Flammulina variety x139, method for identifying the same and application thereof

Abstract

The application discloses a flammulina velutipes variety X139 and an identification method and application thereof. The flammulina velutipes variety X139 is preserved in the China General Microbiological Culture Collection Center (address: No. 3, Beichen West Road, Chaoyang District, Beijing, China) on June 6, 2025, and the biological preservation number is CGMCC No. 42023. The flammulina velutipes variety X139 has high wet affinity, no early opening umbrella, thick and strong stipe, and relatively less number of branches.

Description

Technical Field

[0001] This invention belongs to the field of enoki mushroom breeding and strain molecular identification technology, specifically involving an enoki mushroom variety X139 and its identification method and application. Background Technology

[0002] Enoki mushrooms (Flammulina filiformis) are beautiful in appearance, crisp in texture, and rich in nutrients, including protein, amino acids, vitamins, minerals, dietary fiber, and unsaturated fatty acids. They are also rich in bioactive components such as polysaccharides, flavonoids, terpenes, phenols, and fungal immunomodulatory proteins. Enoki mushrooms can be eaten fresh or processed into ready-to-eat foods, and are very popular among consumers.

[0003] In recent years, my country's edible fungi industry has entered a period of rapid development, with both output and value undergoing tremendous changes. The edible fungi industry has gradually become an important part of my country's agriculture. In 2023, the total national output of edible fungi exceeded 43.34 million tons, with a total output value exceeding 396.5 billion yuan. Among them, enoki mushrooms, as the earliest edible fungi variety to achieve factory-scale production in my country, had a total output of 1.8738 million tons in 2023, ranking first among factory-cultivated edible fungi varieties. The concentration of factory-scale enoki mushroom cultivation has continuously increased with economic and technological development, and its cultivation technology and scale are among the world's best, making enoki mushrooms one of the most industrialized and competitive varieties in the world, with significant economic value.

[0004] Currently, the enoki mushrooms sold in the market are still predominantly white, but they suffer from severe product homogenization, a soft texture that easily gets stuck in teeth, and other problems, seriously affecting the economic benefits of enterprises and the taste experience of consumers. As the market demands higher quality enoki mushrooms, traditional enoki mushroom varieties are struggling to meet consumer needs. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing cultivar identification techniques by providing a cultivar X139 of enoki mushroom (Flammulina filiformis) and its identification method.

[0006] Another objective of this invention is to address the problem of excessive water-grown enoki mushrooms in enoki mushroom production by providing a high-moisture-affinity cap variety X139 with no early opening cap and its identification method.

[0007] Another objective of this invention is to address the problem that enoki mushrooms are prone to getting stuck in teeth when eaten, by providing a enoki mushroom (Flammulina filiformis) variety X139 with a thick stipe and relatively few buds, and its identification method.

[0008] The first aspect of this application provides a strain of enoki mushroom (Flammulina filiformis) X139, which was deposited on June 6, 2025, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China), with the biological accession number: CGMCC No. 42023.

[0009] In some embodiments, the enoki mushroom (Flammulina filiformis) variety X139 has the characteristics of a short growth cycle, no early cap opening, high moisture affinity, and a robust stem.

[0010] The aforementioned enoki mushroom variety X139 was bred from parent X69 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) and parent X70 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) through single-spore hybridization. On PDA medium, enoki mushroom variety X139 exhibits: relatively white and dense mycelia, no powdery spores, and round colonies; the optimal culture temperature for mycelia is 19℃. During its growth and development, the fruiting bodies grow rapidly, and the caps exhibit high moisture affinity. At harvest time, the fruiting bodies have medium-sized, round, and thick caps with a mountain-shaped apex in longitudinal section; the stipe is columnar and robust; the number of buds is relatively small, and the rootstock is firm, resulting in good overall marketability and quality.

[0011] The second aspect of this application provides a method for identifying the enoki mushroom (Flammulina filiformis) variety X139 described in any of the above embodiments, wherein the identification method uses a molecular fingerprint spectrum composed of three specific MNP marker sites for identification.

