Application of LRRC8A gene inhibitor in preparation of medicine for preventing and treating diabetic cardiomyopathy

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of an LRRC8A gene inhibitor in preparation of a medicine for preventing and treating diabetic cardiomyopathy. The LRRC8A gene inhibitor is a preparation which is obtained by taking an LRRC8A gene as an action target and has an interference or knockout effect on the LRRC8A gene. The relationship between the myocardial cell membrane protein LRRC8A and the diabetic myocardial cell energy metabolism is disclosed for the first time through a tissue-specific gene knockout animal model in combination with various research means, and the result shows that the LRRC8A participates in abnormal glucose and lipid metabolism of myocardial tissues caused by diabetes, and myocardial specific knockout of the LRRC8A has the effect of inhibiting diabetes mellitus. Glucose and fatty acid metabolism of diabetic mice can be remarkably improved, and then the heart function is improved. The result is of great significance to development of drugs for treating diabetic cardiomyopathy.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to the use of an LRRC8A gene inhibitor in the preparation of a drug for preventing and treating diabetic cardiomyopathy. Background Art

[0002] Diabetic cardiomyopathy (DCM) refers to structural or functional abnormalities of the heart that occur in patients with diabetes, without coexisting cardiovascular disease. As a major complication of diabetes, DCM has a prevalence of 11.7%-67.0% in the diabetic population, while the 5-year incidence of heart failure in diabetic patients is as high as 8.4%-12.8%. Although insulin resistance, hyperglycemia, and free fatty acid overload are recognized as initiating factors of DCM, key gaps remain in the molecular regulatory mechanisms underlying imbalances in glucose and lipid metabolism, leading to a lack of DCM-specific therapeutic strategies targeting metabolic remodeling.

[0003] Volume-sensitive anion channels (VRACs) are important ion channels widely distributed across various cell types, participating in numerous physiological processes, including cell volume regulation, cell proliferation, apoptosis, and metabolism. In 2014, multiple studies reported that leucine-rich repeat-containing protein 8A (LRRC8A) is a core structural protein of VRAC. Recent studies have confirmed the crucial role of LRRC8A in various cardiovascular pathologies, including cardiac hypertrophy, hypertensive vascular remodeling, and myocardial fibrosis. Furthermore, recent studies have uncovered unique roles for LRRC8A in the metabolism of skeletal muscle cells, hepatocytes, pancreatic β cells, and adipocytes, suggesting that LRRC8A is not only a key regulator of various cardiovascular diseases but also a core hub for cardiac metabolic remodeling. However, its specific role and mechanisms in cardiomyocyte metabolism remain largely unexplained. In particular, the involvement of LRRC8A in abnormal cardiomyocyte glucose and lipid metabolism and myocardial damage in diabetic myocardial carcinoma (DCM) remains a systematic issue. Summary of the Invention

[0004] Based on the above research background and scientific issues, the present invention aims to further explore the mechanism of action of LRRC8A in diabetic cardiomyopathy, reveal its key role in the occurrence and development of diabetic cardiomyopathy, and provide new targets and theoretical basis for the precise diagnosis and treatment of diabetic cardiomyopathy.

[0005] The present invention adopts the following technical solutions: In a first aspect, the present invention provides the use of an LRRC8A gene inhibitor in the preparation of a drug for preventing and treating diabetic cardiomyopathy, wherein the LRRC8A gene inhibitor is a preparation that uses the LRRC8A gene as a target and has an interfering or knocking-out effect on the LRRC8A gene.

[0006] The present invention discovered for the first time that LRRC8A expression increases in myocardial tissue of diabetic cardiomyopathy and is involved in the myocardial glucose and fatty acid metabolism disorders caused by diabetes; myocardial-specific knockout of LRRC8A can significantly improve glucose and fatty acid metabolism and cardiac function in the myocardial tissue of diabetic mice.

[0007] The term "LRRC8A gene" used in the present invention may be of human origin or from other species (such as mouse). The sequence of the LRRC8A gene is well known to those skilled in the art and can be found in various public databases. The human LRRC8A gene sequence can be found in GeneID: 56262, and the mouse LRRC8A gene sequence can be found in GeneID: 241296.

[0008] As used herein, the term "preventing or treating" refers to methods performed to achieve a beneficial or desired clinical outcome. For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, reduction in the extent of the disease, stabilization (i.e., no longer worsening) of the disease state, delay or slowing of disease progression, improvement or alleviation of the disease state, and alleviation of symptoms (whether partial or complete).

[0009] In certain embodiments, the diabetic cardiomyopathy is type 2 diabetic cardiomyopathy.

[0010] In certain embodiments, the drug is a drug that improves cardiac function.

[0011] In certain embodiments, the improvement of cardiac function is to improve the contractile function of myocardial cells, reduce myocardial damage, inhibit myocardial cell apoptosis, and reduce the degree of myocardial cell fibrosis.

[0012] In certain embodiments, the drug is a drug that alleviates myocardial metabolic disorders.

[0013] In certain embodiments, the alleviating myocardial metabolic disorder is to promote the uptake of fatty acids by myocardial cells and inhibit the uptake of glucose by myocardial cells.

[0014] In certain embodiments, the active ingredient of the drug is a nucleic acid or vector for RNA interference with the LRRC8A gene, or a nucleic acid or vector for knocking out the LRRC8A gene.

[0015] In a second aspect, the present invention provides use of the detection reagent for the LRRC8A gene expression level in the preparation of a kit for diagnosing and / or prognosing diabetic cardiomyopathy.

[0016] In a third aspect, the present invention provides a drug for preventing and treating diabetic cardiomyopathy, which contains the LRRC8A gene inhibitor as an active ingredient.

[0017] In certain embodiments, the medicament further comprises a pharmaceutically acceptable excipient.

