Paenibacillus mucilaginosus and application thereof

Abstract

The invention provides paenibacillus mucilaginosus and application of the paenibacillus mucilaginosus, the paenibacillus mucilaginosus is preserved in China General Microbiological Culture Collection Center (CGMCC) on February 8, 2025, and the preservation number is CGMCC No.33505. The paenibacillus mucilaginosus is named as paenibacillus mucilaginosus. The paenibacillus mucilaginosus disclosed by the invention has excellent phosphorus and potassium solubilizing capability, effectively promotes crop growth and improves the crop yield. Meanwhile, ginger blast and root rot of the ginger can be prevented and treated, growth of pathogenic bacteria of the ginger is inhibited, ginger diseases are prevented and treated, growth promotion and bacteriostasis are achieved, dependence of the ginger on chemical pesticides is reduced, the effect is improved, and the yield of the ginger is increased.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural microorganisms, in particular to a strain of Paenibacillus mucilaginosus LY6-1 and its application in soil improvement and microbial fertilizer. Background Art

[0002] Phosphorus and potassium are essential nutrients for plant growth. However, phosphorus in the soil mainly exists in the form of phosphate minerals such as calcium phosphate and iron phosphate, while potassium mainly exists in the form of silicate minerals such as feldspar and mica. These mineral structures are stable, and phosphorus and potassium are difficult to dissolve, making it difficult for crops to directly use them, which affects yield and quality.

[0003] The application of chemical fertilizers can, to some extent, compensate for deficiencies in soil phosphorus and potassium, but their utilization rate is generally less than 30%. Long-term application can lead to soil nutrient imbalances, resulting in a range of problems such as soil compaction or salinization, and water eutrophication. Therefore, finding a solution that can both increase the availability of soil phosphorus and potassium while reducing reliance on chemical fertilizers has become a key issue in modern agricultural development.

[0004] As an environmentally friendly microorganism, Paenibacillus gelatinosa can secrete substances such as citric acid, oxalic acid, phosphatase, and phytase to release fixed phosphorus and potassium from the soil, altering the pH and redox potential of the rhizosphere and promoting plant absorption of phosphorus and potassium. Furthermore, Paenibacillus gelatinosa also possesses a strong biocontrol effect. The lipopeptide antibiotics it secretes can disrupt the permeability of pathogenic fungal cell membranes, and the chitinase it produces can degrade fungal cell wall components, significantly reducing the incidence of soil-borne diseases. Paenibacillus gelatinosa can also form a biological barrier in the rhizosphere through competitive colonization, inhibiting the invasion of pathogens such as Ralstonia solanacearum, activating plant systemic resistance (SAR), and upregulating the expression of defense proteins, achieving a dual synergistic effect of "growth promotion and antibacterial control" and reducing crops' dependence on chemical pesticides.

[0005] How to obtain jelly-like Bacillus with excellent performance and more fully explore the application of jelly-like Bacillus in soil and crops requires further exploration. Summary of the Invention

[0006] The purpose of the present invention is to solve one of the technical problems in the related art to a certain extent at least, and to provide a jelly-like bacillus, a microbial agent, a composite microbial agent, a microbial fertilizer and their use in soil phosphorus and potassium solubilization and disease resistance.

[0007] The first aspect of the present invention provides a jelly-like Paenibacillus LY6-1, whose Latin name is Paenibacillus mucilaginosus, which was deposited in the General Microbiology Center of the China Culture Collection of Microorganisms on February 8, 2025, with a deposit number of CGMCC No. 33505, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] According to an embodiment of the present invention, the Paenibacillus gelatinosa has a 16S rRNA sequence as shown in SEQ ID NO: 1.

[0009] The second aspect of the present invention provides a microbial agent, which comprises the jelly-like Paenibacillus described in the first aspect. The effective viable count of the jelly-like Paenibacillus in the microbial agent is at least 2.0×10 8 CFU / g.

[0010] According to an embodiment of the present invention, the preparation method of the microbial agent comprises: subjecting the strain to liquid fermentation culture, collecting the fermentation liquid and spray drying the liquid. The microbial agent is in powder or granular form.

[0011] The third aspect of the present invention provides a composite microbial agent, comprising a first microbial agent and a second microbial agent, wherein the first microbial agent is the microbial agent described in the second aspect of the present invention, and the second microbial agent comprises at least one selected from Bacillus megaterium, Brevibacillus laterosporus, Bacillus amyloliquefaciens, and Bacillus polymyxa.

[0012] According to an embodiment of the present invention, the composite microbial agent includes 10 to 50 parts by weight of the first microbial agent and 10 to 50 parts by weight of the second microbial agent; wherein the second microbial agent is selected from at least one of the following:

[0013] 10-30 parts by weight of Bacillus megaterium;

[0014] 10-30 parts by weight of Brevibacillus laterosporus;

[0015] 10-30 parts by weight of Bacillus amyloliquefaciens;

[0016] 10 to 30 parts by weight of Bacillus polymyxa.