[0012] In some embodiments, the primer sequences for the three specific MNP marker sites are as follows:

[0013] Forward primer (5'-3') of MNP 1 SEQ ID NO.1:

[0014] TTGATTTCTGGTGCATTCCTTATGG;

[0015] Reverse primer (5'-3') SEQ ID NO.2:

[0016] CAGCGGAATGTCTTATCAACGAAAT;

[0017] Forward primer (5'-3') of MNP 2 SEQ ID NO.3:

[0018] CTATGCCGATAATGCCAAAAACCAT;

[0019] Reverse primer (5'-3') SEQ ID NO.4:

[0020] ACACAGACAGATAGTACTCTGGAAC;

[0021] Forward primer (5'-3') of MNP 3 SEQ ID NO. 5:

[0022] GCGAGGTGTATATATGTAGACGTGA;

[0023] Reverse primer (5'-3') SEQ ID NO. 6:

[0024] CGGAGTATCATAGTTTACTGACGCT.

[0025] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X139 includes the following steps:

[0026] (1) Extract total genomic DNA from the mycelia of all the samples of *Flammulina velutipes* to be tested;

[0027] (2) Using the total genomic DNA as a template, PCR amplification was performed using primers as described in MNP 1 to MNP 3 respectively;

[0028] (3) Sequencing of each amplification product was performed to obtain sequencing data;

[0029] (4) Based on the sequencing data, determine the genotype of 3 loci in each enoki mushroom sample to be tested. If the genotype corresponding to the 3 loci is a heterozygous sequence, then the enoki mushroom to be tested is the X139 variety; otherwise, the enoki mushroom to be tested is a non-X139 variety.

[0030] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X139 involves using a kit to extract total genomic DNA from the mycelia of all enoki mushroom samples to be tested.

[0031] In some embodiments, the PCR amplification system in the identification method for the enoki mushroom (Flammulina filiformis) variety X139 includes:

[0032] 0.2 μM 4 μL primer set;

[0033] 20 ng / μL~30 ng / μL DNA template 4 μL;

[0034] GenoPlexs 3×T Master Mix 10μL;

[0035] ddH2O 12μL.

[0036] In some embodiments, the PCR amplification reaction program is as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 20 s, 60°C annealing for 4 min, 15 cycles; 72°C extension for 4 min; 10°C storage.

[0037] In some embodiments, the identification method for the Flammulina filiformis variety X139 uses an Illumina Next Seq550 for sequencing each amplification product.

[0038] The third aspect of this application provides the application of the enoki mushroom (Flammulina filiformis) variety X139 described in any of the above embodiments in enoki mushroom breeding.

[0039] The fourth aspect of this application provides the application of the enoki mushroom (Flammulina filiformis) variety X139 described in any of the above embodiments in food production.

[0040] This application proposes a new enoki mushroom variety, X139, which is characterized by high yield, excellent appearance, good taste, strong disease resistance, and market competitiveness, thereby leading to the sustainable and healthy development of the enoki mushroom industry.

[0041] In this application, the *Flammulina velutipes* variety X139, after factory-scale bottle cultivation, achieved an average yield of 557 g / bottle (1500 mL), higher than its parent varieties X69 (545 g / bottle) and X70 (500 g / bottle). Its growth cycle was 1 day faster than the parent control X69 and 2 days slower than X70. The caps of *Flammulina velutipes* variety X139 are thick, with an average diameter of 6.93 mm, a thickness of 1.64 mm, and a height of 4.30 mm; the stipes have an average diameter of 3.55 mm and a length of 16.55 cm. The fruiting bodies of *Flammulina velutipes* variety X139 are off-white; the caps are normal in size, thick, and inwardly curled, with a mountain-shaped apex in longitudinal section; the stipes are relatively thick, and the fruiting bodies develop uniformly; compared to its parent variety X69, it is less prone to opening its cap, easier to dehumidify, and has a slightly yellowish color; compared to its parent variety X70, the stipes are thicker and more compact. The enoki mushroom variety X139 exhibits excellent traits, meets diverse market demands, and is suitable for year-round bottle cultivation in industrial settings, demonstrating promising application and promotion prospects. The MNP fingerprint spectrum of enoki mushroom variety X139 possesses specificity and particularity for identifying the strain, providing reliable and accurate results. Compared to morphological identification, it offers advantages such as intuitive visualization, minimal error, and immunity to environmental conditions. Attached Figure Description

[0042] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below, wherein:

[0043] Figure 1 A control diagram showing the mycelial antagonism test between enoki mushroom variety X139 and its parents X69 and X70;

[0044] Figure 2 The mycelial growth diagrams show the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated varieties.

[0045] Figure 3 Shake bottle growth diagrams of Enoki mushroom variety X139, parental lines X69 and X70, and the main cultivated varieties.