[0018] Beneficial effects: This study first discovered that the LRRC8A gene is an important regulatory factor in the development of diabetic cardiomyopathy. By inhibiting or knocking out the expression of the LRRC8A gene, glucose and fatty acid metabolism and cardiac function in the myocardial tissue of diabetic mice can be significantly improved. This has important clinical value for the prevention and treatment of diabetic cardiomyopathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Detection of cardiomyocyte survival rate under different glucose and fatty acid concentrations. A. Cardiomyocyte survival rate under stimulation of different glucose concentrations; B. Cardiomyocyte survival rate under stimulation of different palmitic acid concentrations.

[0020] Figure 2 : Primary cardiomyocytes and phalloidin staining, A. Primary cardiomyocytes; B. Phalloidin staining results of the control group and HPG group, respectively. DAPI blue fluorescence labels the cell nucleus, and red fluorescence labels the cytoskeleton; C. Cell area statistics of the normal control group and HPG stimulation group (***P<0.001).

[0021] Figure 3 : High glucose and high fat induce upregulation of LRRC8A mRNA and protein expression in HL-1 cardiomyocytes. A. RT-qPCR verified the changes in LRRC8A mRNA expression after four different interventions; B. Western blot detected the changes in LRRC8A protein expression after four different interventions (****P<0.0001).

[0022] Figure 4 : A type 2 diabetic cardiomyopathy model was successfully established in C57B / L mice induced by high-fat diet combined with STZ. A. Blood glucose levels of the two groups of mice after modeling; B. Echocardiograms of the two groups of mice; C-F. EF%, FS, e / a, and e / e' values of the hearts of the two groups of mice after modeling (n=6, ****P<0.0001).

[0023] Figure 5: LRRC8A expression is upregulated in the myocardial tissue of C57B / L diabetic cardiomyopathy mice. A. RT-qPCR was used to detect the mRNA expression level of LRRC8A in the myocardial tissue of the two groups of mice; B. Western blot was used to detect the protein expression level of LRRC8A in the myocardial tissue of the two groups of mice; C. Western blot bands (**P<0.01).

[0024] Figure 6 : Schematic diagram of the genomic location of the LoxP site of LRRC8A.

[0025] Figure 7 : Myh6-LRRC8A cKO mouse breeding procedure.

[0026] Figure 8 : Identification results of myocardial tissue-specific LRRC8A knockout mice. A. Identification results of myocardial tissue-specific LRRC8A knockout mice. From left to right: DNA marker, water control, wild-type control, and gene knockout mice 1-3; B. RT-qPCR comparison of LRRC8A mRNA expression levels in myocardial tissue of the two groups of mice (n=3, ****P<0.0001).

[0027] Figure 9 : Establishment of diabetic models in C57B / L and myocardial LRRC8A cKO mice. A, B Comparison of blood glucose levels in four groups of mice at the beginning and end of modeling, n=6; C, D GTT and ITT experiments in four groups of mice, n=4; E, F. Areas under the curves of GTT and ITT experiments (n=4-10, ****P<0.0001).

[0028] Figure 10 : Comparison of general conditions of the four groups of mice (I), A. Appearance of the four groups of mice; BC are the weights of the four groups of mice at the beginning and end of modeling, respectively; D. Weight change curves of the four groups of mice during modeling (n=6, ****P<0.0001, **P<0.01).

[0029] Figure 11 : Comparison of general conditions of the four groups of mice (II), A, B are the blood glucose change curves of the four groups of mice during the modeling process and the body composition detection of mice, lean is muscle, fat is fat, and fluid is body fluid, n=4; C. Comparison of heart weight index of the four groups of mice after the modeling (n=6, *P<0.05).

[0030] Figure 12 : Cardiac function of the two groups of mice at the beginning of modeling. A. Echocardiogram of the two groups of mice at the beginning of modeling; B. EF%, FS, e / a, and e / e' values of the two groups of mice at the beginning of modeling (n=6).

[0031] Figure 13 : Cardiac function of the four groups of mice after modeling. A. Echocardiogram of the four groups of mice after modeling; B. EF%, FS, e / a, and e / e' values of the four groups of mice after modeling (n=4-6, ****P<0.0001).

[0032] Figure 14 : H&E staining and Masson staining of cardiac tissue sections from four groups of mice. A. H&E staining (blue indicates cell nuclei) and Masson staining (blue indicates fibrous tissue). B. Statistics of Masson staining results (n=5, ****P<0.0001).

[0033] Figure 15 : Identification of lentivirus for knockdown of LRRC8A in cardiomyocytes. A and B are HL-1 cardiomyocyte cell lines infected with empty virus NC and siLRRC8A virus sequences, respectively; C and D are Western blotting detection of LRRC8A expression in the two groups of cells and statistical graphs (*P<0.05), respectively.

[0034] Figure 16 : Effects of LRRC8A knockdown on glucose uptake in cardiomyocytes. A, B show the glucose levels in cardiomyocytes and cell culture supernatant after different stimulations (****P<0.0001, ***P<0.001, **P<0.01).

[0035] Figure 17 Effects of LRRC8A knockdown on fatty acid uptake in cardiomyocytes. A and B show the fatty acid contents in cardiomyocytes and cell supernatants after different stimuli, respectively. C and D show the lipid deposition in HL-1 cardiomyocytes and primary mouse cardiomyocytes under different stimuli observed by Oil Red O staining, respectively. Red indicates lipid droplets (****P<0.0001, ***P<0.001).

[0036] Figure 18 : Glycogen\Oil Red O staining of myocardial tissues of four groups of mice. In PAS staining, blue represents cell nuclei and purple represents glycogen; blue represents cell nuclei and yellow arrows represent lipid droplets. DETAILED DESCRIPTION

[0037] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0038] Example 1: Diabetic myocardial injury is accompanied by upregulation of LRRC8A expression 1. Experimental methods 1.1 Construction of a diabetic cardiomyopathy mouse model using high-fat diet combined with STZ injection (1) High-fat fed mice 6-8 weeks old, SPF grade, C57B / L male mice were adaptively fed for 1 week, and then fed freely with a high-sugar and high-fat diet (20% sucrose, 10% lard, 2% cholesterol, 1% bile salt, and 67% ordinary diet). After 6 weeks, the mice were weighed. If the body weight was ≥ the mean body weight of the normal group + 2 times the standard deviation, they were considered to have diet-induced obesity and could proceed to the next step of modeling.

