.67
[0187] The pEcgRNA-frmA knockout plasmid and the Donor DNA-frmA (SEQ ID NO. 68) fragment were co-transformed into the E. coli strain DE. coli strain F containing the pEcCas plasmid. CRISPR technology was used to complete gene knockout, and the control strain MG1655 (DE3) ΔptaΔfrmA, strain G, and the engineered strain E. coli MG1655 (DE3) Δpta::M1-93-ftsZΔminCDEΔfrmA, strain H, in which frmA was successfully knocked out, were screened. The specific transformation steps were the same as in Example 1.
[0188] Example 5: Construction of E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA strain (strain I) and E. coli MG1655 (DE3) Δpta::M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA strain (strain J)
[0189] 1. Construction of pEcgRNA-rpiA knockout plasmid
[0190] Primers were designed based on the upstream and downstream sequences of the E. coli rpiA gene. Based on the E. coli genome sequence published on NCBI, the ribose-5-phosphate isomerase A sequence (Accession IDs: EG111443 (EcoCyc)) was found. The cleavage site N20 (CGCGTCAATAAAGTGTGCGG) was selected from this sequence to design bidirectional amplification primers for pEcgRNA whole plasmid PCR. The pEcgRNA-rpiA knockout plasmid was obtained, as shown in Figure 7. The primers are as follows:
[0191] pEcgRNA-rpiA-up:CGCGTCAATAAAGTGTGCGGGTTTTAGAGCTAGAAATAGCAAG SEQ ID NO.69
[0192] pEcgRNA-rpiA-down:CCGCACACTTTATTGACGCGACTAGTATTATACCTAGGACTGAG SEQ ID NO.70
[0193] 2. The upstream and downstream homology arm primers for rpiA knockout were amplified by PCR as follows:
[0194] a) Primers for amplifying the upstream homology arms of the rpiA knockout gene, using the Escherichia coli K-12 substr. MG1655 (DE3) genome as the template:
[0195] rpiA-L up:CTGCCCGAACATATTTTCCAG SEQ ID NO.71
[0196] rpiA-L down:CGGGGGGAGGTTCCCCCGTCAGAGATCGTTTCGCCTGTGGTAT SEQ ID NO.72
[0197] b) Primers for amplifying the downstream homology arms of the rpiA knockout gene, using the Escherichia coli K-12 substr.
[0198] MG1655(DE3) genome:
[0199] rpiA-R-up:TCTGACGGGGGAACCTCCCCCGTTA SEQ ID NO.73
[0200] rpiA-R-down:GCCGATGATACCCAGCTTTTTG SEQ ID NO.74
[0201] c) Amplifying the rpiA knockout Donor DNA-rpiA fragment (the sequence is SEQ ID NO. 75), the template is the recombinant fragment of the upstream and downstream homology arms of the rpiA knockout
[0202] rpiA-L-up:CTGCCCGAACATATTTTCCAG SEQ ID NO.71
[0203] rpiA-R-down:GCCGATGATACCCAGCTTTTTG SEQ ID NO.74
[0204] The pEcgRNA-rpiA knockout plasmid and the Donor DNA-rpiA (SEQ ID NO. 75) fragment were co-transformed into E. coli strain H containing the pEcCas plasmid. CRISP technology was used to complete gene knockout, and the control strain MG1655 (DE3) Δpta ΔfrmA ΔrpiA, strain I, and the engineered strain E. coli MG1655 (DE3) Δpta::M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA, strain J, in which rpiA was successfully knocked out, were screened. The specific transformation steps were the same as in Example 1.
