Human anti-human PLA2R antibody standard substance and application thereof

Abstract

The invention discloses a human anti-human PLA2R antibody or an antigen binding fragment of the human anti-human PLA2R antibody. The antibody or the antigen binding fragment thereof comprises a CDR sequence selected from at least one of the following sequences or an amino acid sequence having at least 80% identity with the CDR sequence, the CDR sequence of a heavy chain variable region is selected from SEQ ID NO: 3, 5-35, 38, 40-70, 73 and 75-105, and the CDR sequence of a light chain variable region is selected from SEQ ID NO: 108, 110-140, 143, 145-175, 178 and 180-210. The antibody or the antigen binding fragment thereof has high affinity with PLA2R protein, and can be used as an anti-human PLA2R antibody standard substance. The antibody or the antigen binding fragment thereof can be obtained by adopting cell recombination expression, has the advantages of stability, mass production and the like, and can eliminate the possibility that the antibody or the antigen binding fragment thereof is polluted by pathogenic microorganisms in the preparation process, so that the purity and the stability of an anti-human PLA2R antibody standard product can be ensured.

Description

[0001] Case division information

[0002] This application is a divisional application of the patent application filed with the State Intellectual Property Office of China on July 6, 2023, with patent application number 202310829544.8 and patent name "Human Anti-Human PLA2R Antibody Standards and Their Applications". Technical Field

[0003] The present invention belongs to the field of bioengineering. Specifically, the present invention relates to a human anti-human PLA2R antibody standard and its application. More specifically, the present invention relates to an anti-human PLA2R antibody or its antigen-binding fragment, nucleic acid molecule, expression vector, recombinant cell, kit and its application. Background Art

[0004] Primary membranous nephropathy (PMN) is a major cause of renal failure and the leading cause of nephrotic syndrome. While no more than 30% of cases of PMN may resolve spontaneously, another 30% of patients experience a slow progression to renal failure over approximately 10 years, posing a serious threat to life and health. Recent research has confirmed that PMN is an autoimmune disease. Under disease conditions, the body's autoimmune antigens activate the immune system, producing autoimmune antibodies. These autoimmune antibodies bind to autoimmune antigens on glomerular podocytes, triggering an immune attack on the podocytes and surrounding tissues, causing inflammation and glomerular damage.

[0005] The most well-characterized autoimmune antigens in primary MN are PLA2R and THSD7A. Approximately 70%-80% of primary MN cases are PLA2R-type, while less than 10% are THSD7A-type.

[0006] PLA2R antibodies (PLA2R-Ab) play a key role in the development and progression of PLA2R-type MN. Serum PLA2R-Ab levels can serve as a predictive marker for PLA2R-type MN. Higher PLA2R-Ab titers indicate a lower chance of spontaneous remission. Decreased PLA2R-Ab titers often accompany spontaneous remission and can become undetectable in patients with complete remission. Immunosuppressive therapy can reduce PLA2R-Ab titers.

[0007] PLA2R antibody concentrations can be measured qualitatively or quantitatively using diagnostic kits. PLA2R antibody diagnostic kits typically use immunological assays such as ELISA to detect the signal produced by the antibody in the sample and compare it with the signal produced by an antibody standard to obtain a relative concentration. Current PLA2R antibody diagnostic kits use diluted human serum as the standard. Using diluted human serum as a standard has several significant drawbacks. First, human serum standards are relative concentrations compared to the antibody in standard human serum. Therefore, absolute quantification of the chemical concentration of the antibody in plasma cannot be achieved; only relative units (RU) are obtained. This has limited value for clinical research and treatment, as well as for drug and treatment development. Second, although human serum standards are tested for several viruses, such as HIV and HCV, contamination with other viruses and pathogenic microorganisms cannot be ruled out, posing a risk of pathogen contamination. Finally, standards prepared from human serum are limited and have a narrow and limited source, resulting in high production costs. Furthermore, antibodies produced by different patients vary, making batch variability a common problem.

[0008] Therefore, there is an urgent need to provide a PLA2R antibody standard that is simple to prepare and less prone to batch differences. Summary of the Invention

[0009] The present invention aims to, at least to some extent, address at least one of the technical problems existing in the prior art. To this end, the present invention provides an anti-human PLA2R antibody or antigen-binding fragment thereof. This antibody or antigen-binding fragment has high affinity for the PLA2R protein, is simple to prepare, and is less susceptible to batch variability, and can be used as an anti-human PLA2R antibody standard.

[0010] The present invention is accomplished based on the following findings of the inventors:

[0011] PLA2R is a membrane protein highly expressed on the surface of glomerular podocytes, including Figure 1 The structural domains shown. Antibodies in patient plasma primarily recognize the CysR, FNII, and CTLD1 domains of the PLA2R. Therefore, the inventors designed and recombinantly expressed these three domains, using them as antigens. Human antibodies targeting these three domains were screened using a humanized recombinant phage library. These antibodies were used as anti-human PLA2R antibody standards. Calibration was performed using a commercially available diagnostic kit to obtain a concentration conversion relationship between the anti-human PLA2R antibody standard and the antibody in human serum. Furthermore, the antibody can be recombinantly expressed in mammalian cells, enabling stable, large-scale production. This improves the yield and quality of the standard antibody, reduces production costs, and eliminates the possibility of pathogenic microbial contamination.

[0012] In one aspect, the present invention provides an antibody or antigen-binding fragment thereof. According to an embodiment of the present invention, the antibody or antigen-binding fragment thereof comprises: a CDR sequence selected from at least one of the following: heavy chain variable region CDR sequences: SEQ ID NOs: 1-105; light chain variable region CDR sequences: SEQ ID NOs: 106-210, or an amino acid sequence with at least 80% identity thereto: heavy chain variable region CDR sequences: SEQ ID NOs: 106-210. This antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein and can be used as an anti-human PLA2R antibody standard. This antibody or antigen-binding fragment thereof can be produced through recombinant cell expression, offering advantages such as stability and mass production. It also eliminates the possibility of contamination by pathogenic microorganisms during the production process, preventing batch variability and thereby ensuring the purity and stability of the anti-human PLA2R antibody standard.

[0013] In another aspect, the present invention provides a nucleic acid molecule. According to an embodiment of the present invention, the nucleic acid molecule encodes the aforementioned antibody or antigen-binding fragment thereof. The nucleic acid molecule of the present invention can effectively express the aforementioned antibody or antigen-binding fragment thereof.

[0014] In another aspect, the present invention provides an expression vector. According to an embodiment of the present invention, the expression vector carries the aforementioned nucleic acid molecule. The expression vector of the present invention can effectively express the aforementioned antibody or antigen-binding fragment thereof.

[0015] In yet another aspect, the present invention provides a recombinant cell. According to embodiments of the present invention, the recombinant cell: carries the aforementioned nucleic acid molecule; or expresses the aforementioned antibody or antigen-binding fragment thereof. The recombinant cells of the embodiments of the present invention can be used for in vitro expression and large-scale production of the aforementioned antibody or antigen-binding fragment thereof.

[0016] In yet another aspect, the present invention provides the use of the aforementioned antibody or antigen-binding fragment thereof, nucleic acid molecule, expression vector, or recombinant cell in the preparation of a PLA2R antibody standard. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein and can be recombinantly expressed in mammalian cells, offering advantages such as stability and mass production, thereby eliminating the possibility of contamination by pathogenic microorganisms during the preparation process. Therefore, the aforementioned antibody or antigen-binding fragment thereof can be used as an anti-human PLA2R antibody standard to improve the accuracy of PLA2R antibody detection.

[0017] In another aspect, the present invention provides a kit. According to an embodiment of the present invention, the kit comprises: the aforementioned antibody or antigen-binding fragment thereof; the aforementioned nucleic acid molecule; the aforementioned expression vector; or the aforementioned recombinant cell. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein, can be stably and mass-produced, and can eliminate contamination by pathogenic microorganisms. It can be used as an anti-human PLA2R antibody standard. Therefore, a kit containing the aforementioned antibody or antigen-binding fragment thereof has the advantage of high accuracy in detecting PLA2R antibodies.

[0018] In yet another aspect, the present invention provides the use of the aforementioned antibody or antigen-binding fragment thereof, nucleic acid molecule, expression vector, or recombinant cell in preparing a kit for detecting PLA2R antibodies or diagnosing PLA2R antibody-positive membranous nephropathy. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein, can be stably and mass-produced, and can eliminate contamination by pathogenic microorganisms. It can be used as an anti-human PLA2R antibody standard. Therefore, a kit containing the aforementioned antibody or antigen-binding fragment thereof has advantages such as high accuracy in detecting PLA2R antibodies.