[0039] (2) Preparation of 0.1 mol / L citric acid-sodium citrate buffer Solution A: citric acid solution (2.1 g citric acid + 100 mL distilled water).

[0040] Solution B: sodium citrate solution (2.94 g sodium citrate + 100 mL distilled water).

[0041] Add 44 mL of solution B to 56 mL of solution A to obtain 100 mL of 0.1 mol / L citric acid-sodium citrate buffer (adjust pH to 4.5), and filter sterilize.

[0042] (3) Intraperitoneal injection of STZ solution to construct a diabetic cardiomyopathy model 1) Prepare a 10 mg / mL STZ solution: Dissolve 100 mg of STZ in 10 mL of 0.1 mol / L citric acid-sodium citrate buffer (pH 4.5). Prepare the STZ solution immediately before use. Protect from light and store on ice.

[0043] 2) Intraperitoneal injection of STZ in mice: Mice that had been fed a high-fat diet for 6 weeks were fasted for 12 hours. The mice were then captured using the dorsal restraint method the next morning. After being immobilized, the injection site was disinfected with a 75% alcohol cotton ball. The prepared STZ solution was injected intraperitoneally at doses of 50, 75, and 100 mg / kg, respectively. After three consecutive days of injection, blood glucose was tested and the mice were continued to be fed with the original high-fat diet.

[0044] (4) General observation The activity status, coat color, mental state, diet, bowel movements, and body weight of the experimental mice were observed every day.

[0045] (5) Mouse weight monitoring Calibrate the electronic scale and prepare data recording tools. Select a fixed time period for weight monitoring. When weighing, gently soothe the mouse to calm it, then place it on the electronic scale. Wait for the value to stabilize before recording the weight. Monitor the mouse's weight weekly during the modeling process.

[0046] (6) Blood glucose monitoring in mice Three to four days after STZ injection, disinfect the tail tip of the mouse with medical alcohol and puncture the tail tip with a blood collection needle to collect blood. Blood glucose was measured and recorded. A blood glucose level above 16.7 mmol / L was considered a successful diabetes model. After successful model establishment, continue a high-fat diet and monitor blood glucose weekly.

[0047] (7) Glucose tolerance test (GTT) and insulin tolerance test (ITT) experiments in mice 1) GTT: After fasting for 12 hours, fasting blood glucose was measured and recorded. A 20% glucose solution (0.1 mL / 10 g body weight) was intraperitoneally injected. Blood glucose was measured and recorded at 15, 30, 60, and 120 minutes.

[0048] 2) ITT: After fasting for 12 hours, fasting blood glucose was measured and recorded. Intraperitoneal injection of 0.2 IU / kg body weight of insulin was performed, and blood glucose was measured and recorded at 15, 30, 60, and 120 minutes.

[0049] 1.2 Small animal ultrasound monitoring of mouse cardiac function The mice were depilated from the chest area and anesthetized with 4-5% isoflurane inhalation, then fixed in the supine position. A small animal ultrasound system was used to monitor the cardiac function of the mice in M-mode ultrasound mode. Key cardiac function parameters were recorded, including ejection fraction (EF%), fraction shortening (FS), e / a ratio, and e / e' ratio. To ensure data accuracy, at least three consecutive cardiac cycles were observed for each mouse, and the average of these cycles was calculated. Throughout the experiment, the mice were kept in a stable anesthesia state to reduce errors caused by motion artifacts. At the same time, the position of the ultrasound probe was kept stable to obtain clear and consistent images.

[0050] 1.3 Construction of a mouse myocardial injury model using combined high-sugar and high-fat stimulation (1) Culture and passage of HL-1 cardiomyocytes 1) Preparation: Sterilize all experimental materials and equipment. Prepare complete culture medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. Prepare sterile PBS buffer and trypsin-EDTA solution for cell digestion.

[0051] 2) Cell Thawing: Remove the cryovial of HL-1 cells from liquid nitrogen and immediately place it in a 37°C water bath. Gently shake until the cell suspension is completely thawed. Transfer the thawed cell suspension to a centrifuge tube containing complete culture medium. Gently mix thoroughly, centrifuge at 1000 rpm for 5 minutes, and remove the supernatant. Finally, resuspend the cell pellet in fresh complete culture medium, transfer it to a culture flask, and continue culturing in a 37°C, 5% CO2 incubator.

[0052] 3) Cell Passaging: Observe cell growth under a microscope. Cells can be passaged when they reach a density approaching 90% confluency. Remove the old culture medium from the culture flask and gently wash the cells once with PBS buffer to remove residual culture medium and cell debris. Next, add 1 mL of trypsin-EDTA digestion solution, ensuring that it completely covers the cell layer. Return the culture to a 37°C, 5% CO2 incubator and digest for 3-5 minutes. When the cells begin to shrink and gradually become rounded, immediately add 1 mL of complete culture medium to terminate the digestion. Then, gently pipette the cells to completely detach them from the flask wall. Transfer the detached cell suspension to a centrifuge tube and centrifuge at 1000 rpm for 5 minutes. Discard the supernatant. Resuspend the cell pellet in fresh complete culture medium and aliquot into new culture flasks according to experimental needs. Add an appropriate amount of complete culture medium to the culture flask and continue culturing the cells in the incubator. Note: Maintain a sterile environment during the operation to avoid contamination; the digestion time should not be too long to avoid damaging the cells; the cell passage ratio is generally 1:3 to 1:6, which should be adjusted appropriately according to the cell growth status; regularly observe the cell growth status and replace the culture medium in time.

[0053] (2) Construction of diabetic cardiomyopathy cell model 1) Preparation of Palmitic Acid Solution: Weigh 0.014g of palmitic acid and 0.5g of bovine serum albumin (BSA) and add 5mL of PBS to each. Heat the PBS solution containing palmitic acid in a water bath and shake continuously until a uniform suspension forms. Next, add the BSA solution dropwise to the preheated palmitic acid suspension, shaking thoroughly to promote the binding of BSA and palmitic acid, until the solution becomes clear and transparent. While the solution is still warm, filter the resulting solution through a 0.22μm filter to obtain a high-fat stock solution.