[0205] Example 6: Construction of E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB strain (strain K) and E. coli MG1655 (DE3) Δpta::M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB strain (strain L)
[0206] 1. Construction of pEcgRNA-rpiB knockout plasmid
[0207] Primers were designed based on the upstream and downstream sequences of the E. coli rpiB gene. Based on the E. coli genome sequence published on NCBI, the ribose-5-phosphate isomerase B sequence (Accession IDs: EG11827 (EcoCyc)) was found. The cleavage site N20 (AAGTGATTGATAAAGGAACC) was selected from this sequence to design bidirectional amplification primers for pEcgRNA whole plasmid PCR. The pEcgRNA-rpiB knockout plasmid was obtained, as shown in Figure 8. The primers are as follows:
[0208] pEcgRNA-rpiB-up:AAGTGATTGATAAAGGAACCGTTTTAGAGCTAGAAATAGCAAGT SEQ ID NO.76
[0209] pEcgRNA-rpiB-down:GGTTCCTTTATCAATCACTTACTAGTATTATACCTAGGACTGAG SEQ ID NO.77
[0210] 2. The upstream and downstream homology arms of rpiB knockout were amplified by PCR. The primers are as follows:
[0211] a) Primers for amplifying the upstream homology arms of rpiB knockout using the Escherichia coli K-12 substr.MG1655(DE3) genome as template:
[0212] rpiB-L up:GGGTGCACAACTCAGGTTAC SEQ ID NO.78
[0213] rpiB-L down:CCGTCCGTGCAAAACTTCAC SEQ ID NO.79
[0214] b) Primers for amplifying the downstream homology arms of rpiB knockout using the Escherichia coli K-12 substr.MG1655(DE3) genome as template:
[0215] rpiB-R-up:GTTTTGCACGGACGGGGAAGATGAGATTCATCCACTACTTGCAT SEQ ID NO.80
[0216] rpiB-R-down:CCTAACCCTCTCCCCAGAGG SEQ ID NO.81
[0217] c) amplifying the rpiB knockout Donor DNA-rpiB fragment (SEQ ID NO. 82), using the template as the recombinant fragment of the upstream and downstream homology arms of the rpiB knockout;
[0218] rpiB-L-up:GGGTGCACAACTCAGGTTAC SEQ ID NO.78
[0219] rpiB-R-down:CCTAACCCTCTCCCCAGAGG SEQ ID NO.81
[0220] The pEcgRNA-rpiB knockout plasmid and the Donor DNA-rpiB (SEQ ID NO. 82) fragment were co-transformed into E. coli strain I or strain J containing the pEcCas plasmid. CRISP technology was used to complete gene knockout, and the control strain MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB, strain K, and the engineered strain E. coli MG1655 (DE3) Δpta::M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB, strain L, in which rpiB was successfully knocked out, were screened. The specific transformation steps were the same as in Example 1.
[0221] Example 7: Construction of E. coli MG1655 (DE3) Δpta ΔfrmA ΔrpiA ΔrpiB ΔcyaA strain (strain M) and E. coli MG1655 (DE3) Δpta::M1-93-ftsZ ΔminCDE ΔfrmA ΔrpiA ΔrpiB ΔcyaA strain (strain N)
[0222] λ-Red one-step recombination method was used to knock out the expression of cyaA gene:
[0223] a) First, the pKD46 plasmid (as shown in FIG9 ) was chemically transformed into strain K and strain L constructed in Example 6, and single colonies were picked and placed in liquid culture medium, and cultured at 30° C. and 220 rpm until OD 550 ~0.3, placed on ice for 30 min, and centrifuged at 6000 rpm at 4°C for 5 min to prepare electrocompetent strains K and L;
[0224] b) constructing a recombinant fragment FKF::cyaA (the sequence is SEQ ID NO.85);
[0225] The recombinant fragment FKF::cyaA was obtained by PCR amplification and recovery of the target fragment. The template was the pKD4 plasmid (purchased from Beijing Huayueyang Biological). The primers were as follows:
[0226] cyaA-up:CAGGCGATACGTCTTGTACCTCTATATTGAGACTCTGAAACAGAGACTGGATGCCATAAATCAAGGAACACTTAACGGCTGAC(SEQ ID NO.83)
[0227] cyaA-down: CTTTCCGGCACGTTCATCACGAAAAATATTGCTGTAATAGCGGCGTATCGTGATCCTGATTGGCAGGTCTTGAGCGATTGTGTAGG (SEQ ID NO. 84);
[0228] c) electroporating the constructed recombinant fragment FKF::cyaA into competent cells of strain K and strain L obtained in step a), and culturing at 30° C. to obtain transformants; achieving the purpose of cyaA knockout on the chromosome through one-step recombination.
[0229] The temperature-sensitive plasmid pKD46 was eliminated by high temperature induction at 37°C to obtain the control strain E. coli MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiBΔcyaA after cyaA knockout, namely strain M, and the corresponding engineered strain E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔfrmAΔrpiAΔrpiBΔcyaA, namely strain N.
[0230] Example 8: Analysis of relative expression of ftsZ gene in strains D and E
[0231] The strain D and strain E constructed in Example 2 were selected to test the relative expression level of the ftsZ gene.
[0232] In addition, as a control, the control strain E. coli MG1655 (DE3) Δpta constructed in Example 2 was tested in the same manner.
[0233] The specific steps are as follows:
[0234] Real-time PCR technology was used to detect the expression level of ftsZ, which included four steps: RNA collection and extraction, genomic DNA removal, reverse transcription, and RT-PCR.