[0019] In another aspect, the present invention provides a method for detecting PLA2R antibodies. According to an embodiment of the present invention, the method comprises: based on the PLA2R antibody detection results, using the aforementioned antibody or antigen-binding fragment thereof as a PLA2R antibody standard to determine the PLA2R antibody content in the test sample. This improves the accuracy of PLA2R antibody detection. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein, can be stably and mass-produced, and can eliminate contamination by pathogenic microorganisms. Therefore, it can be used as an anti-human PLA2R antibody standard. Therefore, the method of the present invention has the advantages of high accuracy in detecting PLA2R antibodies.

[0020] In another aspect, the present invention provides a method for diagnosing PLA2R antibody-positive membranous nephropathy. According to an embodiment of the present invention, the method comprises: based on the PLA2R antibody detection results of a test sample, using the aforementioned antibody or antigen-binding fragment thereof as a PLA2R antibody standard to determine the PLA2R antibody content in the test sample; and based on the PLA2R antibody content, determining whether the patient corresponding to the test sample suffers from PLA2R antibody-positive membranous nephropathy. This improves the accuracy of PLA2R antibody detection. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein, can be stably and mass-produced, and can eliminate pathogenic microbial contamination. It can be used as an anti-human PLA2R antibody standard to accurately detect the PLA2R antibody content. Therefore, the method of the present invention has a high diagnostic accuracy for PLA2R antibody-positive membranous nephropathy.

[0021] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention.

[0022] The amino acid sequence table of the present invention is as follows:

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033] The nucleotide sequence table of the present invention is as follows:

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047] BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0049] Figure 1 Schematic diagram of the structure of PLA2R in the present invention.

[0050] Figure 2 Schematic diagram of the structure of the expression framework in Example 1 of the present invention.

[0051] Figure 3 This is the SDS-PAGE analysis of CClH in Example 1 of the present invention; wherein lane 1 is a molecular weight reference; lane 2 is purified CClH without reduction; and lane 3 is purified CClH with reduction.

[0052] Figure 4 These are the binding activity results of each antibody in Example 3 of the present invention with CC1h.

[0053] Figure 5 These are the binding activity results of each antibody in Example 3 of the present invention with CC1h.

[0054] Figure 6 The protein standard curve (y=0.6849x+0.6325, R 2 =0.9925).

[0055] Figure 7This is a diagram showing the purification effect of CCIH-Biotin detected by SDS-PAGE in Example 4 of the present invention; wherein, lane 1 is CCIH-Biotin in a reducing loading buffer containing DTT, and lane 2 is CCIH-Biotin in a non-reducing loading buffer.

[0056] Figure 8 The standard curve was prepared by diluting the A13 (P59368) and A13SP (P62297) antibodies in Example 5 of the present invention at 1 RU / mL = 70 ng / mL to the same concentration as the standard.

[0057] Figure 9 For the 9 antibodies in Example 5 of the present invention ( Figure 9 A) and its SP mutant antibodies ( Figure 9 B) The standard curve was prepared by diluting the sample to the same concentration as the standard at 1 RU / mL = 70 ng / mL. DETAILED DESCRIPTION

[0058] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0059] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0060] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0061] To facilitate understanding of the present invention, certain technical and scientific terms are defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs. The abbreviations for amino acid residues are the standard three-letter and / or one-letter codes used in the art to designate one of the 20 commonly used L-amino acids.

[0062] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0063] As used herein, the terms "optionally," "optional," "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0064] As used herein, the terms "identity," "homology," or "similarity" are used to describe an amino acid sequence or nucleic acid sequence relative to a reference sequence, and the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences is determined by conventional methods, for example, see Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, DC). There are many algorithms for aligning sequences and determining sequence identity, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48:443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; the Smith-Waterman algorithm (Meth. Mol. Biol. 10:106); the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 10:116; the similarity search method of Pearson et al. (1990) Proc. Natl. Acad. Sci. 10:117; the similarity search method of Pearson et al. (1990 ... .70:173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. Mol. Biol. 215:403-410). Computer programs that utilize these algorithms are also available and include, but are not limited to, ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0065] Under the premise of not substantially affecting the activity of the antibody (retaining at least 90% of the activity), those skilled in the art can replace, add and / or delete one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more) amino acids in the sequence of the present invention to obtain variants of the antibody or its antigen-binding fragment sequence. They are all considered to be included in the scope of protection of the present invention. For example, amino acids with similar properties are replaced in the variable region. The variant sequence of the present invention may have at least 90%, 95%, 96%, 97%, 98% or 99% identity (or homology) with the reference sequence. The sequence identity of the present invention can be measured using sequence analysis software. For example, the computer program BLAST, especially BLASTP or TBLASTN, using default parameters. The amino acid sequences described in the present invention are all shown in an N-terminal to C-terminal manner.

[0066] As used herein, the term "at least 80% homology" refers to at least 80%, and may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% homology to each reference sequence. The term "at least 90% homology" refers to at least 90%, and may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% homology to each reference sequence.

[0067] As used herein, the term "variant" or "mutant" may refer to any naturally occurring or engineered molecule comprising one or more nucleotide or amino acid mutations.

[0068] In this article, the term "expression vector" generally refers to a nucleic acid molecule that can be inserted into a suitable host and replicates itself, and the inserted nucleic acid molecule is transferred into and / or between cells or hosts. The expression vector may include a vector primarily used for inserting DNA or RNA into a cell, a vector primarily used for replicating DNA or RNA, and a vector primarily used for expression of the transcription and / or translation of DNA or RNA. The vector also includes a vector with a variety of the above functions. The expression vector can be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable cell or host. Typically, the expression vector can produce a desired expression product by cultivating a suitable cell or host containing the expression vector.

[0069] In this article, the term "recombinant cell" generally refers to a cell in which the genetic material of a host cell is modified or reorganized using genetic engineering techniques or cell fusion techniques to obtain a cell with a unique trait of stable inheritance. Wherein, the term "host cell" refers to a prokaryotic cell or eukaryotic cell into which an expression vector can be introduced. The terms "transformed" or "transfected" as used herein refer to the introduction of a nucleic acid (e.g., a vector) into a cell by various techniques known in the art. Suitable host cells can be transformed or transfected with the DNA sequence of the present invention and can be used for the expression and / or secretion of a target protein. Examples of suitable host cells that can be used in the present invention include immortalized hybridoma cells, NS / 0 myeloma cells, 293 cells, Chinese hamster ovary (CHO) cells, HeLa cells, Cap cells (cells derived from human amniotic fluid), and CoS cells.

[0070] The present invention provides an anti-human PLA2R antibody or an antigen-binding fragment thereof, a nucleic acid molecule, an expression vector, a recombinant cell, a kit and uses thereof, which are described in detail below.

[0071] Antibodies or antigen-binding fragments thereof

[0072] In one aspect, the present invention provides an antibody or antigen-binding fragment thereof. According to an embodiment of the present invention, the antibody or antigen-binding fragment thereof comprises: a CDR sequence selected from at least one of the following: heavy chain variable region CDR sequences: SEQ ID NOs: 1-105; light chain variable region CDR sequences: SEQ ID NOs: 106-210, or an amino acid sequence with at least 80% identity thereto: heavy chain variable region CDR sequences: SEQ ID NOs: 106-210. This antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein and can be used as an anti-human PLA2R antibody standard. This antibody or antigen-binding fragment thereof can be produced through recombinant cell expression, offering advantages such as stability and mass production. It also eliminates the possibility of contamination by pathogenic microorganisms during the production process, thereby ensuring the purity and stability of the anti-human PLA2R antibody standard.

[0073] In this article, the term "antibody" is used in the broadest sense, which can include full-length monoclonal antibodies, multispecific antibodies, and chimeric antibodies. The specific structure is not limited as long as they exhibit the desired biological activity. It usually includes a light chain with a lighter molecular weight and a heavy chain with a heavier molecular weight. The heavy chain (H chain) and the light chain (L chain) are connected by a disulfide bond to form an antibody molecule. Among them, the amino acid sequence of the amino terminal (N-terminal) of the peptide chain varies greatly and is called the variable region (V region); the carboxyl terminal (C-terminal) is relatively stable and varies very little, and is called the constant region (C region). The V regions of the L chain and the H chain are called VL and VH, respectively. Among them, the region of the main amino acid residues that play a role in the binding affinity of the recognized antigen or epitope in both VL and VH is called CDR.