[0054] 2) Preparation of high-glucose solution: Take 22.5 mL of 20% sterile glucose solution and add F12 medium to a total volume of 100 mL to prepare a high-glucose culture medium with a glucose concentration of 30 mM. Seal the container and store in a refrigerator at 4°C for immediate use in cell culture.

[0055] 3) Cell Model Construction: A diabetic cardiomyopathy cell model was constructed using high glucose and palmitate (HPG) stimulation. HL-1 cardiomyocytes were first cultured in a suitable culture medium until they reached an appropriate density. The cells were then exposed to high glucose and high lipid environments to simulate diabetic myocardial damage. After validation with CCK-8 assays, a combination of 25mM glucose and 250μM palmitate was selected to construct the diabetic cardiomyopathy cell model.

[0056] 4) CCK-8 Assay: HL-1 cardiomyocytes were seeded in 96-well plates, with 100 μL per well added. After 24 hours of culture, 5.5, 10, 20, 25, 30, 45, and 55 mM glucose and 0, 50, 100, 150, 200, 250, 300, 350, 400, 450, and 1000 μM palmitic acid were added (100 μL per well) and cultured for a further 48 hours. After 48 hours, the cell culture medium was discarded, the cells were washed with PBS, and 10 μL of CCK-8 solution was added to each well. The cells were then incubated in a 37°C incubator in the dark for 1-4 hours. Absorbance at 450 nm was measured using a microplate reader to calculate cell viability.

[0057] (3) Isolation of primary mouse cardiomyocytes (4) Western blot detection of target protein (5) Phalloidin staining of primary cardiomyocytes (6) Mouse heart tissue collection and protein extraction 1) Weigh the mouse and measure the tibia length.

[0058] 2) Use depilatory cream to remove the mouse chest skin.

[0059] 3) Anesthetize the mouse by intraperitoneal injection of 1% sodium pentobarbital according to the mouse's weight.

[0060] 4) Secure the mouse on the operating table with its chest facing upwards and open the chest cavity.

[0061] 5) Use forceps to bluntly separate the subcutaneous tissue, quickly remove the heart, wash it in pre-cooled PBS buffer, and absorb the water and blood with filter paper.

[0062] 6) Weigh the heart and take a photo.

[0063] 7) Place the heart tissue in a cryovial and store in a -80°C freezer.

[0064] 8) The protein extraction process is the same as before.

[0065] (7) Statistical analysis Experimental data are expressed as mean ± standard deviation. Component differences were compared using two-sample t-test or ANOVA analysis, with P < 0.05 considered statistically significant. Graphpad 20.0 software was used for data analysis.

[0066] 2. Results 2.1 Successful construction of a high-glucose and high-fat-induced diabetic cardiomyopathy cell model We conducted in vitro experiments to explore a cell model for diabetic cardiomyopathy. As shown in Figure 1, we used a high-glucose and high-fat medium to induce the HL-1 cardiomyocyte line, using HPG stimulation to simulate diabetic cardiomyopathy in vitro. Cardiomyocyte survival was assessed using a CCK-8 assay. Results showed that cardiomyocyte mortality significantly increased at 30 mM glucose and 300 μM palmitic acid. Therefore, we used a combination of 25 mM glucose and 250 μM palmitic acid to induce cardiomyocytes for 48 hours to simulate a model of myocardial injury in type 2 diabetes.

[0067] 2.2 Primary mouse cardiomyocytes were successfully isolated. Under the induction of high glucose and high fat, the volume of primary mouse cardiomyocytes increased significantly As shown in Figure 2, we successfully isolated and cultured primary mouse cardiomyocytes. After HPG stimulation for 48 hours, phalloidin immunofluorescence staining was performed to reveal the cytoskeleton and measure the cell area. The results showed that HPG stimulation significantly increased the area of cardiomyocytes compared with PBS, and the difference was statistically significant (P < 0.05, Figure 2 B, Figure 2 C).

[0068] 2.3 High glucose and high fat induce HL-1 cardiomyocytes, accompanied by upregulation of LRRC8A expression To verify whether the process of myocardial cell damage caused by diabetes is accompanied by changes in LRRC8A expression, we cultured HL-1 cardiomyocytes and divided them into groups: (1) normal control group (NG), (2) high glucose group (HG), (3) high fat group (HP), and (4) high glucose + high fat group (HPG). After 48 hours of treatment, RNA and protein were extracted from cells in different groups and verified by RT-qPCR and WB. The results are shown in Figure 3: LRRC8A mRNA was expressed in HG, HP, and HPG groups ( Figure 3 A) and protein ( Figure 3 The expression of LRRC8A was upregulated in the HPG group (P<0.05), with the upregulation being particularly significant in the HPG group (P<0.05). These results suggest that LRRC8A expression is significantly increased in HL-1 cardiomyocytes under high-glucose and high-fat culture conditions.

[0069] 2.4 Successful establishment of a high-fat diet combined with STZ-induced diabetic cardiomyopathy model in mice Male C57B / L mice aged 6-8 weeks were selected and, after one week of acclimatization, randomly divided into a negative control group and a high-fat diet group. After six weeks of high-fat diet, the high-fat diet group received intraperitoneal injections of STZ and monitored blood glucose. A successful type 2 diabetes model was established when blood glucose levels exceeded 16.7 mmol / L on two consecutive occasions. As shown in Figure 4A, blood glucose levels in the model group (WD group) were significantly elevated compared to the negative control group (WT group) (P < 0.05). After the WD group continued the high-fat diet for another 6-8 weeks, cardiac function was assessed by echocardiography. Abnormal cardiac function indicated successful modeling.