[0046] Figure 4 The images show the frontal morphology of the fruiting bodies of the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated varieties at the time of harvest.

[0047] Figure 5 The images show the side views of the fruiting bodies of the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated varieties at the time of harvest.

[0048] Figure 6 The images show the root morphology of the fruiting bodies of the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated varieties at the time of harvest. Detailed Implementation

[0049] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to examples. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0050] In the description of this invention, "several" means one or more, "multiple" means two or more, "greater than", "less than", "exceeding" etc. are understood to exclude the number itself, and "above", "below", "within" etc. are understood to include the number itself.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0052] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to specific examples.

[0053] Flammulina strain X69 is a cultivar of Flammulina independently bred by Shanghai Xuerong Biotechnology Co., Ltd. On PDA medium, the strain exhibits: dense white mycelium with a lighter inner ring, slow growth rate, and prominent conidia. In Erlenmeyer flasks and shake flasks, the strain grows slowly, has low mycelial content, small mycelial balls, short spines, a few fragments, and a thicker clear layer. During fruiting in the growing room, mycelial growth is slow, and there is no bud shedding; at harvest, the fruiting bodies have thick caps, robust and compact stems, and are relatively white after root cutting, with a biological conversion rate of 150%–160%. However, scratching can cause clogging of the pores, resulting in spoilage. In the fruiting stage of the growing room, the strain exhibits disadvantages such as patchy buds, a small number of buds, and partially opened caps on the fruiting bodies.

[0054] The enoki mushroom strain X70 is also a cultivated variety of enoki mushroom independently bred by Shanghai Xuerong Biotechnology Co., Ltd. On PDA medium, the strain exhibits relatively dark white mycelium with a lighter outer ring and no conidia. When cultured in Erlenmeyer flasks or shake flasks, the strain grows rapidly, producing small fruiting bodies with short spines and a small amount of clear layer. During the fruiting stage in the growing room, the growth rate is relatively fast; at harvest, the fruiting bodies have small, thick caps that do not open, thin stems, and an overall yellowish color, with a biological conversion rate of 145%–155%. However, it has drawbacks such as a small number of bud drop during bud emergence, lower uniformity of fruiting bodies, more lateral buds, more crystal mushrooms, and generally lower firmness.

[0055] One embodiment of this application provides a strain of enoki mushroom (Flammulina filiformis) X139, which was deposited on June 6, 2025, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China), with the biological accession number: CGMCC No. 42023.

[0056] In this application, the breeding steps for the enoki mushroom variety X139 are as follows:

[0057] White enoki mushroom strains X69 and X70 were selected as parents. Spores from both strains were collected, and 13 single-spore strains of X69 and 7 single-spore strains of X70 with normal mycelial growth and moderate growth rate were selected. These single-spore strains were then subjected to single-single hybridization, and microscopic examination revealed 89 hybrid strains with clamp connections. In the laboratory, 62 hybrid progeny were initially screened based on colony morphology, growth rate, and mycelial morphology in shake flasks, resulting in 6 superior hybrid strains. Fruiting was then conducted at Shandong Xuerong Biotechnology Co., Ltd., yielding 4 hybrid strains with faster mycelial growth, shorter growth cycle, normal cap size, higher yield, thicker stipes, and fruiting body whiteness between the two parents. These 4 strains underwent secondary screening. The secondary screening results showed that 2 hybrid strains had higher yields than the parents and the main cultivated variety. Further pilot-scale experiments were conducted using the parent strain and the main cultivated variety as controls. The results showed that strain X139 performed exceptionally well, with significantly higher yields than the parent strain and the main cultivated variety. Its fruiting bodies were off-white and grew rapidly; the caps exhibited high moisture affinity, were thick, and did not open prematurely; the stipes were robust; and the rootstocks were firm and uniform, indicating good overall commercial characteristics and quality. This variety was named X139, and a plant variety right application was filed.

[0058] In some embodiments, the enoki mushroom (Flammulina filiformis) variety X139 has the characteristics of a short growth cycle, no early cap opening, high moisture affinity, and a robust stem.

[0059] The MNP fingerprint spectrum of the *Flammulina velutipes* variety X139 presented in this application possesses specificity and particularity for identifying *Flammulina velutipes* strain X139, with reliable and accurate results. Compared to morphological identification, it offers advantages such as intuitiveness, smaller errors, and immunity to environmental conditions. This *Flammulina velutipes* variety X139 is a new variety with high yield, excellent appearance, good taste, strong disease resistance, and significant market competitiveness, thereby leading to the sustainable and healthy development of the *Flammulina velutipes* industry.