[0074] As used herein, the terms "complementarity determining region," "CDR," or "CDRs" refer to the hypervariable regions of the heavy and light chains of immunoglobulins, comprising one or more, or even all, of the major amino acid residues that contribute to the binding affinity of an antibody or antigen-binding fragment thereof to its recognized antigen or epitope.

[0075] As used herein, the heavy chain complementarity determining regions (heavy chain variable region CDRs) are referred to as "HCDRs" or "HCDRs," which include HCDR1 (also known as CDR-H1), HCDR2 (also known as CDR-H2), and HCDR3 (also known as CDR-H3); the light chain complementarity determining regions (light chain variable region CDRs) are referred to as "LCDRs" or "LCDRs," which include LCDR1 (also known as CDR-L1), LCDR2 (also known as CDR-L2), and LCDR3 (also known as CDR-L3). Commonly used CDR definition schemes in the art include: Kabat, Chothia, IMGT, Contact, and AbM. As used herein, "Kabat" refers to the definition system described in Kabat et al., U.S. Patent No. 20 ... Exemplary defined CDRs are listed in Table A below. Definitions vary slightly between different references. Given an antibody variable region amino acid sequence, one skilled in the art can routinely determine which residues comprise a specific CDR. It should be noted that the CDRs herein include, but are not limited to, those defined by other methods listed in Table A. CDRs defined using other methods disclosed in the art based on the heavy and light chain variable regions disclosed herein also fall within the scope of protection of the present disclosure.

[0076] Table A: CDR Definition 1

[0077] CDR Kabat <![CDATA[AbM 2 ]]> Chothia HCDR1 <![CDATA[H31~H35 3 ]]> <![CDATA[H26~H35 3 ]]> <![CDATA[H26~H32..34 4 ]]> HCDR2 H50~H65 H50~H58 H52~H56 HCDR3 H95~H102 H95~H102 H95~H102 LCDR1 L24~L34 L24~L34 L24~L34 LCDR2 L50~L56 L50~L56 L50~L56 LCDR3 L89~L97 L89~L97 L89~L97

[0078] 1 The numbering of all CDR definitions in Table A is according to the Kabat numbering system (see below), with amino acid numbers on the heavy chain indicated by "H+numbers" and amino acid numbers on the light chain indicated by "L+numbers".

[0079] 2 "AbM" as used in Table A with a lowercase "b" refers to CDRs defined by Oxford Molecular's "AbM" antibody modeling software.

[0080] 3 If both H35A and H35B are absent, CDR-H1 ends at position 35; if only H35A is present, CDR-H1 ends at position 35A; if both H35A and H35B are present, CDR-H1 ends at position 35B.

[0081] 4 If both H35A and H35B are absent, CDR-H1 ends at position 32; if only H35A is present, CDR-H1 ends at position 33; if both H35A and H35B are present, CDR-H1 ends at position 34.

[0082] Kabat et al. also defined a numbering system applicable to the variable region sequence of any antibody. One of ordinary skill in the art can clearly apply the Kabat numbering system to any variable region sequence without relying on any experimental data other than the sequence itself. As described herein, "Kabat numbering" refers to numbering using the numbering system described in Kabat et al., U. S. Patent No. 2002002002002002002002002003002003002003002003002003002003002003003002003003003003004 ...

[0083] It should be noted that the CDRs of the present invention are annotated based on domain alignment (see "Ehrenmann F, Kaas Q, Lefranc MP. IMGT / 3Dstructure-DB and IMGT / DomainGapAlign: a database and a tool for immunoglobulins or antibodies, T cell receptors, MHC, IgSF and MhcSF. Nucleic Acids Res. 2010 Jan; 38 (Database issue): D301-7. PMID: 19900967." and "Ehrenmann F, Lefranc MP. IMGT / DomainGapAlign: IMGT standardized analysis of amino acid sequences of variable, constant, and groove domains (IG, TR, MH, IgSF, MhSF). Cold Spring Harb Protoc. 2011 Jun 1; 2011 (6): 737-49. PMID: 21632775."). However, a person skilled in the art is fully capable of converting the heavy chains and light chains in the sequence listing into other numbering systems (such as Kabat, Chothia, Contact and AbM) according to the definition rules of Table A for definition, and the CDRs obtained thereby are all within the scope of protection of the present invention.

[0084] As used herein, the terms "full-length antibody," "full-length monoclonal antibody," or "full-length monoclonal antibody" are composed of at least two identical light chains and at least two identical heavy chains connected by interchain disulfide bonds, such as immunoglobulin G (IgG), immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin D (IgD), or immunoglobulin E (IgE).

[0085] As used herein, the terms "polyantibody" and "multispecific antibody" are synonymous and refer to antibodies that can recognize multiple antigenic epitopes, such as antibodies that can recognize two antigenic epitopes (bispecific antibodies, abbreviated as bispecific antibodies), antibodies that can recognize three antigenic epitopes, or antibodies that can recognize four antigenic epitopes. These are broadly understood and are not limited to specific structures, as long as they can recognize multiple antigenic epitopes. In the present invention, at least one of the multiple antigenic epitopes is derived from cTnI.

[0086] As used herein, the term "antigen-binding fragment" refers to a fragment comprising a portion or all of an antibody that lacks at least some of the amino acids present in the full-length chain but is still capable of specifically binding to an antigen. For example, the fragment may comprise a portion or all of an antibody CDR. Such fragments are biologically active because they bind to an antigen and can compete with other antigen-binding molecules (including intact antibodies) for binding to a given epitope. Such fragments are selected from Fab, Fv, scFv, or single-domain antibodies. Such fragments can be produced by recombinant nucleic acid technology or can be produced by enzymatic or chemical cleavage of antigen-binding molecules (including intact antibodies).

[0087] In some optional embodiments of the present invention, the above-mentioned antibody or antigen-binding fragment thereof may further include at least one of the following additional technical features:

[0088] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region CDR1 selected from the amino acid sequence of any one of SEQ ID NOs: 1 to 35, or an amino acid sequence with at least 80% identity thereto; a heavy chain variable region CDR2 selected from the amino acid sequence of any one of SEQ ID NOs: 36 to 70, or an amino acid sequence with at least 80% identity thereto; a heavy chain variable region CDR3 selected from the amino acid sequence of any one of SEQ ID NOs: 71 to 105, or an amino acid sequence with at least 80% identity thereto; a light chain variable region CDR1 selected from the amino acid sequence of any one of SEQ ID NOs: 106 to 140, or an amino acid sequence with at least 80% identity thereto; a light chain variable region CDR2 selected from the amino acid sequence of any one of SEQ ID NOs: 141 to 175, or an amino acid sequence with at least 80% identity thereto; or a light chain variable region CDR3 selected from the amino acid sequence of any one of SEQ ID NOs: 176 to 210, or an amino acid sequence with at least 80% identity thereto.

[0089] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region of any one of the following groups:

[0090]

[0091]

[0092] And / or, the antibody or antigen-binding fragment thereof comprises a light chain variable region of any one of the following groups:

[0093]

[0094]

[0095] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises any one of the following combinations:

[0096]

[0097] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof specifically recognizes PLA2R protein.

[0098] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof specifically recognizes a PLA2R antigen epitope peptide.

[0099] Herein, the term "PLA2R antigen epitope peptide" refers to a polypeptide having an amino acid sequence derived from PLA2R. The "PLA2R antigen epitope peptide" comprises an antigen epitope that can specifically bind to a PLA2R antibody. For example, the PLA2R antigen epitope peptide comprises CysR, FnII, and PLA2R binding region 1. The term "CysR" refers to the CysR domain in PLA2R, and the term "PLA2R binding region 1" refers to CTLD1 (or CTLD domain 1) in PLA2R. For a specific structure, see Figure 1 .

[0100] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof specifically recognizes the CysR, FNII and CTLD1 domains in the PLA2R protein.

[0101] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof further comprises: at least one of a heavy chain framework region sequence and a light chain framework region sequence; wherein, at least a portion of at least one of the heavy chain framework region sequence and the light chain framework region sequence is derived from at least one of a murine antibody, a human antibody, a primate antibody or a mutant thereof.