[0070] Echocardiography results showed that the EF% and FS of diabetic group (WD group) mice were significantly lower than those of WT group mice ( Figure 4 B, Figure 4C, Figure 4 D), indicating that diabetic mice had impaired cardiac contractile function at the end of the experiment (P<0.05). The e / a and e / e' ratios of diabetic mice were not significantly different from those of the control group ( Figure 4 B, Figure 4 E, Figure 4 F), indicating that the cardiac dysfunction in diabetic mice was mainly systolic dysfunction.

[0071] 2.5 In the myocardial tissue of diabetic cardiomyopathy mice, LRRC8A expression is upregulated To clarify the expression of LRRC8A in diabetic myocardial tissue, we took heart samples from mice with successful modeling, extracted RNA and protein, and then used RT-qPCR and WB to detect the expression level of LRRC8A in myocardial tissue. The results showed that the mRNA expression of LRRC8A in diabetic myocardial tissue was ( Figure 5 A) and protein levels ( Figure 5 B, Figure 5 C) increased significantly (P<0.05).

[0072] Example 2: Myocardial tissue-specific LRRC8A knockout significantly improves cardiac function in diabetic mice 1. Experimental methods 1.1 Construction and characterization of myocardial tissue-specific LRRC8A knockout mice (1) Construction of myocardial tissue-specific LRRC8A knockout mice Construction of a gene conditional knockout LRRC8A-floxp using CRISPR / Cas9 technology + / + Mouse, LRRC8A floxp was inserted into the LRRC8A gene exon3 on both sides of the LoxP site + / + The mouse was constructed by Guangzhou Saiye Biotechnology Co., Ltd. + / + The mice were crossed with myocardium-specific Myh6-cre+ mice (purchased from Cytokine), and after two generations of breeding, LRRC8A floxp + / + / Myh6-cre + Myh6-LRRC8A cKO mice were generated to generate cardiac tissue-specific knockout mice. Schematic diagram of the genomic location of the LRRC8A LoxP site and breeding procedures. Figure 6 and Figure 7 shown.

[0073] (2) Identification of myocardial tissue-specific LRRC8A knockout mice The following primers were used for identification: Myh6-Cre-F (SEQ ID NO. 1): 5′-GAAATGACAGACAGATCCCTCCTATC-3′.

[0074] Myh6-Cre-R (SEQ ID NO. 2): 5′-RCGACGATGAAGCATGTTTAGCTG-3′.

[0075] Floxp-F (SEQ ID NO. 3): 5′-CTCCCTATTTGTCCTCTGTGGGC-3′.

[0076] Floxp-R (SEQ ID NO. 4): 5′-ACAAGAAGCAGTGAGGAAGACCAAG-3′.

[0077] 1.2 Construction of a diabetic cardiomyopathy mouse model (1) Modeling method and experimental grouping The modeling method was the same as in Example 1, and the experimental groups were shown in Table 1.

[0078] Table 1 Experimental group information (2) Mouse weight monitoring The method is the same as Example 1.

[0079] (3) Blood glucose monitoring in mice The method is the same as Example 1.

[0080] (4) Mouse GTT and ITT experiments The method is the same as Example 1.

[0081] (5) Small animal ultrasound monitoring of mouse cardiac function The method is the same as Example 1.

[0082] 1.3 Mouse myocardial tissue sampling and testing (1) Heart Weight Index (HWI) Measurement At the end of the experiment, the mice were fasted for 12 hours and anesthetized with isoflurane inhalation, then fixed in the supine position. Blood was collected from the abdominal aorta. After perfusion with normal saline, the mice were quickly killed and the hearts were removed. After repeated flushing with pre-cooled saline, the capsule and blood vessels were cut off, and the mass was weighed using an electronic balance, and the heart weight index (mg / g) = (heart mass / body mass) was calculated.

[0083] (2) Myocardial tissue morphology observation Myocardial sections were cut perpendicularly to the midpoint of the left ventricular long axis. The left ventricular myocardial tissue was fixed with 10% neutral formaldehyde, dehydrated as per standard procedures, embedded in paraffin, and sectioned. ① HE staining: After dewaxing and dehydrating, the sections were stained in hematoxylin solution for 5 to 10 minutes. The sections were then rinsed with tap water to remove excess dye. The sections were then differentiated and blued, then stained in eosin solution for 1 to 5 minutes. After dehydration and mounting, the sections were ready for observation. ② Masson staining: After dehydration and clearing, the sections were stained in hematoxylin solution for approximately 5-10 minutes. The sections were then rinsed with clean water and differentiated. After rinsing, the sections were blued for a few seconds. The sections were then dehydrated and cleared in ethanol and xylene, then mounted and ready for observation. ③ Oil Red O staining: Place the slices in Oil Red O staining solution and stain for 3-5 minutes. Gently rinse the sample with distilled water to remove excess dye, then counterstain the cell nucleus with hematoxylin for 1-2 minutes. After rinsing the sample with distilled water, use glycerol gelatin to seal the slides, observe, and take photos.

[0084] (3) Myocardial tissue protein and RNA extraction The method is the same as Example 1.

[0085] (4) Statistical analysis The method is the same as Example 1.

[0086] 2. Results 2.1 Successful construction of myocardial tissue-specific LRRC8A knockout mice For Floxp mice, the target band appears at 298 bp for wild mice and 374 bp for LRRC8Afloxp + / + Mouse, 298bp and 374bp appeared at the same time as LRRC8Afloxp + / - For Cre mice, the presence of a 533bp target band indicates Cre positive, and the absence of a band indicates Cre negative. Figure 8 As shown in Figure A, the agarose gel electrophoresis results showed that no obvious bands appeared in the water control group, indicating that there was no nonspecific binding between the primers; a band appeared at 298 bp, indicating that it was a wild-type mouse, namely the WT group; a band appeared at 374 bp in mice No. 1-12, indicating that the obtained mice were floxp homozygous mice, namely LRRC8Afloxp+ / + mice, and the electrophoresis results of mice No. 1-13 also showed a target band of 533 bp, indicating that the obtained mice were Cre+ mice, that is, the mice had floxp sites at both ends of the LRRC8A gene and were Cre gene positive, indicating that this genotype of mice was a myocardial tissue-specific LRRC8A knockout mouse.