[0060] The comparison diagram of mycelial antagonism test between enoki mushroom variety X139 and its parents X69 and X70 is shown in the figure. Figure 1 As shown.

[0061] The mycelial growth and shake-flask growth of enoki mushroom variety X139, parental lines X69 and X70, and the main cultivated variety are shown in the figures. Figure 2 , Figure 3 As shown. Among them, Figure 2 The mycelial growth diagrams show the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated variety. Figure 3 Shake bottle growth diagrams of enoki mushroom variety X139, parental lines X69 and X70, and the main cultivated variety.

[0062] See the morphological images of the fruiting bodies of enoki mushroom variety X139, its parents X69 and X70, and the main cultivated varieties. Figures 4-6 As shown. Among them, Figure 4 The images show the frontal morphology of the fruiting bodies of the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated variety. Figure 5 The images show the side morphology of the fruiting bodies of the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated varieties. Figure 6 The images show the root morphology of the fruiting bodies of the enoki mushroom variety X139, its parents X69 and X70, and the main cultivated varieties.

[0063] The aforementioned enoki mushroom variety X139 is a cultivated enoki mushroom variety independently bred by Shanghai Xuerong Biotechnology Co., Ltd. On PDA medium, the strain exhibits: dense white mycelium with a lighter inner ring, slow growth rate, and prominent conidia. In Erlenmeyer flasks and shake flasks, the strain grows slowly, has low mycelial content, small mycelial balls, short spines, a few fragments, and a thicker clarifying layer. During fruiting in the growing room, mycelial growth is slow, and there is no bud shedding; at harvest, the fruiting bodies are white, with thick caps, robust stems, and a relatively firm texture, with a biological conversion rate of 150-160%. However, scratching can cause clogging of the pores, resulting in spoilage. In the fruiting stage of the growing room, the strain exhibits disadvantages such as patchy buds, a small number of buds, and partially open caps on the fruiting bodies.

[0064] Multiple nucleotide polymorphisms (MNPs) refer to the presence of multiple SNPs within a DNA fragment of a certain length. They possess advantages such as higher information content, stronger co-occurrence effects, better discriminative power, and higher mapping accuracy, and have enormous application potential in genetic diversity research, variety identification, and genetic map construction. Therefore, there is an urgent need to develop MNP molecular markers for *Flammulina velutipes* varieties to improve the accuracy and reliability of identification results, thereby providing strong technical support for industrial development.

[0065] Based on this, one embodiment of this application also provides a method for identifying the Flammulina filiformis variety X139 described in any of the above embodiments, wherein the identification method uses a molecular fingerprint spectrum composed of three specific MNP marker sites for identification.

[0066] In some embodiments, the primer sequences for the specific MNP marker sites are as follows:

[0067] Forward primer (5'-3') of MNP 1 SEQ ID NO.1:

[0068] TTGATTTCTGGTGCATTCCTTATGG;

[0069] Reverse primer (5'-3') SEQ ID NO.2:

[0070] CAGCGGAATGTCTTATCAACGAAAT;

[0071] Forward primer (5'-3') of MNP 2 SEQ ID NO.3:

[0072] CTATGCCGATAATGCCAAAAACCAT;

[0073] Reverse primer (5'-3') SEQ ID NO.4:

[0074] ACACAGACAGATAGTACTCTGGAAC;

[0075] Forward primer (5'-3') of MNP 3 SEQ ID NO. 5:

[0076] GCGAGGTGTATATATGTAGACGTGA;

[0077] Reverse primer (5'-3') SEQ ID NO. 6:

[0078] CGGAGTATCATAGTTTACTGACGCT.

[0079] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X139 includes the following steps:

[0080] (1) Extract total genomic DNA from the mycelia of all the samples of *Flammulina velutipes* to be tested;

[0081] (2) Using the total genomic DNA as a template, PCR amplification was performed using primers as described in MNP1 to MNP3;

[0082] (3) Sequencing of each amplification product was performed to obtain sequencing data;

[0083] (4) Based on the sequencing data, determine the genotype of 3 loci in each enoki mushroom sample to be tested. If the genotype corresponding to the 3 loci is a heterozygous sequence, then the enoki mushroom to be tested is the X139 variety; otherwise, the enoki mushroom to be tested is a non-X139 variety.