[0102] Herein, the "framework region" or "FR" region includes the heavy chain framework region and the light chain framework region, and refers to the region other than the CDR in the antibody heavy chain variable region (which can be represented as VH) and the light chain variable region (which can be represented as VL); wherein the heavy chain framework region is represented by "HFR" and can be further subdivided into adjacent regions separated by CDRs, including HFR1, HFR2, HFR3 and HFR4 framework regions; the light chain framework region is represented by "LFR" and can be further subdivided into adjacent regions separated by CDRs, including LFR1, LFR2, LFR3 and LFR4 framework regions.

[0103] In some optional embodiments of the present invention, at least a portion of the heavy chain framework region sequence and the light chain framework region sequence are derived from a human antibody or a mutant thereof.

[0104] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof has a heavy chain variable region with an amino acid sequence as shown in any one of SEQ ID NOs: 211 to 245.

[0105] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof has a light chain variable region with an amino acid sequence as shown in any one of SEQ ID NOs: 246 to 280.

[0106] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises any one of the following combinations:

[0107] Combination number VH (SEQ ID NO: VL (SEQ ID NO: Combination number VH (SEQ ID NO: VL (SEQ ID NO: 1 211 246 19 229 264 2 212 247 20 230 265 3 213 248 21 231 266 4 214 249 22 232 267 5 215 250 23 233 268 6 216 251 24 234 269 7 217 252 25 235 270 8 218 253 26 236 271 9 219 254 27 237 272 10 220 255 28 238 273 11 221 256 29 239 274 12 222 257 30 240 275 13 223 258 31 241 276 14 224 259 32 242 277 15 225 260 33 243 278 16 226 261 34 244 279 17 227 262 35 245 280 18 228 263 .

[0108] In some optional embodiments of the present invention, the antibody contains at least one of a heavy chain constant region and a light chain constant region, and at least a portion of at least one of the heavy chain constant region and the light chain constant region is derived from at least one of a murine antibody, a human antibody, a primate antibody or a mutant thereof.

[0109] In some optional embodiments of the present invention, the heavy chain constant region includes a heavy chain constant region selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD; or, the light chain constant region includes a light chain constant region selected from κ or λ type.

[0110] In some optional embodiments of the present invention, the light chain constant region and the heavy chain constant region are both derived from human IgG4 antibody or a mutant thereof.

[0111] In some optional embodiments of the present invention, the heavy chain constant region is wild-type human IgG4 or a human IgG4 mutant.

[0112] In some optional embodiments of the present invention, the human IgG4 mutant (having the amino acid sequence shown in SEQ ID NO: 282) has an S228P site mutation compared to the heavy chain constant region of the wild-type human wild-type IgG4 antibody.

[0113] It should be noted that the numbering of the above-mentioned sites is obtained by numbering the amino acids of the wild-type human IgG4 Fc part (having the amino acid sequence shown in SEQ ID NO: 281) according to the EU numbering system, for example, position 228 refers to position 228 according to the EU numbering system; the "S228P" means that the serine at position 228 according to the EU numbering system is replaced by proline.

[0114] In some optional embodiments of the present invention, the heavy chain constant region has an amino acid sequence as shown in SEQ ID NO: 281 or SEQ ID NO: 282.

[0115] In some optional embodiments of the present invention, the light chain constant region has an amino acid sequence as shown in SEQ ID NO: 357.

[0116] In some optional embodiments of the present invention, the antibody or its antigen-binding fragment has a heavy chain as shown in any one of the amino acid sequences of SEQ ID NOs: 283 to 317 and SEQ ID NOs: 358 to 366; or the antibody or its antigen-binding fragment has a light chain as shown in any one of the amino acid sequences of SEQ ID NOs: 318 to 352.

[0117] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises any one of the following combinations:

[0118]

[0119]

[0120] In some optional embodiments of the present invention, the antibody comprises at least one selected from monoclonal antibody, polyclonal antibody, multimeric antibody and CDR-grafted antibody.

[0121] In some optional embodiments of the present invention, the antibody comprises at least one selected from single-chain antibody, Fab antibody, Fab' antibody, F(ab')2 antibody, Fv antibody, single-chain antibody, single-domain antibody and minimum recognition unit.

[0122] In some optional embodiments of the present invention, the antigen-binding fragment includes at least one of a Fab fragment, a Fab' fragment, a F(ab)2 fragment, a F(ab')2 fragment, a Fv fragment, a scFv fragment, a scFv-Fc fusion protein, a scFv-Fv fusion protein, an Fv fragment, and a minimum recognition unit.

[0123] The antigen-binding fragments of the above-mentioned antibodies generally have the same binding specificity as the antibody from which they are derived. Those skilled in the art will readily appreciate, based on the disclosure herein, that the antigen-binding fragments of the above-mentioned antibodies can be obtained by, for example, enzymatic digestion (including pepsin or papain) and / or by chemical reduction cleavage of disulfide bonds. Based on the structures of the intact antibodies disclosed herein, those skilled in the art can readily obtain the above-mentioned antigen-binding fragments.

[0124] The antigen-binding fragments of the above antibodies can also be synthesized by recombinant genetic techniques known to those skilled in the art or by, for example, an automatic peptide synthesizer, such as those sold by Applied BioSystems.

[0125] In this article, the terms "polyantibody" and "multispecific antibody" are synonymous, and both refer to antibodies that can recognize multiple antigenic epitopes, such as antibodies that can recognize two antigenic epitopes (abbreviated as bispecific antibodies), antibodies that can recognize three antigenic epitopes, or antibodies that can recognize four antigenic epitopes. This is understood in a broad sense, and the specific structure is not limited, as long as it can recognize multiple antigenic epitopes.

[0126] As used herein, the terms "CDR-grafted antibody" and "modified antibody" both refer to the transplantation of the CDRs of a monoclonal antibody from one species into the variable region of an antibody from another species. For example, the CDRs of a mouse monoclonal antibody can be transplanted into the variable region of a human antibody to replace the human antibody CDRs, allowing the human antibody to acquire the antigen-binding specificity of the mouse monoclonal antibody while reducing its heterologous nature. It should be noted that both polyclonal antibodies and monoclonal antibodies in this application can be CDR-grafted antibodies.

[0127] Herein, the terms "single domain antibody", "nanoantibody" and "VHH antibody" are used interchangeably, which were originally described as the antigen-binding immunoglobulin (variable) domains of "heavy chain antibodies" (i.e., "antibodies lacking light chains") (Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, Bendahman N, Hamers R.: "Naturally occurring antibodies devoid of light chains"; Nature 363, 446-448 (1993)), comprising a heavy chain variable region (VH) and conventional CH2 and CH3 regions, which specifically bind to antigen proteins (e.g., cTnI) through the heavy chain variable region.

[0128] As used herein, the term "Fab antibody" or "Fab fragment" generally refers to an antibody or fragment containing only the Fab molecule, which is composed of the VH and CH1 of the heavy chain and a complete light chain, with the light chain and heavy chain connected by a disulfide bond.

[0129] As used herein, the term "F(ab')2 antibody" or "F(ab')2 fragment" has two antigen-binding F(ab') portions linked together by a disulfide bond.

[0130] As used herein, the term "Fv antibody" or "Fv fragment" generally refers to an antibody or fragment consisting solely of a light chain variable region (VL) and a heavy chain variable region (VH) linked by non-covalent bonds. It is the smallest functional fragment of an antibody that retains a complete antigen-binding site.

[0131] As used herein, the terms "single-chain antibody" and "scFv fragment" refer to antibodies or fragments formed by connecting the heavy chain variable region and the light chain variable region of an antibody via a short peptide.

[0132] In this article, the terms "minimum recognition unit" and "MRU" both refer to antibodies or fragments consisting of only one CDR, which has a very small molecular weight of only about 1% of the complete antibody.

[0133] Nucleic acid molecules, expression vectors, recombinant cells and kits and their uses

[0134] In the process of preparing or obtaining the aforementioned antibodies or antigen-binding fragments thereof, nucleic acid molecules expressing these antibodies or antigen-binding fragments thereof can be connected to different vectors and then expressed in different cells to obtain the corresponding antibodies or antigen-binding fragments thereof.

[0135] In another aspect of the present invention, a nucleic acid molecule is provided. According to an embodiment of the present invention, the nucleic acid molecule encodes the aforementioned antibody or antigen-binding fragment thereof. The nucleic acid molecule according to an embodiment of the present invention can encode the aforementioned antibody or antigen-binding fragment thereof.

[0136] In some optional embodiments of the present invention, the nucleic acid molecule is DNA.