[0017] According to an embodiment of the present invention, the effective viable bacteria count of the jelly-like Paenibacillus in the composite bacterial agent is at least 2×10 8 CFU / g, and at least one of the following conditions is met:

[0018] The effective viable cell count of Bacillus megaterium is at least 5×109 CFU / g;

[0019] The effective viable count of Brevibacillus laterosporus is at least 5×10 9 CFU / g;

[0020] The effective viable count of Bacillus amyloliquefaciens is at least 5×10 10 CFU / g;

[0021] The effective viable count of Bacillus polymyxa is at least 5×10 8 CFU / g.

[0022] The fourth aspect of the present invention provides a microbial fertilizer, which includes the jelly-like Paenibacillus described in the first aspect of the present invention, or the microbial agent described in the second aspect of the present invention, or the composite bacterial agent described in the third aspect of the present invention.

[0023] According to an embodiment of the present invention, the microbial fertilizer is a solid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 2.5×10 7 CFU / g.

[0024] According to an embodiment of the present invention, the microbial fertilizer is a liquid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 6.0×10 7 CFU / mL;

[0025] According to an embodiment of the present invention, the microbial fertilizer further includes a basic fertilizer, and the basic fertilizer includes at least one selected from compound fertilizers, water-soluble fertilizers, organic fertilizers, and organic-inorganic fertilizers.

[0026] The fifth aspect of the present invention provides a method for solubilizing phosphate and potassium in soil, comprising: applying jelly-like Bacillus, a microbial agent, a composite agent or a microbial fertilizer to the soil, wherein the jelly-like Bacillus is the jelly-like Bacillus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0027] The sixth aspect of the present invention provides a method for fertilizing crops, comprising: applying jelly-like Bacillus, a microbial agent, a composite agent or a microbial fertilizer to the crops, wherein the jelly-like Bacillus is the jelly-like Bacillus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0028] According to an embodiment of the present invention, the crop is selected from at least one of wheat, corn, cucumber and ginger.

[0029] The seventh aspect of the present invention provides a method for inhibiting the growth of ginger pathogens, preventing and controlling ginger diseases, or increasing ginger yield, comprising: applying an effective amount of jelly-like Bacillus, a microbial agent, a composite agent, or a microbial fertilizer to the soil where ginger is planted, wherein the jelly-like Bacillus is the jelly-like Bacillus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0030] According to an embodiment of the present invention, the ginger pathogens include Pseudomonas solanacearum and Pythium spp.; the ginger diseases include ginger wilt and root rot.

[0031] The present invention screened out the excellent performance of the jelly-like Paenibacillus LY6-1 (deposit number: CGMCC No. 33505), which has excellent phosphorus and potassium solubilization capabilities. The soluble phosphorus increment reaches 112.48 mg / L, a 60.69% increase over the 70 mg / L specified in NY / T 1847-2010; the relative increment of available potassium reaches 68.83%, a 244.15% increase over the 20% specified in NY 882-2004. This effectively promotes crop growth and increases crop yield. Furthermore, the jelly-like Paenibacillus LY6-1 can prevent and control ginger wilt and root rot, inhibit the growth of ginger pathogens, and prevent ginger diseases, achieving a dual "growth promotion and antibacterial" effect, reducing ginger's dependence on chemical pesticides and increasing ginger yield.

[0032] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention.

[0033] Collection information:

[0034] Strain name: Paenibacillus mucilaginosus

[0035] Deposit date: February 8, 2025

[0036] Depository: General Microbiology Center of China Culture Collection Administration

[0037] Deposit number: CGMCC No.33505 BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0039] Figure 1 A photograph of a plate showing the colony morphology of strain LY6-1;

[0040] Figure 2 Gram-stained photographs of strain LY6-1 are shown;

[0041] Figure 3 The phylogenetic tree of strain LY6-1 constructed based on the 16srRNA gene sequence is shown;

[0042] Figure 4 Shows the results of the determination of the phosphorus and potassium solubilization ability of strain LY6-1 DETAILED DESCRIPTION

[0043] Below with reference to embodiment, the scheme of the present invention will be explained.It will be appreciated by those skilled in the art that the following examples are merely illustrative of the present invention and should not be regarded as limitations of the elements of the embodiments of the present invention, nor should they be regarded as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used that do not indicate manufacturers are conventional products that can be obtained commercially.

[0044] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0045] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0046] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present invention belongs.

[0047] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0048] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0049] The first aspect of the present invention provides a microorganism. According to an embodiment of the present invention, the microorganism is Paenibacillus mucilaginosus, named LY6-1, and deposited in the General Microbiology Center of the China Culture Collection Administration on February 8, 2024, with a deposit number of CGMCC No. 33505. The jelly-like Paenibacillus was isolated and screened from wheat field soil in Meibu Street, Hedong District, Linyi City, Shandong Province. The pure strain was obtained by gradient dilution separation. The strain was identified as jelly-like Paenibacillus by analysis of morphological characteristics, physiological and biochemical characteristics, and molecular biological characteristics.

[0050] According to an embodiment of the present invention, the jelly-like Paenibacillus LY6-1 microorganism has moist, translucent colonies, neat edges, droplet-like protrusions on the surface, a viscous texture, is Gram-positive, has short rod-shaped cells, and can produce transparent spores. The microorganism has the 16S rRNA sequence shown in SEQ ID NO: 1.