[0084] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X139 involves using a kit to extract total genomic DNA from all enoki mushroom mycelial samples to be tested.

[0085] In some embodiments, the PCR amplification system in the identification method for the enoki mushroom (Flammulina filiformis) variety X139 includes:

[0086] 0.2 μM 4 μL primer set;

[0087] 20 ng / μL~30 ng / μL DNA template 4 μL;

[0088] GenoPlexs 3×T Master Mix 10μL;

[0089] ddH2O 12μL.

[0090] In some embodiments, the PCR amplification reaction program is as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 20 s, 60°C annealing for 4 min, 15 cycles; 72°C extension for 4 min; 10°C storage.

[0091] In some embodiments, the identification method for the Flammulina filiformis variety X139 uses an Illumina Next Seq550 for sequencing each amplification product.

[0092] One embodiment of this application also provides the application of the enoki mushroom (Flammulina filiformis) variety X139 described in any of the above embodiments in enoki mushroom breeding.

[0093] One embodiment of this application also provides the application of the enoki mushroom (Flammulina filiformis) variety X139 described in any of the above embodiments in food production.

[0094] In this application, the *Flammulina velutipes* variety X139, after factory-scale bottle cultivation, achieved an average yield of 557 g / bottle (1500 mL), higher than its parent varieties X69 (545 g / bottle) and X70 (500 g / bottle). Its growth cycle was 1 day faster than the parent control X69 and 2 days slower than X70. The caps of *Flammulina velutipes* variety X139 are thick, with an average diameter of 6.93 mm, a thickness of 1.64 mm, and a height of 4.30 mm; the stipes have an average diameter of 3.55 mm and a length of 16.55 cm. The fruiting bodies of *Flammulina velutipes* variety X139 are off-white; the caps are normal in size, thick, and inwardly curled, with a mountain-shaped apex in longitudinal section; the stipes are relatively thick, and the fruiting bodies develop uniformly; compared to its parent variety X69, it is less prone to opening its cap, easier to dehumidify, and has a slightly yellowish color; compared to its parent variety X70, the stipes are thicker and more compact. The enoki mushroom variety X139 exhibits excellent traits, meets diverse market demands, and is suitable for year-round bottle cultivation in industrial settings, demonstrating promising application and promotion prospects. The MNP fingerprint spectrum of enoki mushroom variety X139 possesses specificity and particularity for identifying the strain, providing reliable and accurate results. Compared to morphological identification, it offers advantages such as intuitive visualization, minimal error, and immunity to environmental conditions.

[0095] Example 1

[0096] A method for identifying the enoki mushroom variety X139, which uses a molecular fingerprint composed of three specific MNP marker sites for identification, specifically including the following steps:

[0097] Test materials: A total of 216 Enoki mushroom strains were tested, including strain X139, parent strain, and main cultivated variety.

[0098] (1) Mycelial culture: The enoki mushroom strain X139 was transferred to potato dextrose agar (PDA) solid medium and cultured at 19°C for 7 days before mycelial culture was collected.

[0099] (2) Genomic DNA extraction: Genomic DNA was extracted from the hyphae using a kit. The purity of the DNA in the sample was determined using a spectrophotometer. 1 μL of DNA from the sample was taken and its concentration was determined using a Qubit fluorescence quantitative analyzer. The concentration of the sample DNA was adjusted to be between 30 ng / μL and 50 ng / μL.

[0100] (3) Multiplex polymerase chain reaction (PCR): The MNP marker sites of the extracted Flammulina velutipes strain X139 were amplified by multiplex PCR to obtain multiplex PCR amplification products.

[0101] The PCR amplification system consisted of a total volume of 30 μL, including: 4 μL primer set (0.2 μM concentration per primer), 4 μL (20 ng / μL to 30 ng / μL) of sample DNA to be tested, 10 μL GenoPlexs 3×T Master Mix (manufacturer: Shijiazhuang Borui Biotechnology Co., Ltd.), and 12 μL ddH2O. The mixture was shaken and mixed to obtain the solution for multiplex PCR amplification.

[0102] PCR amplification program: 95℃, 3 min; (95℃, 20 s; 60℃, 4 min) × 15 cycles; 72℃, 4 min; store at 10℃. The multiplex PCR amplification products were purified.

[0103] (4) Construction of high-throughput sequencing libraries and sequencing: Perform high-throughput sequencing on the high-throughput sequencing libraries obtained from multiplex PCR amplification according to the operating instructions of the high-throughput sequencing kit and high-throughput sequencer. The average coverage of the high-throughput sequencing was set to be greater than 700-fold, and the sequencing length was not less than 300 bp.