[0235] RNA collection and extraction: Wild-type strain MG1655 (DE3), E. coli strain D, and strain E were streaked and activated, and single colonies were picked and placed in fresh LB medium. The cells were cultured at 37°C, 220 rpm, and reached the stationary phase. The colonies were then transferred to fresh LB liquid medium with an initial OD550 of 0.1 and cultured at 37°C, 220 rpm, until the early logarithmic phase. 2 mL of the culture medium was collected, centrifuged, and the supernatant discarded. Total RNA from each strain was extracted using a bacterial RNA extraction kit.
[0236] Genomic DNA removal and reverse transcription: Use a reverse transcription kit for these two steps. Mix ~1 μg of total RNA with each reagent on ice and incubate at 42°C for 2 minutes to remove gDNA. Add reverse transcriptase and reaction buffer to the gDNA-removed system and synthesize the first-strand cDNA at 37°C for 15 minutes. Terminate the reaction at 85°C for 5 seconds.
[0237] Compared with the wild-type strain MG1655 (DE3) and strain D, the expression level of ftsZ in strain E was upregulated 10-fold, as shown in Figure 10B , indicating that our strategy of overexpressing the ftsZ gene by integrating additional copies of the M1-93-ftsZ expression cassette into the E. coli genome is feasible.
[0238] Example 9: Cell size analysis of strain D and strain F
[0239] The E. coli strain F constructed in Example 3 was selected for formaldehyde tolerance test.
[0240] In addition, as a control, the control strain E. coli D constructed in Example 2 was tested in the same manner.
[0241] The specific steps are as follows:
[0242] Pick the activated strains D and F by streaking, culture them in 200 mL of LB medium for 48 hours, and centrifuge them at 800 g for 5 minutes at room temperature to remove most of the bacterial cells. Collect the supernatant and centrifuge it as well. Then resuspend the precipitate in 50 mL of fresh LB medium and culture it at 37°C, 250 rpm for 30 minutes to promote the growth of the remaining cells. Add ceftriaxone (100 μg / mL) and culture it at 37°C, 250 rpm for 30 minutes to kill most of the parent cells. After ceftriaxone treatment, centrifuge at 800 g for 5 minutes at room temperature to remove cell debris. Collect the supernatant and centrifuge it at 13,000 g for 15 minutes at 4°C. The separated cells were washed twice in PBS buffer (pH 7.0) for scanning electron microscopy and transmission electron microscopy observation.
[0243] Scanning electron microscopy: Strains cultured in LB medium to the stationary phase were collected by centrifugation, washed several times with 0.1 mol / L PBS, and fixed overnight with 2.5% glutaraldehyde. The samples were washed several times with PBS to remove residual glutaraldehyde, dehydrated by immersion in different concentration gradients of ethanol (30%-100%), critical point dried overnight, and the sample surface was sprayed with gold for observation by scanning electron microscopy.
[0244] Transmission electron microscopy: Strains grown in LB medium to the stationary phase were harvested by centrifugation, washed several times with 0.1 mol / L PBS, and fixed overnight with 2.5% glutaraldehyde. Wash several times with PBS to remove any residual glutaraldehyde. A 4-8 μL sample was dripped onto a hydrophilic-treated grid and allowed to stand for 1-5 minutes before observation under a transmission electron microscope.
[0245] Wherein: PBS buffer formula is:
[0246] As shown in Figure 10C / D / E, the cell size of strain F was significantly reduced compared with strain D after overexpressing the cell division protein ftsZ and knocking out the Z ring positioning system minCDE.
[0247] Example 10: Tolerance analysis of strains D and F
[0248] The E. coli MG1655 (DE3) Δpta::M1-93-ftsZΔminCDE (strain F) constructed in Example 3 was selected for formaldehyde tolerance test.
[0249] In addition, as a control, the control strain E. coli MG1655 (DE3) Δpta (strain D) constructed in Example 2 was tested in the same manner.
[0250] The specific steps are as follows:
[0251] A single colony activated by streaking was selected and inoculated into 15 mL of MOPS medium. Culture was continued overnight at 37°C and 200 rpm until the logarithmic phase (OD550 ~1.5-2.0). OD550 was measured. The culture was diluted to an OD550 of ~0.1 with MOPS medium supplemented with final concentrations of 0 mM, 0.25 mM, 0.5 mM, 0.75 mM, and 1 mM, respectively. 200 μL of the culture was added to three replicates of a 96-well plate. A control containing the culture diluted in MOPS medium without formaldehyde was used to monitor growth. OD550 readings were taken every 10 minutes using a microplate reader for 24 hours. Growth curves were plotted, and the μ values were compared by fitting the logarithmic exponential trend line to determine the inhibitor tolerance of the engineered bacteria.