[0137] It should be noted that, for nucleic acid molecules mentioned herein, those skilled in the art will understand that they actually include any one or both of the complementary double strands. For convenience, although only one strand is provided in most cases herein, the other strand complementary thereto is also disclosed. In addition, the molecular sequences in the present invention include DNA or RNA forms, and disclosure of one of them implies that the other is also disclosed.

[0138] In another aspect of the present invention, the present invention proposes an expression vector. According to an embodiment of the present invention, it carries the aforementioned nucleic acid molecule. When the aforementioned nucleic acid molecule is connected to the vector, the nucleic acid molecule can be directly or indirectly connected to the control elements on the expression vector, as long as these control elements can control the translation and expression of the nucleic acid molecule. Of course, these control elements can come directly from the expression vector itself, or they can be exogenous, that is, not from the expression vector itself. Of course, the nucleic acid molecule and the control elements can be operably connected. In this article, "operably connected" means that the exogenous gene is connected to the vector so that the control elements in the vector, such as transcription control sequences and translation control sequences, can play their expected function of regulating the transcription and translation of the exogenous gene. Commonly used vectors can be, for example, plasmids, phages, etc. After the vectors according to some specific embodiments of the present invention are introduced into suitable recipient cells, the expression of the aforementioned antibody or its antigen-binding fragment can be effectively achieved under the mediation of the regulatory system, thereby achieving large-scale in vitro acquisition of the antibody or its antigen-binding fragment.

[0139] In some optional embodiments of the present invention, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector.

[0140] In some optional embodiments of the present invention, the expression vector is a plasmid expression vector.

[0141] In yet another aspect, the present invention provides a recombinant cell. According to an embodiment of the present invention, the recombinant cell: carries the aforementioned nucleic acid molecule; or expresses the aforementioned antibody or antigen-binding fragment thereof. Under suitable conditions, the cell can effectively express the aforementioned antibody or antigen-binding fragment thereof within the cell.

[0142] In some optional embodiments of the present invention, the recombinant cell is obtained by introducing the aforementioned expression vector into a host cell.

[0143] In some optional embodiments of the present invention, the recombinant cell is a eukaryotic cell.

[0144] In some optional embodiments of the present invention, the recombinant cell is a mammalian cell.

[0145] It should be noted that the cells of the present invention are not particularly limited and may be prokaryotic cells, eukaryotic cells, or bacteriophages. The prokaryotic cells may be Escherichia coli, Bacillus subtilis, Streptomyces, or Proteus mirabilis. The eukaryotic cells include fungi such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Trichoderma, insect cells such as S. frugiperda, plant cells such as tobacco, and mammalian cells such as BHK cells, CHO cells, COS cells, and myeloma cells.

[0146] In an optional embodiment of the present invention, the cells are mammalian cells, including BHK cells, CHO cells, NSO cells or COS cells, and do not include animal germ cells, fertilized eggs or embryonic stem cells.

[0147] It should be noted that the "suitable conditions" described in the present invention refer to conditions suitable for the expression of the antibodies or antigen-binding fragments thereof of the present invention. It will be readily understood by those skilled in the art that conditions suitable for the expression of the antibodies or antigen-binding fragments thereof include, but are not limited to, suitable transformation or transfection methods, suitable transformation or transfection conditions, healthy cell status, suitable cell density, suitable cell culture environment, and suitable cell culture time. "Suitable conditions" are not particularly limited, and those skilled in the art can optimize the most suitable conditions for the expression of the antibodies or antigen-binding fragments thereof based on the specific laboratory environment.

[0148] In yet another aspect, the present invention provides the use of the aforementioned antibody or antigen-binding fragment thereof, nucleic acid molecule, expression vector, or recombinant cell in preparing a PLA2R antibody standard. Methods according to certain embodiments of the present invention can effectively produce large quantities of the antibody or antigen-binding fragment thereof.

[0149] Based on the amino acid sequence of the antibody or antigen-binding fragment thereof disclosed herein, those skilled in the art can easily conceive of using genetic engineering technology or other technologies (chemical synthesis, recombinant expression) to prepare the antibody or antigen-binding fragment thereof. For example, the antibody or antigen-binding fragment thereof can be isolated and purified from the culture product of a recombinant cell capable of recombinantly expressing the antibody or antigen-binding fragment thereof as described in any of the above items. This is easy to achieve for those skilled in the art. Based on this, regardless of the technology used to prepare the antibody or antigen-binding fragment thereof disclosed herein, it falls within the scope of protection of the present disclosure.

[0150] In yet another aspect, the present invention provides a kit. According to an embodiment of the present invention, the kit comprises: the aforementioned antibody or antigen-binding fragment thereof; the aforementioned nucleic acid molecule; the aforementioned expression vector; or the aforementioned recombinant cell. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein, can be stably and mass-produced, and can eliminate contamination by pathogenic microorganisms. It can be used as an anti-human PLA2R antibody standard. Therefore, a kit containing the aforementioned antibody or antigen-binding fragment thereof has the advantage of high accuracy in detecting PLA2R antibodies.

[0151] In an optional embodiment of the present invention, the kit may further include a reagent for detecting PLA2R antibodies.

[0152] In another aspect of the present invention, the present invention provides a use of the aforementioned antibody or antigen-binding fragment thereof, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned recombinant cell in preparing a kit for detecting PLA2R antibodies or diagnosing PLA2R antibody-positive membranous nephropathy.

[0153] method

[0154] In another aspect, the present invention provides a method for detecting PLA2R antibodies. According to an embodiment of the present invention, the method comprises: based on the PLA2R antibody detection results, using the aforementioned antibody or antigen-binding fragment thereof as a PLA2R antibody standard to determine the PLA2R antibody content in the test sample. This improves the accuracy of PLA2R antibody detection. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein, can be stably and mass-produced, and can eliminate contamination by pathogenic microorganisms. Therefore, it can be used as an anti-human PLA2R antibody standard. Therefore, the method of the present invention has the advantages of high accuracy in detecting PLA2R antibodies.

[0155] In another aspect, the present invention provides a method for diagnosing PLA2R antibody-positive membranous nephropathy. According to an embodiment of the present invention, the method comprises: based on the PLA2R antibody detection results of a test sample, using the aforementioned antibody or antigen-binding fragment thereof as a PLA2R antibody standard to determine the PLA2R antibody content in the test sample; and based on the PLA2R antibody content, determining whether the patient corresponding to the test sample suffers from PLA2R antibody-positive membranous nephropathy. This improves the accuracy of PLA2R antibody detection. As previously mentioned, the aforementioned antibody or antigen-binding fragment thereof has a high affinity for the PLA2R protein, can be stably and mass-produced, and can eliminate pathogenic microbial contamination. It can be used as an anti-human PLA2R antibody standard to accurately detect the PLA2R antibody content. Therefore, the method of the present invention has a high diagnostic accuracy for PLA2R antibody-positive membranous nephropathy.

[0156] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.

[0157] Example 1: Preparation of the major PLA2R antigenic region CC1H

[0158] 1.1 Construction of recombinant protein of the main antigenic region of PLA2R

[0159] The plasmid vector used is the pcDNA3.4 transient expression vector, which contains the native full-length CMV promoter and the WPRE element downstream of the cloning site. Vectors based on the CMV promoter generally have good expression levels in CHO cell transient expression systems. The WPRE element is located downstream of the multiple cloning site and can effectively improve gene transcription and expression. In E. coli, it has an ampicillin resistance gene. Then, the vector gene pcDNA3.4 is amplified using PCR technology and connected to the synthetic gene (the gene sequence connected to the target gene (gene of interest) and the signal peptide (signal peptide) is referred to as the synthetic gene). The PCR template is obtained by gene synthesis. The pcDNA3.4 vector fragment and the synthetic gene fragment are connected using a homologous recombination kit. The DH5α competent cell is transformed to obtain a single clone, which is amplified and sequenced. After sequencing confirmation, the plasmid is extracted to obtain the synthetic gene recombinant expression plasmid. Among them, the synthetic gene is cloned between the CMV promoter and the WPRE gene of the plasmid pcDNA3.4. For details, see Figure 2 .

[0160] Among them, the amino acid sequence of the signal peptide is:

[0161] MLLSPSLLLLLLLGAPRGCA(SEQ ID NO:353);

[0162] The nucleotide sequence of the signal peptide is:

[0163] ATGCTGCTGTCGCCGTCGCTGCTGCTGCTGCTGCTGCTGGGGGCGCCGGGGCTGCGCC (SEQ ID NO: 354).

[0164] The structural diagram of PLA2R is shown in Figure 1 As shown, the target gene is the amino acid sequence 1 to 367 (Glu) of the PLA2R fragment. The constructed transient expression plasmid is named pcDNA3.4-CC1H.