[0104] Add 10 μL GenoPlexs 3×T Master Mix, 2 μL 5 μM P5 primer, 2 μL 5 μM P7 barcode primer (the primers contain the sample barcode) and 16 μL ddH2O to the multiplex PCR amplification product, vortex to mix and centrifuge briefly.

[0105] PCR amplification program: 95℃, 3 min; (95℃, 15 s; 58℃, 15 s; 70℃, 30 s) × 8 cycles; 72℃, 5 min; store at 10℃. The sequencing library was then purified.

[0106] High-throughput sequencing was performed using an Illumina Next Seq550 sequencer to sequence the library and obtain sequencing data for the sample to be tested. For detailed sequencing steps, please refer to the instruction manual of the sequencer.

[0107] (5) Data alignment: The sequencing data of *Flammulina velutipes* strain X139 were homologously aligned to the DNA sequences of MNP marker sites on the *Flammulina velutipes* reference genome, and the average coverage fold of the detected marker sites was statistically analyzed. The genotypes of the detected MNP marker sites were recorded as all detected alleles of that site. The detected alleles refer to the detected DNA fragment consisting of the first to last base of the marker, and different detected alleles are separated by " / ".

[0108] Using Bowtie2 (version 2.1.0) software, the sequencing data of the samples to be tested were aligned to the reference genome of *Flammulina velutipes* to obtain the DNA sequence of the MNP markers for each sample. The alignment results were saved in SAM (The Sequence Alignment / Map format). The three MNP marker sites and primer information for *Flammulina velutipes* variety X139 are shown in Table 1.

[0109] Table 1. List of three MNP marker sites and primer information for Flammulina velutipes variety X139

[0110]

[0111] Multiplex PCR amplification and sequencing were performed on 216 enoki mushroom varieties. The sequencing data showed that at three MNP loci, the genotype corresponding to enoki mushroom variety X139 was heterozygous, while the genotypes for the other varieties were homozygous. This indicates a significant difference in the DNA fingerprinting between enoki mushroom variety X139 and its parents and the main cultivated varieties.

[0112] (6) Calculation of genetic similarity: Based on the principle that different strains of *Flammulina velutipes* are considered to have a difference if there is at least one SNP difference in the alleles of the same MNP marker locus, the number of differentially expressed MNP markers in pairwise comparisons of different *Flammulina velutipes* strains was counted, and marker loci that can significantly distinguish any *Flammulina velutipes* strain were screened based on the differentially expressed MNP marker loci. When the genetic similarity (GS) between the test sample and the control sample is less than 97%, it is determined to be "different strains".

[0113] Genetic similarity GS = n / N × 100%, where N is the number of MNP loci co-amplified by the test strain and the enoki mushroom variety X139, and n is the number of MNP loci with the same genotype among the MNP loci co-amplified by the test strain and the enoki mushroom variety X139. The genetic similarity results between enoki mushroom variety X139 and 215 other strains are shown in Table 2.

[0114] Table 2. Genetic similarity (GS) between enoki mushroom strain X139 and 215 other strains.

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121] As shown in Table 2, the highest genetic similarity of the *Flammulina velutipes* strain X139 with 215 other strains was 90.67%, and the lowest was 0%. Only strains JZG0101 and JZG0209 showed a genetic similarity exceeding 90%. The genetic similarity with the parent strain X69 (test number: JZG221224126) was 84.59%, with X70 (test number: JZG221224127) at 77.78%, and with the main cultivated variety (test number: JZG220608004) at 83.77%. These results indicate significant genetic differences between *Flammulina velutipes* strain X139 and its parent strain, the main cultivated variety, and other *Flammulina velutipes* strains. This demonstrates that the MNP marker locus constructed in this application can effectively identify *Flammulina velutipes* strain X139.

[0122] Example 2

[0123] This embodiment is used for a comparative cultivation experiment of the enoki mushroom variety X139 obtained in Example 1 for industrial production.

[0124] Comparison test strain: X139, the main production variety.

[0125] Test site: Shandong Xuerong Biotechnology Co., Ltd. (hereinafter referred to as Shandong Xuerong Company).

[0126] Experimental setup: The inoculum strains for the experiments were prepared uniformly and cultivated in factory-scale bottle culture (1500mL, 353g (dry material) / bottle) according to the production management methods of Shandong Xuerong Company. Specific cultivation information is shown in Table 3.