[0252] Figure 11 shows that the tolerance of the modified strain F (E. coli MG1655 (DE3) Δpta::M1-93-ftsZΔminCDE) was significantly improved. First, strain F improved its tolerance to formaldehyde. As shown in Figure 11, when the culture medium did not contain formaldehyde, the specific growth rate (μ = 0.39h) of strain F was significantly improved compared to that of strain D. -1 ), the growth of strain F was weak (μ=0.36h -1 ); When the culture medium contained 0.75 mM formaldehyde, the specific growth rate of strain F (0.34 h -1 ) compared with the specific growth rate of strain D (0.31h -1 ) increased by 16%. This trend still existed when the formaldehyde concentration was higher. When the formaldehyde concentration was 1 mM, the specific growth rate of strain F (0.32 h -1 ) compared with the specific growth rate of strain D (0.23h -1 ) increased by 40%. Further analysis found that 1 mM formaldehyde reduced the specific growth rate of strain D by more than 40% (from 0.39 h -1 to 0.23h -1 ), while the specific growth rate of strain F was only reduced by 10% (from 0.36h -1 to 0.32h -1 ). This was also confirmed by observation of cell number using a fluorescence microscope.
[0253] In addition to formaldehyde, we also characterized the tolerance of strains D and F to other aldehydes (furfural, vanillin, and HMF). As shown in Figure 12, strain F was not tolerant to any of these aldehydes. These results indicate that strain F is tolerant to formaldehyde.
[0254] Example 11: Cell membrane function analysis of strains D and F
[0255] The E. coli MG1655 (DE3) Δpta::M1-93-ftsZΔminCDE (strain F) constructed in Example 3 was selected for cell membrane fluidity test.
[0256] In addition, as a control, the control strain E. coli MG1655 (DE3) Δpta (strain D) constructed in Example 2 was tested in the same manner.
[0257] The specific steps are as follows:
[0258] Pick the activated single clone by streaking and inoculate it into 15 mL MOPS medium. Incubate overnight at 37°C, 200 rpm until the logarithmic phase (OD550 ~ 1.5-2.0). Measure OD550. Collect the exponential phase cells (5000g, 10 min), wash them twice with 0.1M PBS buffer (pH 7.0), and then suspend them to OD 550 ~1. Use PBS to dilute the DPH stock solution to 2×10 -6 Add 500 μL of bacterial suspension to 500 μL of DPH working solution and incubate at 37°C in the dark for 30 minutes. Centrifuge at 8000 rpm for 3 minutes. Wash the cell pellet with 500 μL of PBS buffer. Transfer 100 μL of the resuspended cells to a black opaque 96-well plate. Measure fluorescence polarization readings at excitation wavelengths of 360 / 40 nm and emission wavelengths of 460 / 40 nm using a microplate reader (96-well plate with black opaque bottom, top emission, top collection). Calculate the polarization value (P) according to the following formula:
[0259] P=(IVV-IVHG) / (IVV+IVHG)
[0260] IVV: Fluorescence intensity measured with the polarizer and analyzer optical axes aligned vertically; IVH: Fluorescence intensity measured with the polarizer and analyzer optical axes aligned vertically and horizontally, respectively. G is the correction factor, set to 1. A larger P value indicates lower membrane fluidity.
[0261] As shown in Figure 13, after strain D (E. coli MG1655 (DE3) Δpta) and strain F (E. coli MG1655 (DE3) Δpta::M1-93-ftsZΔminCDE) in the stable phase were treated with formaldehyde at a final concentration of 5 mM for 2 hours, the cell membrane microviscosity of strain F increased by 83% compared with that of strain D, indicating that its cell membrane fluidity was significantly reduced compared with that of strain D.
[0262] Example 12: Analysis of cell membrane components of strains D and F
[0263] The E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDE (strain F) constructed in Example 3 was selected for analysis of cell membrane components.
[0264] In addition, as a control, the control strain E. coli MG1655 (DE3) Δpta (strain D) constructed in Example 2 was tested in the same manner.
[0265] The specific steps are as follows:
[0266] Pick the activated single clone by streaking and inoculate it into 15 mL MOPS medium. Incubate overnight at 37°C, 200 rpm until the logarithmic phase (OD550 ~ 1.5-2.0). Measure OD550. Collect the exponential phase cells (5000g, 10 min), wash them twice with 0.1M PBS buffer (pH 7.0), and then suspend them to OD 550 The relative contents of phosphatidylethanolamine (PE), phosphatidylglycerol (PG), and cardiolipin (CL) in the cell membrane phospholipids of strains D (E. coli MG1655(DE3)Δpta) and F (E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDE) were measured using a cell membrane phospholipid composition assay kit. As shown in Figure 14, the ratio of CL / (PE+PG+CL) in the cell membrane of strain F was significantly higher than that of strain D (Figure 14), confirming that the cardiolipin content in the cell membrane of strain F was significantly increased.