[0087] RNA was extracted from the myocardial tissue of positive mice and RT-qPCR experiments were performed. The results showed that compared with WT mice, LRRC8Afloxp + / + Cre + The LRRC8A mRNA level in the myocardial tissue of mice was significantly decreased (P<0.05). The above results further indicate that the mice are myocardial tissue-specific LRRC8A knockout mice ( Figure 8 B).

[0088] 1.2 Construction of C57B / L and myocardial LRRC8A knockout mouse diabetic models Male C57B / L mice aged 6-8 weeks and KO mice of the same age were obtained through breeding and identification. After one week of adaptive feeding, the mice were divided into the WT group (wild group), WD group (wild diabetes group), KO group (knockout group), and KD group (knockout diabetes group) and modeled. The blood glucose levels of the mice were compared at the beginning of the intervention and at the completion of the modeling. The results are shown in Figure 2. Figure 9 A and Figure 9 As shown in B, there was no significant difference in the initial blood glucose levels of the four groups of mice. After the model was established, the blood glucose levels of the WD and KD groups increased significantly (P<0.05). The blood glucose fluctuation curve results showed that compared with the WT and KO groups, the blood glucose levels of the WD and KD groups increased significantly after intraperitoneal injection of STZ (P<0.05). The GTT results showed that compared with the WT and KO groups, the blood glucose levels of the WD and KD groups were higher at various time points after intraperitoneal injection of glucose, and the area under the curve also increased significantly (P<0.05). The ITT results showed that after intraperitoneal injection of insulin, the blood glucose values of the WD and KD groups were significantly higher than those of the WT and KO groups at various time points, and the area under the curve increased significantly (P<0.05). The above results confirmed that a 6-week high-fat diet can induce insulin resistance in mice, and the type 2 diabetes mouse model was successfully established ( Figure 9 C, Figure 9 D, Figure 9 E, Figure 9 F).

[0089] 2.3 Comparison of general conditions of the four groups of mice The weight of mice in different groups was measured at the beginning of modeling and after successful modeling. The results showed that at the beginning of modeling, the weight of mice in the KO and KD groups was smaller than that in the WT and WD groups (P<0.05). After successful modeling, the weight of the WD group was significantly lower than that in the WT group (P<0.05). The weight of the KO and KD groups was significantly lower than that in the WT and WD groups, respectively (P<0.05). Figure 10 The weight change curve shows that Figure 10As shown in Figure D, after the successful establishment of the diabetes model, the body weight of mice in the WD group began to decrease significantly, and the body weight of mice in the KO group and KD group was significantly lower than that of the WT and WD groups at each time point. Figure 11 Figure A shows the dynamic changes in blood glucose levels during the modeling process. Using a small animal component analyzer, we examined the body composition of the four groups of mice. The results showed no significant differences in muscle and fluid content among the four groups, while the body fat percentage of the WD group increased significantly (P<0.05). Figure 11 As shown in B. After the mice were collected, their hearts were weighed and the heart weight index was calculated. The results showed that there was no significant difference in the heart weight index among the four groups of mice ( Figure 11 C).

[0090] 2.4 Cardiac function monitoring of four groups of mice At the beginning and end of the modeling, the cardiac function changes of each group were detected by echocardiography. The results showed that at the beginning of the modeling, there was no significant difference in EF%, FS, e / a, and e / e' between the two groups of mice ( Figure 12 After modeling, the EF% and FS values of the WD group mice were significantly lower than those of the WT group mice (P<0.05), indicating that the diabetic mice had significant cardiac systolic function impairment, while the EF% and FS values of the KO and KD groups were significantly better than those of the WD group (P<0.05). There was no significant difference in the e / a and e / e' ratios among the four groups, suggesting that LRRC8A can significantly improve the cardiac systolic function of diabetic mice ( Figure 13 ).

[0091] H&E staining and Masson staining of mouse heart paraffin sections showed that compared with the WT group, the myocardial cell structure in the WD group was disordered and myocardial fibrosis was aggravated, while the myocardial structure disorder and fibrosis in the KO and KD groups were milder ( Figure 14 These results suggest that diabetic mice exhibit myocardial structural changes, and knockout of LRRC8A can significantly alleviate myocardial structural disorders in diabetic mice.

[0092] Example 3: LRRC8A is involved in the process of myocardial glucose and lipid metabolism disorders in diabetes 1. Experimental methods 1.1 Construction and characterization of myocardial tissue-specific LRRC8A knockout mice Same as Example 1.

[0093] 1.2 Construction of diabetic cardiomyopathy mouse model Same as Example 1.

[0094] 1.3 Myocardial tissue metabolomics detection In this experiment, liquid chromatography-mass spectrometry (LC / MS) and gas chromatography-mass spectrometry (GC / MS) techniques were used to perform metabolomics analysis on myocardial tissue.

[0095] (1) Collection of materials The mice were quickly killed, and the myocardial tissue was removed, trimmed, and then frozen in a liquid nitrogen tank to prevent metabolite degradation.

[0096] (2) Reagents and instruments Prepare the reagents required for LC / MS and GC / MS, such as extraction solvents, internal standards, etc. Also, ensure that the liquid chromatography-mass spectrometry and gas chromatography-mass spectrometry instruments are in good working condition.

[0097] (3) Sample processing 1) Metabolite extraction: Thaw the myocardial tissue sample, add an appropriate amount of extraction solvent, and extract metabolites using homogenization, ultrasound, or oscillation.

[0098] 2) Centrifugation and filtration: The extract is centrifuged to remove insoluble impurities, and then filtered to obtain a clear metabolite extract.

[0099] 3) Derivatization (for GC / MS): Since most metabolites in myocardial tissue are non-volatile substances, the extract needs to be derivatized before GC / MS analysis to increase the volatility and detection sensitivity of the metabolites.