[0127] Table 3. Multi-batch variety comparison cultivation experiment

[0128]

[0129] As shown in Table 3, among them:

[0130] (1) The average growth cycle of the enoki mushroom variety X139 is 25.5 days, while the average growth cycle of the main cultivated variety is 26.7 days. The growth cycle of enoki mushroom variety X139 is 1 day shorter than that of the control main cultivated variety.

[0131] (2) The average yield per bottle of enoki mushroom variety X139 was 557.58g, while the average yield per bottle of the main cultivated variety was 545.80g. The average yield per bottle of enoki mushroom variety X139 was 2.16% higher than that of the control main cultivated variety (significant difference).

[0132] (3) In terms of commercial characteristics, the fruiting body cap of the enoki mushroom variety X139 is thicker than that of the main cultivated variety in the control production, the stipe is thicker and more compact than that of the main cultivated variety in the control production, and the cross section after root cutting is slightly yellower than that of the main cultivated variety in the control production.

[0133] The results show that the X139 enoki mushroom variety has excellent overall performance, meets the requirements of the industrialized cultivation and production model of enoki mushrooms and the market quality demand, and has great market potential.

[0134] The enoki mushroom variety X139 and the main production variety underwent multiple cultivation trials, and the results are shown in Table 4.

[0135] Table 4 Results of multiple batch cultivation trials

[0136]

[0137]

[0138] Note: '**' indicates P<0.01, which is highly significant; '*' indicates P<0.05, which is significant; ' / ' indicates no significant difference.

[0139] Example 3

[0140] This embodiment provides a cultivation method for the enoki mushroom variety X139.

[0141] The cultivation method for enoki mushroom variety X139 includes the following steps:

[0142] (1) Ingredients: The cultivation material is accurately measured according to the formula requirements, and the materials are thoroughly mixed. Water is added until the moisture content reaches 67.5%-69.5% and the pH value is 6.5-7.0. The stirring time is adjusted according to seasonal changes to prevent the mixture from becoming rancid. Stirring continues until bottling is completed.

[0143] (2) Bottling: Use 1500mL high-temperature resistant plastic bottles to complete the bottling process on a bottling machine. The bottles should be packed tightly at the top and loosely at the bottom, with a filling difference of less than 50g between bottles. The filling height should be 1cm to 1.5cm from the bottle shoulder, and a hole should be punched in the middle to the bottom of the bottle. The bottle cap should be put on immediately after filling.

[0144] (3) Sterilization: After bottling, high-pressure high-temperature sterilization should be carried out immediately, maintaining 100℃ for 60 minutes, and then raising the temperature to 121℃ and maintaining it for 60 minutes. All microorganisms and spores in the culture medium must be completely killed.

[0145] (4) Cooling: After sterilization, the bottles and baskets are pushed into the cooling room to cool to below 22°C. The cooling room and inoculation room are equipped with purification devices and refrigeration equipment.

[0146] (5) Inoculation: Liquid culture inoculation. The temperature inside the bottle should be controlled below 22℃ during inoculation, and microscopic examination should be used to ensure that the liquid culture is uncontaminated and vigorous before it can be used for inoculation and cultivation. The inoculation volume of liquid culture is 35mL to 37mL of bacterial solution per cultivation bottle, of which the wet weight of mycelium is about 1.15g / 10mL and the viable cell count is about 18300cfu / mL.

[0147] (6) Cultivation: The temperature of the cultivation room is controlled at 16℃~18℃, the humidity is maintained at about 80%, and the CO2 concentration is controlled at 2000ppm~3000ppm. The cultivation time is 20d~22d.

[0148] (7) Scratching: After the cultivation is completed, the fully developed cultivation bottles are scratched with a scratching machine. The scratching depth should be 1cm to 1.5cm. Remove the old mycelium blocks on the surface, keep the substrate surface flat, add water, and then enter the growth chamber for fruiting.

[0149] (8) Fruiting body growth: 7-8 days after mycelium recovery and bud emergence, the temperature is controlled at 14℃-16℃, relative humidity at 95%-100%, CO2 concentration at less than 2000ppm, and no light is required; after bud emergence, the temperature is adjusted according to the growth of the mushroom body, controlled within the range of 4℃-15℃, relative humidity at 85%-95%, CO2 concentration at 2000ppm-8000ppm, and light intensity at 5Lux-20Lux.