[0051] A second aspect of the present invention provides a microbial agent comprising the Paenibacillus jelly-like LY6-1 described in the first aspect. According to embodiments of the present invention, the Paenibacillus jelly-like or microbial agent of the present invention has a phosphate solubilizing capacity of 112.48 mg / L, which is 60.69% higher than that specified in NY / T 1847-2010. The Paenibacillus jelly-like or microbial agent of the present invention has a potassium solubilizing capacity of 68.83%, which is 244.15% higher than that specified in NY 882-2004.

[0052] The third aspect of the present invention provides a composite microbial agent, comprising a first microbial agent and a second microbial agent, wherein the first microbial agent is the microbial agent described in the second aspect of the present invention, and the second microbial agent comprises at least one selected from Bacillus megaterium, Brevibacillus laterosporus, Bacillus amyloliquefaciens, and Bacillus polymyxa.

[0053] According to an embodiment of the present invention, the first microbial agent of the present invention is obtained by the following steps:

[0054] performing liquid fermentation culture on the jelly-like Paenibacillus to obtain a fermentation liquid;

[0055] The fermentation broth is spray-dried to obtain the microbial agent.

[0056] The microbial agent is in dry powder form, and the effective viable bacteria count of jelly-like Paenibacillus per gram of the microbial agent is at least 2×10 8 CFU.

[0057] In at least some embodiments, the composite bacterial agent includes 10 to 50 parts by weight of the first microbial agent and at least one selected from the following: 10 to 30 parts by weight of Bacillus megaterium; 10 to 30 parts by weight of Brevibacillus laterosporus; 10 to 30 parts by weight of Bacillus amyloliquefaciens; and 10 to 30 parts by weight of Bacillus polymyxa.

[0058] In at least some embodiments, the effective viable count of Paenibacillus jelly in the composite bacterial agent is at least 2×10 8 CFU / g, and at least one of the following conditions is met: the effective viable count of Bacillus megaterium is at least 5×10 9 CFU / g; the effective viable count of Brevibacillus laterosporus is at least 5×10 9 CFU / g; the effective viable count of Bacillus amyloliquefaciens is at least 5×10 10 CFU / g; the effective viable count of Bacillus polymyxa is at least 5×10 8 CFU / g.

[0059] The fourth aspect of the present invention provides a microbial fertilizer, which includes the above-mentioned Paenibacillus jelly-like, or the above-mentioned microbial agent, or the above-mentioned composite agent.

[0060] In some embodiments, the microbial fertilizer is a solid fertilizer, and the number of effective viable microorganisms contained in the microbial fertilizer is at least 2.5×10 7 CFU / g; Optionally, the microbial fertilizer is a liquid fertilizer, and the number of effective viable microorganisms contained in the microbial fertilizer is at least 6.0×10 7 CFU / mL;

[0061] The microbial fertilizer further includes at least one of the following basic fertilizers: at least one of compound fertilizers, water-soluble fertilizers, organic fertilizers, and organic-inorganic fertilizers.

[0062] The fifth aspect of the present invention provides a method for fertilizing crops, comprising: applying an effective amount of jelly-like Bacillus, a microbial agent, a composite agent, or a microbial fertilizer to the crops, wherein the jelly-like Bacillus is the jelly-like Bacillus described in the first aspect, the microbial agent is the microbial agent described in the second aspect, the composite agent is the composite agent described in the third aspect, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect. By treating the crops in the soil, it can increase production, promote growth, and increase income, especially for wheat, corn, cucumber, and ginger. For example, the composite agent applied to cucumbers increased the average taproot length by 27.77%, the average germ length by 30.40%, and the average fresh weight by 35.85% compared with CK; the microbial fertilizer applied to wheat increased the number of ears per mu by 9.15% and the yield per mu by 8.18% compared with the conventional humic acid organic and inorganic fertilizer 15-15-15.

[0063] The sixth aspect of the present invention provides a method for inhibiting the growth of ginger pathogens, preventing and controlling ginger diseases, or increasing ginger yield, comprising: applying an effective amount of jelly-like Bacillus, a microbial agent, a composite agent, or a microbial fertilizer to the soil where ginger is planted, wherein the jelly-like Bacillus is the jelly-like Bacillus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0064] According to an embodiment of the present invention, the ginger pathogens include Pseudomonas solanacearum and Pythium spp., and the ginger diseases include ginger wilt and root rot. For example, compared with conventional ginger cultivation, the composite microbial inoculant applied to ginger reduced the incidence of ginger wilt by 33.7%, the incidence of root rot by 28.23%, and increased per-acre yield by 25.51%.

[0065] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.

[0066] Example 1 Isolation and Screening of Jelly-like Paenibacillus LY6-1

[0067] From the collected soil samples, the jelly-like Paenibacillus LY6-1 was isolated by the plate spreading method and the plate streak method, which specifically includes the following steps:

[0068] Soil samples were collected from wheat fields in Meibu Street, Hedong District, Linyi City, Shandong Province, using a five-point sampling method. Ten soil samples were collected, each weighing about 20 g, and placed in sterile sampling bags. After thoroughly mixing the soil samples, 10 g was placed in 90 mL of sterile water and shaken at 30°C and 180 rpm for 30 min. The upper suspension was diluted with sterile water to a gradient of 10. -5 Gradient. Add 0.1 mL of each dilution from the gradient to solid silicate bacterial culture medium and spread evenly. Set up three replicates for each concentration. After incubation at 30°C for 4 days, select strains with different colony morphologies and streak them onto silicate bacterial agar medium for purification. Observe colony growth regularly. Regenerated colonies are purified once again using the same method to obtain pure strain LY6-1, which is then stored at 4°C for future use.