[0165] The amino acid sequence of the synthetic gene (PLA2R major antigen region) is:

[0166] MLLSPSLLLLLLLGAPRGCAEGVAAALTPERLLEWQDKGIFVIQSESLKKCIQAGKSVLTLENCKQANKHMLWKWVSNHGLFNIGGSGCLGLNFSAPEQPLSLYECDSTLVSLRWRCNRKMITGPLQYSVQVAHDNTVVASRKYIHKWISYGSGGGDICEYLHKDLHTIKGNTHGMPCMFPFQYNHQWHHECTREGREDDLLWCATTSRYERDEKWGFCPDPTSAEVGCDTIWEKDLNSHICYQFNLLSSLSWSEAHSSCQMQGGTLLSITDETEENFIREHMSSKTVEVWMGLNQLDEHAGWQWSDGTPLNYLNWSPEVNFEPFVEDHCGTFSSFMPSAWRSRDCESTLPYICKKYLNHIDHEIVEGGHHHHHH(SEQ ID NO:355);

[0167] The nucleotide sequence of the synthetic gene (major antigen region of PLA2R) is as follows:

[0168]

[0169] 1.2 Transient expression of CC1H

[0170] About 24 hours before transfection, take FreeStyle TM Cells (cell density 5-6×10 5 / mL, from FreeStyle, Gibco, USA TM MAX CHO Expression System, Catalog No. K900020), cultured at 37°C, 5% CO2, and 120-135 rpm / min.

[0171] On the day of transfection, cells were diluted to a cell density of 1×10 6 / mL, add 10mL of cells to each shaking flask (cell survival rate is above 95%).

[0172] Lightly blend FreeStyle TM MAX Reagent several times, being careful not to vortex.

[0173] Take 12.5 μg of pcDNA3.4-CC1H and add OptiPRO TM SFM to a total volume of 0.2 mL and mix gently.

[0174] Take 12.5 μL of FreeStyle TM MAX Reagent, added Opti-Pro TM Add SFM to a total volume of 0.2 mL and mix gently. Mix thoroughly and add to the plasmid mixture and mix gently to obtain 0.4 mL DNA-FreeStyle TM MAX mixture and incubate at room temperature for 10 minutes to allow complex formation.

[0175] Slowly add the above 0.4mL DNA-FreeStyle TM MAX complex was added to the cells while slowly rotating the flask.

[0176] The cells were cultured at 37°C, 5% CO2 and 120-135 rpm / min without replacing or supplementing the culture medium. The cell culture supernatant was collected after 7 days.

[0177] 1.3 Purification and identification of CC1H

[0178] Sample: Take 25 mL of the cell culture supernatant from step 1.2. Centrifuge at 7000 rpm for 10 min at 4°C. Pass through a 0.22 μm syringe filter. Apply to a Ni Sepharose 6FF column at 2 mL / min. Elute with 20 mM phosphate buffer, 500 mM NaCl, and 20 mM imidazole, pH 6.8. Elute over 5 column volumes with 0-100% 20 mM phosphate buffer, 1 M NaCl, and 500 mM imidazole, pH 6.8. Collect 2 mL fractions per tube.

[0179] The eluted peak was ultrafiltered three times in a 30 kD ultrafiltration centrifuge tube and the solution was replaced with 50 mM phosphate buffer and 150 mM NaCl, pH 7.4. The Bradford method was used for quantification. The expression level of CC1H was measured to be 37 mg / L. CC1H was analyzed by SDS-PAGE. The analysis results are shown in the figure. Figure 3 shown.

[0180] Example 2: CC1H biotin labeling and humanized phage library screening

[0181] Biotin labeling of CC1H and screening of the humanized phage library were performed by Sanyou Biopharmaceuticals (Shanghai) Co., Ltd. CC1H was first biotin-labeled, and ELISA was used to confirm biotin binding. Subsequently, a solid-phase and liquid-phase cross-screening method was used using immunotubes and magnetic bead screening to screen the humanized recombinant antibody library constructed by Sanyou Biopharmaceuticals (Shanghai). Fab antibodies specific for CC1H were enriched by trypsin elution. ELISA was used to assess the enrichment of the different output pools, and this screening yielded the majority of well-enriched output pools at the ELISA level. After initial ELISA screening, 1748 clones were selected, and 834 positive clones specifically binding to CC1H were obtained. Of these, 98 were sequence-unique molecules. Thirty-four molecules (see P59365-P59376 and P59378-P59399 in Table 1) were selected for full-length construction. These 34 molecules were of the IgG4 subtype.

[0182] Nine antibodies with good affinity and expression levels were selected at the phage level to construct IgG4SP subtype antibodies (see P62295-P62298, P62300-P62304 in Table 1, referred to as SP mutants).

[0183] A total of 43 antibodies were selected for expression (for their amino acid and nucleotide sequences, see the "Amino Acid Sequence Listing of the Present Invention" and "Nucleotide Sequence Listing of the Present Invention" in the Summary of the Invention). The corresponding heavy and light chains were cloned between the CMV promoter and the WPRE gene in pcDNA3.4. CHO cells were transiently transfected and expression levels were measured (ExpiCHO Expression System Kit, ThermoFisher, Cat. No. A29133). Antibody numbers and expression levels are shown in Table 1.

[0184] Table 1: Antibody numbers and expression levels

[0185]

[0186]

[0187] Note: *IgG4SP is a point mutation of IgG4, with an S228P mutation site in the hinge region, which increases antibody stability.

[0188] Example 3: Human anti-human PLA2R antibody ELISA detection

[0189] The human anti-human PLA2R antibody after phage screening and expression in Example 2 was used to indirectly determine its binding to CC1h using the ELISA method.

[0190] Add 30 μL CC1h (2 μg / mL, diluted in 1*PBS) to the ELISA plate reaction wells, seal the plate, and incubate at 4°C overnight; wash the plate three times with PBST and discard the liquid in the wells; add 5% PBSM to block the ELISA plate at room temperature for 2 hours; wash the plate three times with PBST, add 30 μL Abs (diluted in 1*PBS) to each well of the ELISA plate and incubate at room temperature for 60 minutes; wash the plate three times with PBST, add 30 μL anti-human IgG Fc HRP (diluted with 1% PBSM at a ratio of 1:8000) to each well, incubate at room temperature for 60 minutes; add TMB and stop the reaction with 2M blocking solution and measure the OD value at 450 nm. Recombinant Ipilimumab (Sanyou Biopharmaceutical) was used as a negative control. The test results are shown in Tables 2 and 3. Figures 4 and 5 .

[0191] Table 2: Binding activity of each antibody to CC1h

[0192] Protein name <![CDATA[EC 50 (ng / mL)]]> Protein name <![CDATA[EC 50 (ng / mL)]]> A2(P59365) 3.94 B67(P59388) 5.02 A5(P59366) 8.81 B83(P59389) 7.71 A8(P59367) 4.81 B88(P59390) - A13(P59368) 6.49 B90(P59391) 2.96 A21(P59369) 8.49 B109(P59392) 6.38 A22(P59370) - B114(P59393) 6.52 A23(P59371) 27.57 B117(P59394) 7.17 A26(P59372) 15.97 B123(P59395) 8.09 A44(P59373) 4.79 B145(P59396) - A53(P59374) 4.03 B156(P59397) 10.48 A61(P59375) 4.6 B201(P59398) 8.88 A67(P59376) 6.41 B307(P59399) 5.74 A156(P59378) 6.9 A2SP(P62295) 5.66 A187(P59379) 6.4 A5SP(P62296) 11.15 A378(P59380) 14.06 A13SP(P62297) 8.69 A382(P59381) 13.24 A61SP(P62298) 10.26 B16(P59382) 6.67 A156SP(P62300) 14.65 B20(P59383) 5.36 A187SP(P62301) 11.52 B24(P59384) 7.03 B88SP(P62302) 8.76 B29(P59385) 3.85 B90SP(P62303) 19.5 B44(P59386) - B156SP(P62304) 8.12 B53(P59387) 7.67

[0193] ELISA results showed that A22 (see Figure 4 A), B44 (see Figure 4 C), B88 (see Figure 4 C), B145 (see Figure 5A) These four antibodies did not bind to CC1h significantly, and the positive results in the phage library screening process may be false positives. The remaining antibodies all showed different binding strengths to CC1h. 50 The concentrations ranged from 3.85 ng / mL (B29) to 27.6 ng / mL (A23). The results showed that most antibodies specifically bound to CC1h.