[0267] Example 13: Analysis of Methanol Utilization Ability of the Recombinant E. coli MG1655(DE3)Δpta::M1-93-ftsZΔminCDEΔrpiAΔrpiBΔcyaA
[0268] The micro Escherichia coli with improved formaldehyde tolerance constructed by the present invention can be used as a chassis cell to utilize various one-carbon compounds such as methanol. Specifically, the following steps are included:
[0269] 1. Transform the methanol utilization plasmid pCDF-RuMP into the control bacteria (strain M) and the engineered bacteria (strain N);
[0270] 2. The CT4-1mdh gene in the pCDF-RuMP vector is derived from Cupriavidus necator, and the hps-phi operon is derived from Bacillus methanolicus (NCBI accession number GCF_000262755.1);
[0271] The CT4-1mdh gene was optimized and conventionally synthesized by GENEWIZ (Suzhou GENEWIZ Biotechnology Co., Ltd.) at the MCS1 site of the pCDF-duet (Spectinomycin) plasmid to obtain the pCDF-CT4-1mdh plasmid. The hps-phi operon was then cloned into the MCS2 site of the pCDF-CT4-1mdh plasmid.
[0272] Primers were designed containing homologous sequences on the left and right sides of the insertion site of the pCDF-CT4-1mdh plasmid. The primer sequences are as follows:
[0273] Vector backbone primers:
[0274] P2-F:GCAGATCTCAATTGGATATCGG SEQ ID NO.86
[0275] P2-R:CCATATGTATATCTCCTTCTTATACTT SEQ ID NO.87
[0276] hps-phi operon:
[0277] HPS-F:GTATAAGAAGGAGATATACATATGGAACTGCAACTGGCTC SEQ ID NO.88
[0278] PHI-R:GATATCCAATTGAGATCTGCTTATTCCAGGTTAGCGTGACG SEQ ID NO.89
[0279] The vector backbone and gene fragment were cloned separately by PCR. After purification and recovery of the PCR products, the vector backbone and gene fragment were seamlessly cloned. The assembled products were used for heat shock transformation to screen single clones for sequencing verification to obtain the target plasmid pCDF-RuMP (map shown in Figure 15).
[0280] (1) For the co-utilization of methanol and xylose, MOPS + 2% (wt / v) casein acid hydrolysate + 50 mM xylose + 450 mM methanol were used for cultivation;
[0281] Among them: MOPS culture medium formula is:
[0282] 40X "M"
[0283] The micronutrient solution ingredients are:
[0284] The compositions of ZnCl2 solution, Na2SeO3 solution and Na2MoO4 solution are:
[0285] (2) Culture the cells at 37°C and 250 rpm using 0.1 mM IPTG as an inducer, sampling every 24 h. The culture fluid was centrifuged and filtered, and then analyzed by high performance liquid chromatography.
[0286] As shown in FIG16 , when the final concentration of methanol in the culture medium was 450 mM, the control bacteria reached its maximum biomass (OD 550 =0.6), consumed 13mM (0.42g / L) of methanol and 6mM (0.9g / L) of xylose during the entire culture period.550 =6.2) is 10 times that of the control bacteria, and the consumption of methanol is 170mM (5.4g / L) and xylose is 48mM (7.2g / L), which are 13 times and 8 times that of the control bacteria respectively. When the final concentration of methanol in the culture medium is further increased to 900mM, the engineered bacteria can still grow normally and reach its maximum biomass (OD 550 =3.5), respectively, the control bacteria (4mM methanol, 3mM xylose, OD 550 =0.2). We then analyzed the growth of the control and engineered bacteria at even higher methanol concentrations. The results showed that the engineered bacteria could still grow at a methanol concentration of 1350 mM (43 g / L), while the growth of the control bacteria was completely inhibited. To our knowledge, this is the highest methanol concentration tolerated by synthetic methylotrophic bacteria.
[0287] Example 14: Analysis of intracellular formaldehyde content in strains M and N
[0288] To clarify whether the low growth and methanol assimilation efficiency of strain M compared to strain N was due to the formation of toxic formaldehyde in the RuMP pathway, we evaluated the intracellular formaldehyde concentrations of strains M and N. The following steps were performed:
[0289] (1) Same as Example 13;
[0290] (2) Same as Example 13;
[0291] (3) For the determination of intracellular formaldehyde, MOPS + 2% (wt / v) casein acid hydrolysate + 50 mM xylose + 450 mM methanol were used for cultivation. Cell samples were collected every 24 h and analyzed for biomass (OD550) and formaldehyde. 2 ml of culture was mixed with 0.2 mL of 20% (w / v) trichloroacetic acid, 0.1 mL of 2,4-dinitrophenylhydrazine, and 0.5 mL of acetonitrile. The mixture was then vortexed for 1 min, incubated at 60°C for 30 min, and centrifuged at 13,000 g for 10 min. The supernatant was analyzed by HPLC equipped with a C18 reverse phase column. 65% acetonitrile was used as the mobile phase at a flow rate of 0.3 mL / min.