[0069] Example 2 Identification of Paenibacillus jelly LY6-1

[0070] Example 2 The pure strain LY6-1 obtained in the present invention was identified by its morphological, physiological and biochemical, and molecular biological characteristics. Specific characteristics are as follows:

[0071] (1) Morphological characteristics:

[0072] The colony is moist, translucent, with neat edges, droplet-shaped protrusions on the surface, and a sticky texture. Figure 1 As shown; Gram staining is positive, the bacteria are short rod-shaped, and can produce transparent spores, such as Figure 2 shown.

[0073] (2) Physiological and biochemical characteristics:

[0074] The fatty acid composition of strain LY6-1 was tested using the Microbial Fatty Acid Rapid Identification System (MIDI). It was found that the major fatty acids of strain LY6-1 screened by the present invention were C15:0anteiso, C16:0, C16:1ω11c, and C16:0iso, with contents of 43.52%, 15.53%, 7.73%, and 5.35%, respectively. The results for specific fatty acids are shown in Table 1. The results indicate that strain LY6-1 conforms to the major cellular fatty acid profile of Paenibacillus.

[0075] Table 1 Fatty acid data of strain LY6-1

[0076]

[0077]

[0078] The carbohydrate metabolism ability of strain LY6-1 was tested by API 50CH, as shown in Table 2. The results showed that strain LY6-1 met the carbohydrate metabolism characteristics of Paenibacillus.

[0079] Table 2 API 50CH test data of strain LY6-1

[0080]

[0081]

[0082] Note: +, positive; -, negative; W, weakly positive.

[0083] (3) Molecular biological characteristics:

[0084] The 16S rRNA gene sequence (1407 bp) and phylogenetic tree analysis results of strain LY6-1 are as follows:

[0085] The 16S rRNA gene sequence was determined using bacterial 16S rRNA gene universal primers 27F and 1492R to obtain a 1407 bp gene fragment:

[0086] TCGACGGCTGGCTCCCTTACGGTTACCCCACCGGCTTCGGGTGTTGTAAACTCTCGTGGTTGACGGGCGGTGTGTA

[0087] CAAGACCCGGGAACGTATTCACCGCGGCATGCTGATCCGCGATTACTAGCAATTCCGACTTCATGCAGGCGAGTTGCA

[0088] GCCTGCAATCCGAACTGAGACCGGCTTCTAAGGATTCGCTCCATCTCGCGACTTCGCTTCCCGTTGTACCGGCATTG

[0089] TAGTACGTGTGTAGCCCAGGTCATAAGGGGCATGATGATTTGACGTCATCCCCACCTTCCTCCGGGTTTGTCACCGGCA

[0090] GTCACTCTAGAGTGCCCAACTCAATGCTGGCAACTAAAGTCAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATCT

[0091] CACGACACGAGCTGACGACAACCATGCACCACCTGTCACCTCTGTCCCGAAGGAGGGCCCTATCTCTAGGGCTTTCAG

[0092] AGGGATGTCAAGACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATACTCCACTGCTTGTGCGGGTCCCCG

[0093] TCAATTCCTTTGAGTTTCACTCTTGCGAGCGTACTCCCCAGGCGGAGTGCTTATTGTGTTTACTTCGGCACCAAGGGT

[0094] ATCGAAACCCCTAACACCTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGC

[0095] TTTCGCGCCTCAGCGTCAGTTACAGTCCAGAAAGCCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCAC

[0096] CGCTACACGTGGAATTCCGCTTTCCTCTCCTGCACTCAAGTCTTCCAGTTTCCGGTGCGAACCGGGGTTGAGCCCCGG

[0097] GCTTAAACACCAGACTTAAAAGACCGCCTGCGCGCGCTTTACGCCCAATAATTCCGGACAACGCTTGCCCCCTACGTA

[0098] TTACCGCGGCTGCTGGCACGTAGTTAGCCGGGGCTTTCTTCTCAGGTACCGTCATTCGCAGAGCAGTTACTCTCCACG

[0099] ACATTCTTCCCTGGCAACAGAGCTTTACGATCCGAAAACCTTCATCACTCACGCGGCGTTGCTCCGTCAGGCTTGCGC

[0100] CCATTGCGGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCT

[0101] CTCAGGTCGGCTACGCATCGTCGCCTTGGTGGGCCATTACCCCGCCAACTAGCTAATGCGCCGCAGGCCCATCCGTAA

[0102] GCCACAGGTTGCCCCGTGTTTCATGATTCCGGCATGCACCGAAACCAGCTATCCGGTCTTAGCTACCGTTTCCGGTAG

[0103] TTATCCCGATCTTACAGGCAGGTTGCCTACGTGTTACTCACCCGTCCGCCGCTAAGCACCGAAGTGCTCCGCTCGACTTGC (SEQ ID NO: 1)

[0104] The 16S rRNA sequence of strain LY6-1 was subjected to BLAST analysis in NCBI to construct a phylogenetic tree. Figure 3 The results showed that strain LY6-1 and Paenibacillus mucilaginosus VKPM B-7519 T Clustered into the same branch with 100% support.