[0150] (9) Harvesting and packaging: Harvest when the height of the mushroom body reaches the height of the sleeve paper, the cap is not open, and the diameter of the cap is 0.5cm to 1cm. When harvesting, pick the whole bunch of enoki mushrooms, cut off the bottom culture medium with a knife, pack them and put them into a cold storage. The temperature of the cold storage is controlled at 3℃ to 5℃.

[0151] In the above embodiments, the descriptions of each embodiment have different focuses. For parts not described in detail in a certain embodiment, please refer to the relevant descriptions in other embodiments.

[0152] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0153] The above-described embodiments are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A mushroom of the species Flammulina velutipes Flammulina filiformis X139, characterized in that The strain was deposited in China General Microbiological Culture Collection Center on June 6, 2025, and the deposit number is: CGMCC No. 42023.

2. The mushroom according to claim 1 Flammulina filiformis X139, characterized in that The enoki mushroom Flammulina filiformis X139 has the characteristics of short growth cycle, no early opening of cap, high humidity affinity, and thick stem.

3. The Flammulina velutipes of claim 1 or 2 Flammulina filiformis A method for identifying X139, characterized by, The identification method adopts a molecular fingerprint composed of 3 specific MNP marker sites, and the primer sequences of the 3 specific MNP marker sites are as follows: Forward primer of MNP 1 SEQ ID NO. 1: TTGATTTCTGGTGCATTCCTTATGG; Reverse primer of MNP 1 SEQ ID NO. 2: CAGCGGAATGTCTTATCAACGAAAT; Forward primer of MNP 2 SEQ ID NO. 3: CTATGCCGATAATGCCAAAAACCAT; Reverse primer of MNP 2 SEQ ID NO. 4: ACACAGACAGATAGTACTCTGGAAC; Forward primer of MNP 3 SEQ ID NO. 5: GCGAGGTGTATATATGTAGACGTGA; Reverse primer of MNP 3 SEQ ID NO. 6: CGGAGTATCATAGTTTACTGACGCT; Specifically comprising the following steps: (1) Extracting total genomic DNA of mycelium of all to-be-tested Pholiota nameko samples; (2) Using the total genomic DNA as a template, PCR amplification is performed using the primers as described in MNP 1-MNP 3; (3) Sequencing each amplification product to obtain sequencing data; (4) Determining the genotype of 3 specific MNP marker sites in each to-be-tested Pholiota nameko sample based on the sequencing data; (5) Calculating genetic similarity: based on the principle that at least 1 SNP on the same MNP marker site allele in different Pholiota nameko strains is different, the number of different MNP markers in pairwise comparison of different Pholiota nameko strains is counted, and the marker site that can significantly distinguish any Pholiota nameko strain is screened according to the different MNP marker sites. If the genetic similarity GS between the to-be-tested strain and Pholiota nameko X139 is less than 97%, it is determined to be "different strains", otherwise, it is determined to be "same strain"; Genetic similarity GS = n / N x 100%, wherein N is the number of MNP sites commonly amplified from the to-be-tested strain and Pholiota nameko X139, and n is the number of MNP sites with the same genotype in the MNP sites commonly amplified from the to-be-tested strain and Pholiota nameko X139.

4. The mushroom according to claim 3 Flammulina filiformis A method for identifying X139, characterized by, In step (1), a kit is used to extract total genomic DNA of mycelium of all to-be-tested Pholiota nameko samples.

5. The mushroom according to claim 3 Flammulina filiformis A method for identifying X139, characterized by, In step (2), the PCR amplification system comprises: 0.2 μM 4 μL primer set; 20 ng / μL~30 ng / μL DNA template 4 μL; GenoPlexs 3×T Master Mix 10 μL; ddH2O 12 μL; PCR amplification reaction program: 95 ℃ pre-denaturation 3 min; 95 ℃ denaturation 20 s, 60 ℃ annealing 4 min, 15 cycles; 72 ℃ extension 4 min; 10 ℃ preservation.

6. The mushroom according to any one of claims 3 to 5 Flammulina filiformis A method for identifying X139, characterized by, In step (3), Illumina Next Seq550 was used for sequencing when each amplification product was sequenced.

7. The Flammulina mellea according to claim 1 or 2 Flammulina filiformis X139 for use in breeding Flammulina mellea.

8. The Flammulina mellea according to claim 1 or 2 Flammulina filiformis Flammulina filiformis Use of X139 in food production.

Images