[0292] Wherein: the MOPS culture medium formula is the same as that in Example 13.
[0293] As shown in Figure 17, strain M maintained intracellular formaldehyde concentrations as high as 47 μM / g DCW, four-fold higher than the empty vector, confirming our hypothesis that formaldehyde produced during methylotrophic metabolism impairs its fitness. These results are consistent with our previous observations that formaldehyde, rather than methanol, causes severe cytotoxicity. In contrast to strain M, strain N maintained rapid growth despite intracellular formaldehyde concentrations reaching 35 μM / g DCW.
[0294] Example 15: Strain N 13 C methanol metabolic flux analysis
[0295] The micro Escherichia coli with improved formaldehyde tolerance constructed by the present invention can be used as a chassis cell to utilize various one-carbon compounds such as methanol to enter central carbon metabolism. Specifically, the following steps are included:
[0296] (1) Same as Example 13;
[0297] (2) Same as Example 13;
[0298] (3) Same as Example 13;
[0299] (4) After 96 h of culture, the cells were centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the cells were collected and sent to Shanghai Puling Biotechnology Co., Ltd. for 13C methanol metabolic flux analysis.
[0300] We further optimized the experimental conditions for methanol assimilation in a 250 mL baffled shake flask. As shown in Figure (16) A, strain N grew rapidly. On the 4th day, the biomass reached the highest level (OD550 = 10), and 330 mM (10.6 g / L) of methanol was consumed. The maximum consumption rate was 175 mM / day (5.3 g / L / day), which is the highest methanol consumption and consumption rate among all synthetic methylotrophic Escherichia coli.
[0301] As shown in Figures 18B and C, strain N failed to grow when only 50 mM xylose and 2% (wt / v) casein acid hydrolysate were added to the MOPS minimal medium. Strain N also failed to grow when 2% (wt / v) glucose was added to the medium. However, when the glucose in the medium was replaced with methanol, strain N grew rapidly. These results indicate that the metabolic pattern of strain N has shifted from traditional sugar catabolism to methanol anabolism.
[0302] To confirm that methanol was assimilated in strain N, we analyzed its metabolic flux. We first examined key metabolites in the pentose phosphate pathway, glycolysis, and central carbon metabolism. As shown in Figure 18D, after 96 hours of cultivation, in the glycolysis pathway, 98% of 2-phosphoglycerate, 51% of fructose 6-phosphate, 47% of glucose 6-phosphate, 40% of pyruvate, 37% of glyceraldehyde 3-phosphate, 27% of 3-phosphoglycerate, 32% of phosphoenolpyruvate, and 23% of 1,6-bisphosphate were labeled with methanol-derived 13C. In the pentose phosphate pathway, 35% of ribose 5-phosphate and 36% of ribulose 5-phosphate were labeled. In the central carbon metabolism cycle, 37% of fumarate, 36% of malate, 36% of succinate, 27% of cis-aconitic acid, 22% of citric acid, and 10% of oxaloacetate were labeled. These results indicate that methanol successfully enters the central carbon metabolism of strain N. We also examined amino acid labeling. As shown in Figure 18E, 16 amino acids (Ala, Ser, Arg, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Pro, Ser, Thr, Trp h, and Tyr) were successfully labeled. Among the labeled amino acids, Ser, Gly, Ala, Trp, Leu, Ile, and Tyr are from the glycolysis pathway, His is from the pentose phosphate pathway, and Glu, Asp, Gln, Pro, Arg, Met, Thr, and Lys are from the TCA cycle.
[0303] Among the metabolites examined, some were labeled with multiple carbon atoms. Approximately 29% of 2-phosphoglycerate, 12% of fructose 6-phosphate, 11% of glucose 6-phosphate, 5% of fructose 1,6-bisphosphate, ribose 5-phosphate, pyruvate, citric acid, aconitic acid, fumaric acid, malic acid, and succinic acid were labeled with two carbon atoms. Between 0.2% and 1.7% of fructose 6-phosphate, aconitic acid, fumaric acid, glucose 6-phosphate, malic acid, ribose 5-phosphate, and succinic acid were labeled with three carbon atoms. Regarding amino acids, approximately 28% of Trp, 25% of Ser, 3% of Asp, and 3% of Gln were successfully labeled with two carbon atoms. 15% of Trp and 1.6% of Ser were successfully labeled with three carbon atoms, and 4.6% of Trp, 0.1% of Glu, and 0.1% of Lys were labeled with four carbon atoms. These results indicate that methanol is deeply involved in the metabolism of strain N.