[0105] In summary, through the above morphological characteristics, physiological and biochemical properties and molecular biological identification analysis of strain LY6-1, strain LY6-1 was identified as Paenibacillus mucilaginosus.

[0106] Example 3 Determination of Phosphate and Potassium Solubilization Capacity of Paenibacillus ly6-1

[0107] (1) Determination of phosphorus and potassium solubilization effect. According to "NY / T 1847-2010 General Technical Requirements for Quality Evaluation of Microbial Fertilizer Production Strains" (abbreviated as "NY / T 1847-2010"), "NY 882-2004 Silicate Bacteria"

[0108] The ability of strain LY6-1 to solubilize insoluble phosphorus and mineral potassium was determined according to the method described in NY 882-2004.

[0109] Prepare activation medium: starch 5.0 g, yeast extract 1.0 g, K2HPO4 2.0 g, MgSO4·7H2O 0.5 g, CaCO3 0.1 g, FeCl3·6H2O 0.005 g, distilled water 1000 mL, pH 8.0; phosphate solubilization medium: glucose 10.0 g, AlPO4 10.0 g, (NH4)2SO4 0.5 g, MgSO·7H2O 0.3 g, NaCl 0.3 g, KCl 0.3 g, FeSO4·H2O0.036 g, MnSO4·H2O 0.03 g, distilled water 1.0 L, рH 7.0; potassium solubilization medium: sucrose 10 g.0, MgSO4·7H2O 0.5 g, (NH4)2·SO4 0.2 g, NaCl 0.1 g, CaCO3 0.1, potassium feldspar powder 5.0g, distilled water 1.0L, pH 7.2.

[0110] Fermentation culture of the strain to be tested: strain LY6-1 was inoculated into the activation medium and activated for 5 days. The number of viable bacteria was determined and the number of viable bacteria in the culture medium was adjusted to 2×10 8 5 mL of activated bacterial solution was respectively inoculated into 95 mL of sterile phosphate-solubilizing medium and potassium-solubilizing medium. At the same time, blank treatment groups CK1 and CK2 and a control group of phosphate-solubilizing and potassium-solubilizing medium were set up. The blank treatment group was added with equal amount of sterilized LY6-1 activated bacterial solution, the phosphate-solubilizing control group was added with equal number of viable bacteria and equal volume of strain A (Bacillus subtilis, deposit number CGMCC No. 21826, self-screened strain) with phosphate-solubilizing ability, and the potassium-solubilizing control group was added with equal number of viable bacteria and equal volume of strain B (Bacillus megaterium, deposit number CGMCC No. 21828, self-screened strain) with potassium-solubilizing ability. After culturing at 28°C and 150 r / min for 7 days, soluble phosphorus and available potassium were determined, respectively.

[0111] (2) Results of the determination of LY6-1's ability to solubilize phosphorus and potassium

[0112] The results of the determination of LY6-1's ability to dissolve phosphorus and potassium are as follows: Figure 4 The results showed that strain LY6-1 had the best ability to solubilize both phosphorus and potassium. The increase in soluble phosphorus reached 112.48 mg / L, a 60.69% increase over the 70 mg / L in NY / T 1847-2010 and a 41.11% increase over strain A. The relative increase in available potassium reached 68.83%, a 244.15% increase over the 20% in NY 882-2004 and a 94.33% increase over strain B.

[0113] Example 4 Preparation and Application of Composite Bacterial Agent

[0114] Example 4 provides a composite bacterial agent, and the specific preparation and application methods are as follows:

[0115] (1) Preparation of seed solution: Select the jelly-like Paenibacillus LY6-1 and inoculate it into 300 mL and 2000 mL of sterile silicate bacterial culture medium respectively. Carry out secondary amplification culture at 30°C and 200 r / min for later use.

[0116] (2) Liquid fermentation. The seed liquid was sequentially transferred into a 50-500 L fermentation tank and subjected to secondary liquid fermentation at 30°C and 500 r / min. The formula of the fermentation medium (in mass percentage) was as follows: 5% corn starch, 3% soybean meal, 0.5% calcium carbonate, 0.2% glucose, 0.1% potassium dihydrogen phosphate, 0.1% dipotassium hydrogen phosphate, 0.05% magnesium sulfate, 0.02% manganese sulfate, pH 8.0.

[0117] (3) Spray drying: The fermentation liquid was mixed with diatomaceous earth and light calcium carbonate and then spray dried to obtain an effective viable bacterial count of 1×10 9 CFU / g powdered jelly-like Paenibacillus LY6-1 microbial agent.