[0100] (4) LC / MS analysis The treated metabolite extract is injected into a liquid chromatography-mass spectrometer for separation and detection. The metabolites are qualitatively and quantitatively analyzed based on their chromatographic retention times and mass spectrometric characteristic ions.

[0101] (5) GC / MS analysis The derivatized metabolite extract is injected into a gas chromatography-mass spectrometer for separation and detection. Qualitative analysis of metabolites is performed using standard mass spectral libraries such as those from NIST, while quantitative analysis is performed based on peak area.

[0102] (6) Data analysis 1) Metabolite identification: By comparing with the standard mass spectrometry library or nuclear magnetic resonance database, the detected metabolites are qualitatively analyzed to determine their chemical structure and molecular formula.

[0103] 2) Statistical analysis: Use multivariate statistical analysis methods, such as principal component analysis (PCA), partial least squares regression (PLS), and cluster analysis, to perform pattern recognition and differential analysis on the metabolome data to identify significantly different metabolites between different groups.

[0104] 3) Metabolic pathway analysis: The identified differential metabolites are compared with known biological metabolic pathways to clarify their specific location in the metabolic network and their biological functions, thereby revealing the underlying biological mechanisms and pathological processes.

[0105] 1.4 Construction of LRRC8A knockdown cell model and cell experiment grouping (1) Adenovirus infection of primary mouse cardiomyocytes Primary mouse cardiomyocytes were isolated and cultured in a serum-free medium for 12 hours as a preconditioning step. Subsequently, adenovirus was added to serum-free medium, with 2-6 μl of adenovirus added to each well of a 6-well plate. The cells were mixed thoroughly and incubated in an incubator for 6-8 hours to ensure adequate viral transfection. Following successful transfection, the cells were divided into four groups: normal (NC), high-glucose and high-fat (HPG), shLRRC8A, and shLRRC8A+HPG.

[0106] shLRRC8A sense strand (SEQ ID NO. 5): GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC.

[0107] shLRRC8A antisense strand (SEQ ID NO. 6): AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG.

[0108] (2) Lentiviral infection of HL-1 cardiomyocyte cell line HL-1 cardiomyocytes were seeded into 24-well plates and cultured for 24 hours. Lentivirus was diluted in normal culture medium at three concentrations: 1:10, 1:100, and 1:1000 in a biosafety cabinet. Polybrane was added at 1 / 1000, mixed, and then added to the cells. After 24 hours of culture, the virus-containing medium was discarded, the cells were washed with PBS, and fresh culture medium was replaced for another 48 hours. Successful transfection was confirmed by the appearance of green fluorescence under fluorescence. Selection was then performed by adding puromycin at a dilution of 1:3000 for 12 hours each, for three consecutive cycles. After successful transfection, the cells were divided into four groups: control (NG), high-glucose and high-fat (HPG) group, siLRRC8A group, and siLRRC8A + HPG group.

[0109] siLRRC8A (SEQ ID NO. 7): 5′-GCTGATGATTGCTGTCTTTGG-3′.

[0110] 1.5 Determination of glucose content in myocardial cells and culture medium (1) Determination of glucose content in myocardial cells 1) Cell collection: Cells were seeded in 6-well plates according to the pre-grouping and treated accordingly. The cell culture medium was discarded and the cells were washed twice with PBS. The cells were gently scraped off with a cell scraper and collected in a centrifuge tube. The tubes were centrifuged at 1000 r / min for 10 minutes, the supernatant was discarded, and the cell pellet was retained. The cell pellet was washed twice with isotonic buffer and finally centrifuged at 1000 r / min for 10 minutes. The supernatant was discarded and the cell pellet was retained.

[0111] 2) Cell disruption: Add 0.2-0.3 mL of homogenate medium to the cell pellet, and then perform ultrasonic disruption in an ice-water bath (power 300w, each ultrasonic treatment for 3-5 seconds, 30 seconds interval, repeat 3-5 times). The prepared homogenate can be used for subsequent determination and analysis.

[0112] 3) Absorbance determination: Take a 96-well plate and add distilled water, standard, and sample according to the kit instructions. Then add 250 μL of working solution to each well. Gently shake the plate and incubate at 37°C for 10 minutes. Measure the absorbance of each well at a wavelength of 505 nm using a microplate reader.

[0113] 4) Calculation of glucose content: Calculate the intracellular glucose content according to the formula: Glucose content (mmol / g protein) = [(A 测定 -A 空白 ) / (A 标准 -A 空白 )]×C 标准 ÷Cpr, C 标准 : Standard concentration, 5.55mmol / L.

[0114] (2) Determination of glucose content in supernatant 1) Sample collection: aspirate the cell culture medium of different treatment groups, centrifuge at 1000 r / min for 10 minutes, and take the supernatant for measurement.

[0115] 2) Absorbance determination: the method is the same as before.

[0116] 3) Calculation of glucose content: the method is the same as before.

[0117] 1.6 Determination of fatty acid content in myocardial cells and culture medium (1) Determination of fatty acid content in myocardial cells 1) Cell collection: The method is the same as the glucose content detection procedure.

[0118] 2) Cell disruption: The method is the same as the glucose content detection process.

[0119] 3) Absorbance Determination: According to the kit instructions, add double-distilled water, standard, sample, and detection reagents 1 and 2, mix well, incubate at 37°C for 5 min, place in an automatic microplate reader, and read the absorbance at a wavelength of 546 nm.

[0120] 4) Calculation of fatty acid content: Calculate the intracellular fatty acid content according to the formula: Fatty acid content (mmol / g protein) = ([ΔA 测定 -ΔA 空白 )( / ΔA 标准 -ΔA 空白 )]×C 标准 ÷Cpr, Cstandard: standard concentration, 1mmol / L.

[0121] (2) Determination of fatty acid content in supernatant 1) Sample collection: aspirate the cell culture medium of different treatment groups, centrifuge at 1000 r / min for 10 minutes, and take the supernatant for measurement.

[0122] 2) Cell disruption: The method is the same as before.

[0123] 3) Absorbance determination: the method is the same as before.

[0124] 4) Calculation of fatty acid content: the method is the same as before.