[0304] Example 16: Product synthesis analysis of strains M and N
[0305] The micro E. coli with improved formaldehyde tolerance constructed by the present invention can be used as a chassis cell to utilize methanol and other one-carbon compounds for the synthesis of high-value products. Specifically, the process includes the following steps:
[0306] (1) The 3-HP production plasmid pET-3-HP or the TAL production plasmid pTrc99A-bktB was transformed into strain M and strain N containing the pCDF-RuMP plasmid;
[0307] (2) The mcrC (SEQ ID NO. 90) and mcrN (SEQ ID NO. 91) genes on the pET-3-HP vector were derived from Chloroflexus aurantiacus (NCBI accession number GCF_003514535.1), and the bktB gene (SEQ ID NO. 98) on the pTrc99A-bktB vector was derived from Ralstonia eutropha (NCBI accession number GCF_002011925.2). The target genes containing the vector homologous sequences were obtained by PCR amplification. Specifically:
[0308] Primers were designed containing homologous sequences on the left and right sides of the insertion site of the pET-3-HP plasmid. The primer sequences are as follows:
[0309] pET-mcrC-mcrN vector backbone primers:
[0310] pET-P1-F:AATTCGAGCTCGGCGCG SEQ ID NO.92
[0311] pET-P1-R:CGGATCCTGGCTGTGGTG SEQ ID NO.93
[0312] mcrN amplification primers:
[0313] mcrN-up:CACCACAGCCAGGATCCGATGAGCGGAACAGGACGA SEQ ID NO.94
[0314] mcrN-down:CATGGTTTTATTCCTCCTTAAAATCTTAAATGTTGGCAGGGATGTTGA SEQ IDNO.95
[0315] mcrC-up:GATTTTAAGGAGGAATAAACCATGAGCGCCACCACCGGCGC SEQ ID NO.96
[0316] mcrC-down:AGGCGCGCCGAGCTCGAATTTTACACGGTAATCGCCCGTC SEQ ID NO.97
[0317] The vector backbone and gene fragment were cloned separately by PCR. After purification and recovery of the PCR products, the vector backbone and gene fragment were seamlessly cloned. The assembled products were used for heat shock transformation to screen single clones for sequencing verification to obtain the target plasmid pET-3-HP (map shown in Figure 20).
[0318] pTrc99A-bktB vector backbone primers:
[0319] pTrc99A-F:TACGTGATTGATAAATCCGC SEQ ID NO.99
[0320] pTrc99A-R:GGTCTGTTTCCTGTGTGAAA SEQ ID NO.100
[0321] bktB amplification primers:
[0322] bktB-up:TTTCACACAGGAAACAGACCATGACGCGTGAAGTGGTAGT SEQ ID NO.101
[0323] bktB-down:GCGGATTTATCAATCACGTATCAGATACGCTCGAAGATGG SEQ ID NO.102
[0324] The vector backbone and gene fragment were cloned separately by PCR. After purification and recovery of the PCR products, the vector backbone and gene fragment were seamlessly cloned. The assembled products were used for heat shock transformation to screen single clones for sequencing verification to obtain the target plasmid pTrc99A-bktB (map shown in Figure 22).
[0325] As shown in Figure 19, in a shake flask containing 500mM methanol, 50mM xylose, and 2% acid hydrolyzate in MOPS minimal medium, strain M did not grow, consumed no methanol and xylose, and produced no 3-HP. Within 4 days, strain N consumed 90mM xylose and 330mM methanol (10.2g / L) and produced 120mM (10.8g / L) 3-HP, with a maximum productivity of 48mM / day (4.3g / L / day). To our knowledge, this is the highest 3-HP production and productivity among all synthetic methylotrophic bacteria.
[0326] As shown in FIG21 , strain N produced approximately 85 mg / L TAL within 4 days, which was approximately 30 times higher than that of strain M (2.8 mg / L).
[0327] Taken together, these results demonstrate the effectiveness of minicell-producing synthetic methylotrophic E. coli strains as a basis for the biosynthesis of valuable chemicals.
[0328] It can be seen that the present invention uses genetic engineering technology to construct micro Escherichia coli, combined with the optimization of the methanol utilization pathway, which can effectively improve the ability of the recombinant engineered bacteria to utilize C1 compounds.
[0329] The above describes specific embodiments of the present invention. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art may make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. The embodiments of this application and the features in the embodiments may be combined with each other in any manner unless there is a conflict.