[0118] (4) Preparation and application of composite microbial agents. According to the preparation process of LY6-1 microbial agent, the corresponding culture medium formula and fermentation conditions were used to prepare Bacillus megaterium agents (preservation number CGMCC No. 21828, effective viable count of 2×10 10 CFU / g), Brevibacillus laterosporus agent (deposit number CGMCC No.33504, effective viable count 1×10 10 CFU / g), Bacillus amyloliquefaciens agent (preservation number CGMCC No.17841, effective viable count of 8×10 10 CFU / g). The above-mentioned microbial agents were mixed in a mass ratio of 1:1:1 to obtain a composite agent. The composite agent obtained above was used to promote the growth of cucumber in a plate test. The test set up 5 treatments, namely CK blank treatment, T1 composite agent (jelly-like Bacillus + Bacillus megaterium + Brevibacillus laterosporus, mass ratio of 1:1:1), T2 composite agent (jelly-like Bacillus + Bacillus megaterium + Bacillus amyloliquefaciens, mass ratio of 1:1:1), T3 composite agent (jelly-like Bacillus + Brevibacillus laterosporus + Bacillus amyloliquefaciens, mass ratio of 1:1:1), T4 composite agent (Bacillus megaterium + Brevibacillus laterosporus + Bacillus amyloliquefaciens, mass ratio of 1:1:1), and each composite agent was diluted with physiological saline to 1×10 7CFU / mL. Sterile filter paper was placed at the bottom of each 9mm test dish. Six cucumber seeds that had been soaked in 75% ethanol for 2 minutes, 2% sodium hypochlorite for 2 minutes, and then washed 5 times with sterile water were placed on the filter paper. 5 mL of the above-mentioned concentration of 1×10 7 CFU / mL of composite bacterial agent solution and sterile water, with 3 replicates for each treatment. After culturing at 30℃ for 5 days, the development of seed roots, embryos, etc. was observed and counted.

[0119] The results of the cucumber growth promotion test with the composite microbial agent are shown in Table 3.

[0120] Table 3 Results of the test on the growth promotion of cucumber by composite microbial agent

[0121] Treatment group Average taproot length (cm) Average germ length (cm) Average fresh weight (g) CK 6.2 5.0 0.159 T1 7.42 6.0 0.212 T2 7.66 5.66 0.188 T3 7.92 6.52 0.216 T4 6.35 5.21 0.166

[0122] The results showed that the composite inoculant containing Paenibacillus gelatinosa treatments T1, T2, and T3 all significantly promoted cucumber growth, and the growth-promoting effects were greater than those of treatment T4, which did not contain Paenibacillus gelatinosa. Among them, treatment T3 had the highest growth-promoting effect, with average taproot length increasing by 27.74%, average germ length increasing by 30.40%, and average fresh weight increasing by 35.85% compared to CK. Compared to T4, treatment T3 increased average taproot length by 24.72%, average germ length by 25.14%, and average fresh weight by 30.12%, demonstrating a significant growth-promoting effect.

[0123] Example 5 Preparation and Application of Microbial Fertilizer

[0124] Example 5 provides a microbial fertilizer, and the specific preparation and application methods are as follows:

[0125] (1) Preparation of microbial fertilizer

[0126] During the coating process of compound fertilizer, the solid composite bacterial agents T1, T3, and T4 prepared in Example 4 were added to the nitro-sulfur based compound fertilizer (15-5-25) and the humic acid type organic and inorganic fertilizer (15-15-15) at a mass ratio of 1-5‰, respectively, and the actual effective viable bacterial count was about 4×10 7 The results of the test on the number of viable bacteria in the microbial fertilizer are shown in Table 4.

[0127] Table 4 Number of viable bacteria of microbial fertilizer

[0128]

[0129] (2) Application of microbial fertilizers

[0130] The microbial fertilizer prepared in Example 5 was subjected to a field application effect test on wheat. The test field was located in Huaishang District, Bengbu, Anhui Province. The test set up a control group CK1 (nitro-sulfur based compound fertilizer 15-5-25), a treatment group T1-1 (jelly-like Paenibacillus + Bacillus megaterium + Brevibacillus laterosporus + nitro-sulfur based compound fertilizer 15-5-25), a treatment group T1-3 (jelly-like Paenibacillus + Brevibacillus laterosporus + Bacillus amyloliquefaciens + nitro-sulfur based compound fertilizer 15-5-25), and a treatment group T1-4 (Bacillus megaterium + Brevibacillus laterosporus + Bacillus amyloliquefaciens + nitro-sulfur based compound fertilizer 15-5-25); a control group CK2 (humic acid organic and inorganic fertilizer 15-15-15 Eight experimental groups were tested, each with three plots of 60 m2 each. All experimental treatments were applied to the soil as base fertilizer at a rate of 50 kg / mu. The application method was broadcasting followed by machine plowing. The wheat was sown and managed uniformly according to conventional methods. The experimental results for each treatment group were summarized in Table 5, as shown in the following table:

[0131] Table 5 Wheat field test results of microbial fertilizer

[0132]

[0133] The experimental results showed that microbial fertilizers containing Paenibacillus gelatinosa LY6-1 significantly increased wheat spike number and yield per mu compared to the control group, and both increases were higher than those without Paenibacillus gelatinosa. Treatment T2-1, which included Paenibacillus gelatinosa + Bacillus megaterium + Brevibacillus laterosporus + a humic acid organic-inorganic fertilizer (15-15-15), showed the highest increases in spike number and yield per mu, reaching 9.15% and 8.18%, respectively. Treatment T2-4, a compound microbial fertilizer without Paenibacillus gelatinosa, increased spike number and yield per mu by 3.65% and 2.21%, respectively, significantly exceeding those of T2-1. Furthermore, among the nitric-sulfur compound microbial fertilizers, treatment T1-3, containing Paenibacillus gelatinosa, also significantly increased spike number and yield per mu compared to treatment T1-4, which did not contain Paenibacillus gelatinosa.