[0125] 1.7 Statistical analysis The method is the same as Example 1.

[0126] 2. Results 2.1 Alterations in cardiomyocyte glucose and lipid metabolism after LRRC8A knockdown at the cellular level (1) Identification of LRRC8A knockdown lentivirus in cardiomyocytes To further verify the effect of LRRC8A on glucose and lipid metabolism in cardiomyocytes, we first constructed LRRC8A knockdown lentivirus. After lentiviral transfection and screening ( Figure 15 A's, Figure 15 B) The knockdown effect of LRRC8A was detected by WB experiment. The results showed that the LRRC8A protein level in cardiomyocytes of the siLRRC8A group was significantly decreased compared with the control group (P<0.05) ( Figure 15 C, Figure 15 D).

[0127] (2) Changes in glucose metabolism in cardiomyocytes after knockdown of LRRC8A at the cellular level In the HPG-induced cardiomyocyte injury model, the glucose content in the cardiomyocytes and cell culture supernatant of different groups was detected. The results showed that after HPG stimulation, the glucose content in the cell culture supernatant increased and the intracellular glucose content increased (P<0.05). After silencing LRRC8A, the glucose content in the supernatant decreased (P<0.05) and the intracellular glucose content increased significantly (P<0.05), indicating that silencing the expression of LRRC8A in cardiomyocytes can significantly promote the uptake of glucose by cardiomyocytes. Figure 16 shown.

[0128] (3) Changes in fatty acid metabolism in cardiomyocytes after knockdown of LRRC8A at the cellular level In the HPG-induced cardiomyocyte injury model, the fatty acid content in the cardiomyocytes and cell culture supernatant of different groups was detected. The results showed that after high sugar and high fat stimulation, the fatty acid content in the cell culture supernatant increased (P<0.05) and the fatty acid content in the cells increased (P<0.05). After silencing LRRC8A, the fatty acid content in the supernatant increased and the fatty acid content in the cells decreased significantly. Therefore, we speculate that LRRC8A may promote the uptake of fatty acids by cardiomyocytes. Figure 17 A, Figure 17 As shown in B.

[0129] We further used Oil Red O staining to stain the HL-1 cardiomyocytes in different treatment groups. The results showed that compared with the NG group, red lipid droplets were deposited in the HPG group (e.g. Figure 17 C). After silencing LRRC8A expression and then stimulating with high glucose and high fat, we observed a significant decrease in intracellular red lipid droplets. We also performed Oil Red O staining using primary mouse cardiomyocytes. The results are shown in Figure 2. Figure 17 As shown in D, after silencing LRRC8A expression, the fatty acid content in cardiomyocytes was significantly reduced.

[0130] 2.2 Changes in myocardial lipid metabolism after myocardial tissue-specific LRRC8A knockout Glycogen staining was performed on myocardial tissue sections of the four groups of mice. The results showed that clear purple granular glycogen deposits were visible in the myocardial cells. The cell nuclei were counterstained blue with hematoxylin, with intact morphology and clear nuclear membranes. In the KO and KD groups, significantly reduced glycogen deposits were seen on the myocardial cell membranes. Figure 18 The myocardial tissue sections of the four groups of mice were stained with Oil Red O. The results are shown in Figure 18 As shown, free fatty acids (red lipid droplets) appeared in the cardiomyocytes of the WD group, the intracellular fatty acids in the KO group were significantly more than those in the WT group, and the intracellular fatty acids in the KD group were significantly less than those in the WD group.

[0131] In summary, we verified that LRRC8A is involved in the process of myocardial glucose and lipid metabolism disorders in diabetic cardiomyopathy, and LRRC8A may serve as a new target for the treatment of diabetic cardiomyopathy.

[0132] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

Claims

1. Use of an LRRC8A gene inhibitor in the preparation of a drug for preventing and treating diabetic cardiomyopathy, characterized in that: The LRRC8A gene inhibitor is a preparation obtained by taking the LRRC8A gene as a target and having an interference or knockout effect on the LRRC8A gene.

2. Use of the LRRC8A gene inhibitor according to claim 1 in the preparation of a drug for preventing and treating diabetic cardiomyopathy, characterized in that: The diabetic cardiomyopathy is type 2 diabetic cardiomyopathy.

3. Use of the LRRC8A gene inhibitor according to claim 1 in the preparation of a drug for preventing and treating diabetic cardiomyopathy, characterized in that: The medicine is a medicine for improving cardiac function.

4. Use of the LRRC8A gene inhibitor according to claim 3 in the preparation of a drug for preventing and treating diabetic cardiomyopathy, characterized in that: The improvement of cardiac function is to improve the contractile function of myocardial cells, reduce myocardial damage, inhibit myocardial cell apoptosis, and reduce the degree of myocardial cell fibrosis.

5. Use of the LRRC8A gene inhibitor according to claim 1 in the preparation of a drug for preventing and treating diabetic cardiomyopathy, characterized in that: The medicine is a medicine for alleviating myocardial metabolic disorder.

6. Use of the LRRC8A gene inhibitor according to claim 5 in the preparation of a drug for preventing and treating diabetic cardiomyopathy, characterized in that: The relief of myocardial metabolic disorder is to promote the uptake of fatty acids by myocardial cells and inhibit the uptake of glucose by myocardial cells.

7. Use of the LRRC8A gene inhibitor according to claim 1 in the preparation of a drug for preventing and treating diabetic cardiomyopathy, characterized in that: The active ingredients of the drug are nucleic acids and vectors for RNA interference with the LRRC8A gene, or nucleic acids and vectors for knocking out the LRRC8A gene.

8. Use of the LRRC8A gene expression detection reagent of claim 1 in the preparation of a kit for diagnosing and / or prognosing diabetic cardiomyopathy.

9. A drug for preventing and treating diabetic cardiomyopathy, characterized in that: The LRRC8A gene inhibitor according to claim 1 is used as an active ingredient.

10. The drug for preventing and treating diabetic cardiomyopathy according to claim 9, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images