Claims
1. Use of microcells without genomic DNA in improving formaldehyde tolerance and one-carbon compound utilization ability; the microcells without genomic DNA are produced by regulating the cell division system of bacteria.
2. The use according to claim 1, wherein The regulation of the bacterial cell division system is achieved by overexpressing the cell division protein FtsZ and its homologs, and / or inhibiting the Z-ring positioning system MinCDE and its homologs.
3. The use according to claim 1, wherein The nucleotide sequence of the gene encoding the cell division protein FtsZ is shown as any one of the sequences in SEQ ID NO.1 - SEQ ID NO.
16.
4. The use according to claim 1, wherein The nucleotide sequence of the gene minCDE encoding the Z-ring positioning system is shown as any one of the sequences in SEQ ID NO.19 - SEQ ID NO.
29.
5. Use of the cell division protein FtsZ in improving formaldehyde tolerance and / or one-carbon compound utilization ability.
6. The use according to claim 5, wherein The nucleotide sequence of the gene encoding the cell division protein FtsZ is shown as any one of the sequences in SEQ ID NO.1 - SEQ ID NO.
16.
7. A recombinant Escherichia coli with improved formaldehyde tolerance and one-carbon compound utilization ability, characterized in that Replace the phosphotransacetylase gene pta in Escherichia coli with the cell division protein FtsZ and overexpress the cell division protein FtsZ to obtain the resulting recombinant Escherichia coli; the nucleotide sequence of the gene encoding the cell division protein FtsZ is shown as any one of the sequences in SEQ ID NO.1 - SEQ ID NO.16, and the nucleotide sequence of the gene encoding phosphotransacetylase pta is shown as SEQ ID NO.
17.
8. The recombinant Escherichia coli according to claim 7, wherein The Escherichia coli is E.coli MG1655(DE3).
9. The recombinant Escherichia coli according to claim 7, wherein Overexpression of the cell division protein FtsZ is achieved by upregulating the expression of ftsZ with an artificial promoter element, and the artificial promoter element is M1 - 93; the nucleotide sequence of M1 - 93 is shown as SEQ ID NO.
18.
10. A micro-recombinant Escherichia coli, obtained by knocking out the Z-ring positioning system MinCDE on the basis of the recombinant Escherichia coli according to any one of claims 7-9; the nucleotide sequence of the gene MinCDE encoding the Z-ring positioning system is shown as any one of the sequences in SEQ ID NO.19-SEQ ID NO.
29.
11. A chassis cell for improving one-carbon compound utilization ability, characterized in that The chassis cell is obtained by knocking out at least one of the frmA gene encoding formaldehyde dehydrogenase and the following genes on the basis of the mini-recombinant Escherichia coli described in claim 10: The rpiA gene encoding ribose phosphate isomerase A; The rpiB gene encoding ribose phosphate isomerase B; The cyaA gene encoding adenylate cyclase.
12. The chassis cell according to claim 11, wherein The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown as SEQ ID NO.30; the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown as SEQ ID NO.31; the nucleotide sequence of the rpiB gene encoding ribose phosphate isomerase B is shown as SEQ ID NO.32, and the nucleotide sequence of the cyaA gene encoding adenylate cyclase is shown as SEQ ID NO.
33.
13. A cell factory for improving formaldehyde tolerance and one-carbon compound utilization ability of Escherichia coli, characterized in that Introducing the RuMP pathway into the chassis cell described in claim 11 or 12 includes introducing the mdh gene from Cupriavidus necator, the hps gene and the phi gene from Bacillus methanolicus, and the nudF protein from Escherichia coli.
14. The cell factory according to claim 13, wherein The nucleotide sequence of the mdh gene is shown as SEQ ID NO.34; the nucleotide sequence of the hps gene is shown as SEQ ID NO.35; the nucleotide sequence of the phi gene is shown as SEQ ID NO.36; the nucleotide sequence encoding the nudF protein is shown as SEQ ID NO.
37.
15. A method for constructing a cell factory according to claim 13 or 14, characterized in that The construction method includes the following steps: S1. Assemble the mdh gene from Cupriavidus necator, the hps gene and phi gene from Bacillus methanolicus, and the nudF protein from Escherichia coli into the pCDFduet-1 plasmid to obtain a plasmid for the one-carbon compound utilization pathway with high activity, denoted as the pCDF-RuMP plasmid; S2. Transfer the pCDF-RuMP plasmid into the above-mentioned chassis cells to construct the cell factory.
16. Use of a cell factory as claimed in claim 13 or 14, or a cell factory obtained by the method as claimed in claim 15, in the utilization of one-carbon compounds.