[0134] Example 6 Preparation and Application of Ginger Disease Prevention Composite Bacterial Agent

[0135] Example 6 provides a composite bacterial agent, the specific preparation and application methods are as follows:

[0136] (1) Liquid fermentation. The jelly-like Paenibacillus sp. LY6-1 was selected and inoculated into 500 mL and 5000 mL of secondary sterile silicate bacterial culture medium, respectively. After incubation at 32°C and 180 r / min, the culture medium was inoculated into 50 L and 500 L fermenters, respectively. Secondary liquid fermentation was carried out at 32°C and 500 r / min. The formula of the fermentation medium (in mass percentage) was as follows: 4% corn starch, 3.5% soybean meal, 0.3% calcium carbonate, 0.5% glucose, 0.15% potassium dihydrogen phosphate, 0.15% dipotassium hydrogen phosphate, 0.1% magnesium sulfate, 0.01% manganese sulfate, pH 8.0.

[0137] (2) Spray drying. The fermentation broth was spray dried to obtain an effective viable bacterial count of 1.8×10 9 CFU / g powdered microbial agent.

[0138] (3) Preparation of composite microbial agents. According to the preparation process of LY6-1 microbial agent, the corresponding culture medium formula and fermentation conditions were used to prepare Bacillus amyloliquefaciens agent (preservation number CGMCC No. 17841, effective viable cell count of 1×10 11 CFU / g), Bacillus polymyxa agent LY37 (effective viable count of 2.5×10 9 CFU / g), Bacillus amyloliquefaciens and Bacillus polymyxa are functional strains independently screened by Sinochem Agriculture (Linyi) R&D Center Co., Ltd. The LY6-1 microbial agent, Bacillus amyloliquefaciens, and Bacillus polymyxa microbial agents were mixed at a mass ratio of 1:1:1 to obtain a composite agent. The Bacillus amyloliquefaciens and Bacillus polymyxa agents were mixed at a mass ratio of 1:1.7 to obtain a control agent with the same effective viable cell count as the composite agent.

[0139] (4) Application of compound microbial agent. The field effect of the compound microbial agent was verified and ginger was planted in Xujiahu Town, Yishui County, Linyi City, Shandong Province. The experiment set up 4 treatment groups, namely control group 1, control group 2, control group 3 and experimental group. Each group was arranged with 3 plots, each plot was 50m 2 Control group 1 was conventional planting without the application of microbial agents; control group 2 was the application of microbial agents purchased from the market (brand: Haoduobang, trade name: Jiangwenqing, active ingredients: Bacillus subtilis + Bacillus jelly, effective viable count ≥ 5 × 10 8CFU / g) after planting; control group 3 was treated with the aforementioned control inoculant after planting; and the experimental group was treated with the aforementioned composite inoculant containing the LY6-1 strain after planting. The commercial inoculant was applied at a dosage of 500g / mu. The control and composite inoculants were applied at the same dosage as the commercial inoculant, based on the total viable bacterial count. The results for each treatment group were collected at the early stages of ginger harvest (215 days of the experimental period), as shown in Table 6.

[0140] Table 6 Ginger field test results of composite microbial agent

[0141] Incidence of ginger blast (%) Root rot incidence (%) Yield per mu (kg) Control group 1 (conventional planting) 44.36 27.38 3108.50 Control group 2 (market microbial agent) 36.65 21.33 3431.42 Control group 3 (control bacterial agent) 37.24 20.77 3577.19 Experimental group (compound bacterial agent) 29.41 19.65 3901.37

[0142] As can be seen from Table 6, the composite bacterial agent of the present invention has the highest disease resistance and growth-promoting effect on ginger blast and root rot of ginger. The specific effects are as follows: compared with conventional planting, the incidence of ginger blast is reduced by 33.7%, the incidence of root rot is reduced by 28.23%, and the yield per mu is increased by 25.51%; compared with the market bacterial agent, the incidence of ginger blast is reduced by 19.75%, the incidence of root rot is reduced by 7.88%, and the yield per mu is increased by 13.70%; compared with the control bacterial agent without the addition of the jelly-like Bacillus of the present invention, the incidence of ginger blast is reduced by 21.03%, the incidence of root rot is reduced by 5.39%, and the yield per mu is increased by 9.06%.

[0143] As demonstrated in the above examples, the present invention's Paenibacillus ly6-1 and its composite bacterial agents, fertilizers, and the like exhibit excellent phosphate and potassium solubilization, growth promotion, and disease resistance, significantly increasing crop yields. In particular, they exhibit significant resistance to ginger blast and root rot, achieving dual growth-promoting and antibacterial effects, thereby increasing ginger yield.