[0194] Example 4: Kinetic and Thermodynamic Analysis of the Interaction between Antibodies and CC1H

[0195] Sartorius Bio-Layer Interferometry (BLI) The N1 molecular interaction instrument detects the interaction between proteins and biomolecules, namely, the binding constant (Ka), dissociation constant (Kd), and affinity constant (KD) of the interaction between the 43 PLA2R human antibodies in Example 2 and biotin-labeled CCIH.

[0196] The specific experimental steps are as follows:

[0197] 4.1 Biotin labeling of CC1H

[0198] The CC1H protein purified in Example 1 was biotin-labeled using the EZ-Link Sulfo-NHS-LC-Biotin kit (ThermoScientific, 21335). The specific steps are as follows:

[0199] Equilibrate the reagent kit to room temperature;

[0200] Prepare a 10 mM biotin solution. Dissolve 0.5 mg of biotin in 90 μL of sterile double-distilled water.

[0201] Add 20 times the molar number of the protein to the CCIH protein solution.

[0202] The system was placed on ice and incubated for 2 hours, during which time the system was inverted several times to ensure thorough mixing.

[0203] 4.2 Purification of CClH-Biotin

[0204] Use G-25 pre-packed desalting column (Borgron, EG001) to purify biotin-labeled CC1H-Biotin:

[0205] Prepare 20 mM PBS buffer at pH 7.2 according to Table 3;

[0206] Table 3: PBS buffer preparation table

[0207]

[0208] balance:

[0209] Use a 10mL syringe to draw PBS buffer, connecting the column and syringe "drop by drop" each time to prevent bubbles;

[0210] Cut off the outlet end;

[0211] A total of 25 mL of PBS buffer was passed through the column at 5 mL / min (120 drops / min) to remove ethanol from the column, and the column effluent was discarded;

[0212] Loading:

[0213] Use a 3 mL syringe to load 1.5 mL of sample at 5 mL / min (make up the amount less than 1.5 mL with PBS buffer) and discard the column effluent;

[0214] An additional 3 mL of PBS buffer was injected; approximately 2 mL was collected in total.

[0215] Column cleaning and storage:

[0216] Use a 10 mL syringe to pass 25 mL of PBS buffer, then pass 25 mL of water, and discard the column flow-through;

[0217] Use a 10 mL syringe to pass 25 mL of 20% ethanol and store at 4°C;

[0218] Sample storage:

[0219] The collected samples were sterilized by filtration using a 0.2 μm pore size filter and stored in aliquots.

[0220] 4.3 Bradford method (Biyuntian, P0060) to measure CC1H-Biotin protein concentration

[0221] After completely melting and mixing, the protein standard (5 mg / ml BSA) was diluted with PBS buffer to prepare 0, 0.125, 0.25, 0.5, 0.75, 1, and 1.5 mg / ml protein standards and mixed thoroughly;

[0222] 5 μL of protein standards of different concentrations were added to the standard wells of a 96-well immunoplate (Thermo Scientific, 468667);

[0223] Take 5 μL of sample into the sample well of 96-well immunoplate (if less than 5 μL, add PBS buffer to make up);

[0224] Add 250 μL of G250 staining solution to each well;

[0225] A595 was measured using a microplate reader;

[0226] The protein concentration in the sample was calculated based on the standard curve. Figure 6 , where y = 0.6849x + 0.6325, R 2 =0.9925.

[0227] The calculated concentration of CC1H-Biotin protein was 2.36 mg / mL.

[0228] 4.4 Identification of sample purity and concentration by reducing / non-reducing SDS-PAGE

[0229] The purity and concentration of the samples were determined by reducing / non-reducing SDS-PAGE. Figure 7 As shown, the lanes from left to right are CCIH-Biotin in reducing loading buffer containing DTT and CCIH-Biotin in non-reducing loading buffer.

[0230] The molecular weight of CC1H-Biotin is approximately 40 KDa, and the purity is >98%.

[0231] 4.5 Using Pierce TM Biotin Quantitation Kit(HABA assay)(Thermo Scientific TM , 28005) kit to detect biotin incorporation levels. Equilibrate the ABA / Avidin premix to room temperature;

[0232] Add 100 μL of ultrapure water to the HABA / Avidin premix tube and blow evenly with a pipette tip;

[0233] Add 160 μL of PBS buffer to the wells of a 96-well immunoplate (Thermo Scientific, 468667);

[0234] Add 20 μL of HABA / Avidin premix solution to the wells containing PBS buffer, shake and mix thoroughly, and then measure A500;

[0235] Add 20 μL of biotinylated sample to the well containing HABA / Avidin, shake and mix thoroughly, and then measure A500 to keep it constant for at least 15 seconds;

[0236] The biotin incorporation level was calculated according to Beer's law. The results are shown in Table 4. The biotin incorporation level of CC1H-Biotin was calculated to be 1.80 mol biotin / mol protein.

[0237] Table 4: Biotin incorporation levels

[0238]

[0239] 4.6 Interaction Assay between CC1H-Biotin and Human Antibodies Against PLA2R Screened from Phage Library

[0240] Using Sartorius N1 molecular interaction instrument, select SA sensor (Sartorius, Streptavidin(SA)Biosensor, 18-5019):

[0241] The sensor was pre-wetted in PBSTB buffer (PBS buffer with 0.02% Tween-20 and 0.1% BSA) for >10 min and then loaded onto the molecular interaction instrument;

[0242] The sensor was immersed in different buffer solutions and tested using the 5-step method:

[0243] Baseline 1 (PBSTB buffer 300 μL, 1 min) -> Immobilization (CC1H-biotin, 20 μg / mL 300 μL, 2 min) -> Baseline 2 (PBSTB buffer, 3 min) -> Binding (76.6-8.5 nM PLA2R human antibody prepared in Example 2, gradient diluted with PBSTB buffer 300 μL, 2 min) -> Dissociation (PBSTB buffer 300 μL, 5 min) (because the human antibody sample contains ExpiCHO TM Expression medium, baseline 2 and dissociation PBSTB buffer containing the corresponding concentration of ExpiCHO TM Expression medium (Gibco, A2910001);

[0244] The binding constant (Ka), dissociation constant (Kd) and affinity constant (KD) were calculated. See Table 5 for details.

[0245] Table 5: Ka, Kd, and KD values of CC1H-Biotin and PLA2R human antibody

[0246] Protein number Protein name KD(M) ka(1 / Ms) kd(1 / s) <![CDATA[R 2 ]]> P59365 A2 1.04E-10 7.55E+05 7.86E-05 0.992 P59366 A5 4.55E-10 5.77E+05 2.63E-04 0.999 P59368 A13 5.80E-10 4.80E+05 2.78E-04 0.998 P59375 A61 1.78E-11 1.06E+06 1.89E-05 0.995 P59378 A156 1.58E-10 6.44E+05 1.02E-04 0.996 P59379 A187 2.04E-09 1.94E+05 3.95E-04 0.999 P59390 B88 2.11E-02 5.91E+04 1.25E+03 0.000 P59391 B90 8.407E-10 6.08E+05 5.12E-04 0.991 P59397 B156 2.42E-10 5.16E+05 1.25E-04 0.999 P62295 A2SP <1E-12 8.72E+05 <1E-7 0.989 P62296 A5SP 1.56E-09 3.04E+05 4.75E-04 0.999 P62297 A13SP 3.587E-10 4.06E+05 1.46E-04 0.998 P62298 A61SP 1.26E-10 6.48E+05 8.17E-05 0.999 P62300 A156SP 4.56E-10 3.71E+05 1.69E-04 0.999 P62301 A187SP 1.36E-09 1.67E+05 2.27E-04 0.999 P62302 B88SP 1.448E-10 5.56E+05 8.04E-05 0.998 P62303 B90SP 6.594E-09 9.70E+04 6.39E-04 0.981 P62304 B156SP <1E-12 6.54E+05 <1E-7 0.997

[0247] As can be seen from the table above, except for P59390 (B88), the other antibodies used to detect molecular interactions all bind well to CC1H and can be used as PLA2R antibody standards.

[0248] Example 5: Calibration of PLA2R Antibody Standards

[0249] 5.1 Measurement conversion relationship

[0250] The titers of A13 (P59368) and A13SP (P62297) prepared in Example 2 at different dilutions were detected using the Euroimmun anti-PLA2R (IgG) kit (Euroimmun, EA 1254-9601G (96)). The average value was used as the conversion relationship between RU and ng, see Table 6.