[0144] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "implementation method" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0145] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A jelly-like bacillus (Paenibacillus mucilaginosus), deposited in the General Microbiology Center of the China Culture Collection Administration on February 8, 2025, with the deposit number CGMCC No. 33505.

2. A microbial agent, characterized in that: The microbial agent includes the jelly-like Paenibacillus according to claim 1.

3. The microbial agent according to claim 2, characterized in that The effective viable bacteria count of the jelly-like Paenibacillus in the microbial agent is at least 2.0×10 8 CFU / g.

4. The microbial agent according to claim 2 or 3, characterized in that The preparation method of the microbial agent comprises: performing liquid fermentation culture on the strain, collecting the fermentation liquid and then spray drying it.

5. The microbial agent according to claim 2 or 3, characterized in that The microbial agent is in powder or granular form.

6. A composite bacterial agent, characterized in that: A microbial agent comprising the microbial agent according to any one of claims 2 to 5.

7. The composite bacterial agent according to claim 6, characterized in that The composite microbial agent includes a first microbial agent and a second microbial agent, wherein the first microbial agent is the microbial agent according to any one of claims 2 to 5, and the second microbial agent includes at least one selected from Bacillus megaterium, Brevibacillus laterosporus, Bacillus amyloliquefaciens, and Bacillus polymyxa.

8. The composite bacterial agent according to claim 7, characterized in that The composite microbial agent comprises 10 to 50 parts by weight of the first microbial agent and 10 to 50 parts by weight of the second microbial agent; wherein the second microbial agent is selected from at least one of the following: 10-30 parts by weight of Bacillus megaterium; 10-30 parts by weight of Brevibacillus laterosporus; 10-30 parts by weight of Bacillus amyloliquefaciens; 10 to 30 parts by weight of Bacillus polymyxa.

9. The composite bacterial agent according to any one of claims 6 to 8, characterized in that The effective viable bacteria count of the jelly-like Paenibacillus in the composite bacterial agent is at least 2×10 8 CFU / g, and at least one of the following conditions is met: The effective viable cell count of Bacillus megaterium is at least 5×10 9 CFU / g; The effective viable count of Brevibacillus laterosporus is at least 5×10 9 CFU / g; The effective viable count of Bacillus amyloliquefaciens is at least 5×10 10 CFU / g; The effective viable count of Bacillus polymyxa is at least 5×10 8 CFU / g.

10. A microbial fertilizer, characterized in that: The method comprises the Paenibacillus gelatinosa according to claim 1, the microbial agent according to any one of claims 2 to 5, or the composite bacterial agent according to any one of claims 6 to 9.

11. The microbial fertilizer according to claim 10, characterized in that The microbial fertilizer is a solid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 2.5×10 7 CFU / g; Alternatively, the microbial fertilizer is a liquid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 6.0×10 7 CFU / mL.

12. The microbial fertilizer according to claim 10, characterized in that The microbial fertilizer further includes a basic fertilizer, and the basic fertilizer includes at least one selected from compound fertilizers, water-soluble fertilizers, organic fertilizers, and organic-inorganic fertilizers.

13. A method for dissolving phosphorus and potassium in soil, characterized in that: include: Applying jelly-like Paenibacillus, a microbial agent, a composite agent or a microbial fertilizer to the soil, the jelly-like Paenibacillus is the jelly-like Paenibacillus according to claim 1, the microbial agent is the microbial agent according to any one of claims 2 to 5, the composite agent is the composite agent according to any one of claims 6 to 9, and the microbial fertilizer is the microbial fertilizer according to any one of claims 10 to 12.

14. A method for fertilizing crops, characterized in that: include: The crops are applied with Paenibacillus jelly-like, a microbial agent, a composite agent or a microbial fertilizer, wherein the Paenibacillus jelly-like is the Paenibacillus jelly-like according to claim 1, the microbial agent is the microbial agent according to any one of claims 2 to 5, the composite agent is the composite agent according to any one of claims 6 to 9, and the microbial fertilizer is the microbial fertilizer according to any one of claims 10 to 12.

15. The method according to claim 14, characterized in that The crops are selected from at least one of wheat, corn, cucumber and ginger.

16. A method for inhibiting the growth of ginger pathogens, preventing and treating ginger diseases or increasing ginger yield, characterized in that: include: A jelly-like Bacillus, a microbial agent, a composite agent or a microbial fertilizer is applied to the soil for growing ginger, wherein the jelly-like Bacillus is the jelly-like Bacillus according to claim 1, the microbial agent is the microbial agent according to any one of claims 2 to 5, the composite agent is the composite agent according to any one of claims 6 to 9, and the microbial fertilizer is the microbial fertilizer according to any one of claims 10 to 12.

17. The method according to claim 16, characterized in that The ginger pathogens include Pseudomonas solanacearum and Pythium spp.; the ginger diseases include ginger wilt and root rot.

18. Use of the jelly-like Paenibacillus according to claim 1 in the preparation of a microbial agent, a composite microbial agent or a microbial fertilizer.

Images