[0251] Table 6: Titer detection results of A13 and A13SP at different dilutions

[0252]

[0253]

[0254] The quantitative conversion relationship of A13 / A13SP is about 1RU=70ng. Draw the A13 / A13SP standard curve according to 1RU=70ng and compare it with the standard product of Euromon. Figure 8 .

[0255] Depend on Figure 8 It can be seen that in the very high concentration range (>750RU / mL), the A13 / A13SP standard curve is slightly different from the Euromon standard. This may be because the kit standard is a polyclonal antibody, which is a mixture of multiple antibodies with significantly different affinities. Therefore, its ELISA curve performance is different from that of the screened monoclonal antibodies.

[0256] 2. Comparison of standard curves

[0257] The 9 antibodies and their SP mutants prepared in Example 2 were screened using the Euromon ELISA kit (see Figure 9 ) were compared with the standard sample in the kit.

[0258] The experimental steps are as follows:

[0259] Add 100 μL / well of standards 1-5, human antibody samples, and negative control, seal the plate, and incubate at room temperature (25°C) for 30 min;

[0260] Discard the liquid in the wells and place the plate on a plate washer (Bio-Rad, ImmunoWash TM Wash the plate 4 times with the matching plate washer (1575), centrifuge at 600 g for 1 min on a plate spinner (Hettich, Universal 16R), and pat dry several times;

[0261] Add 100 μL of the matching enzyme conjugate to each well, seal the plate, and incubate at room temperature (25°C) for 30 min;

[0262] Repeat the plate wash;

[0263] Add 100 μL of the supporting substrate colorimetric solution to each well, incubate in the dark at room temperature (25°C) for 15 min, then add 100 μL of the supporting stop solution to each well and measure A450.

[0264] Test results see Figure 9 , Figure 9 The concentration of the screening antibody was converted to RU according to 1RU=70ng.

[0265] Depend on Figure 9 As shown in Figure A, P59390 (B88) cannot be detected by the commercial kit, which is consistent with the results of CC1h ELISA and BLI analysis. The other antibodies and their SP mutants performed close to the standard curve of the Euromon ELISA kit. The curve shape of the screened antibody differed from that of the kit standard. This may be because the kit standard is a polyclonal antibody, composed of a mixture of multiple antibodies with significantly different affinities. Therefore, its ELISA curve performance differs from that of the screened monoclonal antibody.

[0266] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0267] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. An anti-PLA2R antibody or an antigen-binding fragment thereof, characterized in that: Include: A CDR sequence selected from at least one of the following or an amino acid sequence having at least 80% identity thereto: Heavy chain variable region CDR sequences: SEQ ID NOs: 3, 5-35, 38, 40-70, 73, 75-105; Light chain variable region CDR sequences: SEQ ID NO: 108, 110-140, 143, 145-175, 178, 180-210.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein The antibody or antigen-binding fragment thereof comprises: a heavy chain variable region CDR1 selected from the amino acid sequence of any one of SEQ ID NOs: 3, 5 to 35, or an amino acid sequence having at least 80% identity thereto; a heavy chain variable region CDR2 selected from the amino acid sequence of any one of SEQ ID NOs: 38, 40 to 70, or an amino acid sequence having at least 80% identity thereto; a heavy chain variable region CDR3 selected from the amino acid sequence of any one of SEQ ID NOs: 73, 75 to 105, or an amino acid sequence having at least 80% identity thereto; a light chain variable region CDR1 selected from the amino acid sequence of any one of SEQ ID NOs: 108, 110 to 140, or an amino acid sequence having at least 80% identity thereto; A light chain variable region CDR2 selected from the amino acid sequence of any one of SEQ ID NOs: 143, 145 to 175, or an amino acid sequence having at least 80% identity thereto; or a light chain variable region CDR3 selected from the amino acid sequence of any one of SEQ ID NOs: 178, 180 to 210, or an amino acid sequence at least 80% identical thereto; Optionally, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region selected from any one of the following groups: And / or, the antibody or antigen-binding fragment thereof comprises a light chain variable region of any one of the following groups: Optionally, the antibody or antigen-binding fragment thereof comprises any one of the following combinations: Optionally, the antibody or antigen-binding fragment thereof specifically recognizes CysR, FNII and CTLD1 domains in the PLA2R protein.

3. The antibody or antigen-binding fragment thereof according to claim 1, wherein The antibody or antigen-binding fragment thereof further comprises: at least one of a heavy chain framework region sequence and a light chain framework region sequence; wherein at least a portion of at least one of the heavy chain framework region sequence and the light chain framework region sequence is derived from at least one of a murine antibody, a human antibody, a primate antibody, or a mutant thereof; Optionally, at least a portion of the heavy chain framework region sequence and the light chain framework region sequence are derived from a human antibody or a mutant thereof; Optionally, the antibody or antigen-binding fragment thereof has a heavy chain variable region having an amino acid sequence as shown in any one of SEQ ID NOs: 213, 215 to 245; Optionally, the antibody or antigen-binding fragment thereof has a light chain variable region having an amino acid sequence as shown in any one of SEQ ID NOs: 248, 250 to 280; Optionally, the antibody or antigen-binding fragment thereof comprises any one of the following combinations:

4. The antibody or antigen-binding fragment thereof according to claim 1, wherein The antibody comprises at least one of a heavy chain constant region and a light chain constant region, wherein at least a portion of at least one of the heavy chain constant region and the light chain constant region is derived from at least one of a murine antibody, a human antibody, a primate antibody, or a mutant thereof; Alternatively, the heavy chain constant region comprises a heavy chain constant region selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD; or The light chain constant region comprises a light chain constant region selected from a κ type or a λ type; Optionally, the light chain constant region and the heavy chain constant region are both derived from human IgG4 antibody or a mutant thereof; Optionally, the heavy chain constant region is wild-type human IgG4 or a human IgG4 mutant; Optionally, the human IgG4 mutant has an S228P site mutation compared to the heavy chain constant region of the wild-type human IgG4 antibody; Optionally, the heavy chain constant region has the amino acid sequence shown in SEQ ID NO: 281 or SEQ ID NO: 282; Optionally, the light chain constant region has the amino acid sequence shown in SEQ ID NO: 357; Optionally, the antibody or antigen-binding fragment thereof has a heavy chain as shown in any one of the amino acid sequences of SEQ ID NO: 285, SEQ ID NOs: 287-317, and SEQ ID NOs: 361-366; or The antibody or antigen-binding fragment thereof has a light chain represented by the amino acid sequence of any one of SEQ ID NO: 320 and SEQ ID NO: 322 to 352; Optionally, the antibody or antigen-binding fragment thereof comprises any one of the following combinations: ； Optionally, the antibody comprises at least one selected from a monoclonal antibody, a polyclonal antibody, a multimeric antibody and a CDR-grafted antibody; Optionally, the antibody comprises at least one selected from a single-chain antibody, a Fab antibody, a Fab' antibody, a F(ab')2 antibody, a Fv antibody, and a single-chain antibody; Optionally, the antigen-binding fragment comprises at least one of a Fab fragment, a Fab' fragment, a F(ab)2 fragment, a F(ab')2 fragment, a Fv fragment, a scFv fragment, a scFv-Fc fusion protein, and a scFv-Fv fusion protein.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the antibody or antigen-binding fragment thereof according to any one of claims 1 to 4; Optionally, the nucleic acid molecule is DNA.

6. An expression vector, characterized in that Carrying the nucleic acid molecule according to claim 5; Optionally, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector; Preferably, the expression vector is a plasmid expression vector.

7. A recombinant cell, characterized in that The recombinant cell: Carrying the nucleic acid molecule according to claim 5; or Expressing the antibody or antigen-binding fragment thereof according to any one of claims 1 to 4; Optionally, the recombinant cell is obtained by introducing the expression vector of claim 6 into a host cell; Optionally, the recombinant cell is a eukaryotic cell; Preferably, the recombinant cell is a mammalian cell.

8. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5, the expression vector according to claim 6, or the recombinant cell according to claim 7 in the preparation of a PLA2R antibody standard.

9. A kit, characterized in that include: The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4; The nucleic acid molecule according to claim 5; The expression vector according to claim 6; or The recombinant cell according to claim 7.

10. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5, the expression vector according to claim 6, or the recombinant cell according to claim 7 in preparing a kit for detecting PLA2R antibodies or diagnosing PLA2R antibody-positive membranous nephropathy.

Images