Streptomyces nigrum X29 and application thereof
By screening Streptocytica fermentation broth X29, parasitic nematode control agents were prepared, which solved the problem of chemical pesticide contamination and the small number of existing bio-drug species, and achieved efficient prevention and control of various plant parasitic nematodes and plant growth promotion effects.
Patent Information
- Application Number
- CN202510683353.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2025-08-08
AI Technical Summary
Existing chemical pesticides have environmental pollution and food safety threats in preventing and controlling plant parasitic nematodes. There are few types of bio-drugs and unstable prevention effects, making it difficult to effectively solve the problem of root knot nematode flooding.
Streptocytica nigra X29 was screened, and parasitic nematode control agents were prepared through its fermentation broth and supernatant. The nematode active substances and growth-promoting substances produced by it were used, such as indoleacetic acid and ferrite, to achieve efficient prevention and control of various plant parasitic nematodes and plant growth promotion.
The mortality rates of Streptomyces black X29 against southern root knot nematode, pine nematode, rice dry tip nematode and sweet potato stem nematode were 92.6%, 82.5%, 74.7% and 52.2%, respectively, significantly inhibiting nematode reproduction and promoting plant growth. After the fermentation broth treatment, the length of cucumber and tomato radiculogen increased by 28.8% and 19.0%, and the stem and fresh weight of stems increased by 13.3% and 26.0%, respectively.
Smart Images
Figure CN120442491A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological control, relates to a Streptomyces and applications, and particularly relates to a black Streptomyces X29 and applications. Background Art
[0002] Plant parasitic nematodes are an important type of plant pathogens that are widely distributed around the world and have strong adaptability to the environment. They establish long-term and stable parasitic relationships with host plants, seriously harming food, horticultural crops and forest plants, causing global economic losses of up to US$100 billion each year.
[0003] Currently, there are over 5,000 known species of plant-parasitic nematodes belonging to over 200 genera. Based on an assessment of the economic losses caused by nematodes, the most important plant-parasitic nematode species in my country are, in order: root-knot nematodes, cyst nematodes, pine wood nematodes, stem nematodes, brachypod nematodes, penetrating nematodes, semi-piercing nematodes, and reniform nematodes. Root-knot nematodes are widely distributed in areas with hot climates or short winters, host over 2,000 plant species, and cause approximately 5% of global crop losses. There are over 90 valid species of the genus Meloidogyne, with over 40 reported and documented in my country. The most common are the southern root-knot nematode, the peanut root-knot nematode, the Javan root-knot nematode, the northern root-knot nematode, and the elephant-ear bean root-knot nematode.
[0004] Biological control of plant parasitic nematodes is currently an important component of agricultural plant disease prevention and control. Root-knot nematodes are soil-borne pests with a wide host range and severe damage, making them the most important and difficult to control.
[0005] Currently, plant root-knot nematode control primarily relies on chemical pesticides. Chemical nematicides are highly toxic, leaving significant residues in soil, water, and agricultural products, severely polluting the environment and food, posing a threat to human health. With increasing attention to food safety and environmental issues, the use of most highly toxic chemical nematicides has been banned or restricted. Currently, only a few nematicides, such as avermectin and thiazophos, maintain market demand. The identification of new, highly effective biocontrol bacteria is a primary challenge in the development of green pesticides for nematode control.
[0006] The main root-knot nematode biocontrol microorganisms discovered and used in production are fungi and bacteria, such as Paecilomyces lilacinus and Pulcinia chlamydospora. Paecilomyces lilacinus has been industrialized and widely used for root-knot nematode control. Pulcinia chlamydospora is a parasitic fungus that parasitizes root-knot nematode eggs and females, and its commercial preparations are highly effective against vegetable root-knot nematodes. Research on bacterial nematode biocontrol agents primarily focuses on Bacillus amyloliquefaciens, Bacillus thuringiensis, and Pseudomonas fluorescens. Existing fungal and bacterial biocontrol agents for root-knot nematodes are limited in variety and have inconsistent efficacy, making them ineffective in addressing the widespread root-knot nematode infestation. Developing effective and stable microbial preparations is an urgent challenge in plant parasitic nematode control. Screening for new, highly effective biocontrol bacteria is one of the fundamental solutions to overcoming the current challenges in controlling plant parasitic nematode diseases, primarily root-knot nematodes.
[0007] Actinomycetes are the primary producers of antibiotics. Approximately 70% of existing antibiotics are produced by microorganisms; approximately 70% of microbial antibiotics are produced by actinomycetes; and approximately 70% of actinomycete-produced antibiotics are produced by Streptomyces. Therefore, Streptomyces is a major producer of antibiotics and a key target for screening biocontrol agents against root-knot nematodes. Streptomyces is the largest genus in the order Actinomycetales, currently comprising over 500 active species. Antibiotics synthesized by Streptomyces are primarily used in medicine, with strong antibacterial and antifungal properties. However, their application in agriculture is limited, and their role in controlling plant-parasitic nematodes has not received widespread attention. In addition to producing a wide variety of antibiotics, Streptomyces possesses a key characteristic: it produces large numbers of highly stress-resistant spores that can survive for long periods in dry conditions. This characteristic gives Streptomyces significant commercial value: live bacterial preparations have a long shelf life. If strains of Streptomyces that are highly effective against plant-parasitic nematodes can be identified, this would provide a promising avenue for biological control of plant-parasitic nematodes and a valuable resource for the development of biocontrol products for root-knot nematodes. Currently, there are no Streptomyces products on the market that have been successfully used for root-knot nematode control. Summary of the Invention
[0008] In order to solve the above technical problems existing in the background technology, the present invention provides a black Streptomyces X29 having strong insecticidal activity against plant parasitic nematodes and capable of promoting plant growth and its application.
[0009] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions.
[0010] A strain of Streptomyces nigra X29, characterized in that: the Streptomyces nigra X29 is named Streptomyces nigra X29, and the Streptomyces nigra X29 has been deposited in the China Center for Type Culture Collection on May 17, 2024, and the deposit number is CCTCC NO: M 2024976.
[0011] Based on the fermentation broth obtained from the aforementioned Streptomyces nigricans X29.
[0012] Based on the supernatant of the fermentation broth obtained from the aforementioned Streptomyces nigricans X29.
[0013] Use of the Streptomyces nigricans X29, the fermentation broth obtained from Streptomyces nigricans X29 and / or the supernatant of the fermentation broth obtained from Streptomyces nigricans X29 as described above in the preparation of a parasitic nematode control agent and / or in controlling parasitic nematodes.
[0014] The above-mentioned parasitic nematodes are plant-parasitic nematodes.
[0015] The parasitic nematodes are root-knot nematodes, pine wood nematodes, rice stem nematodes and / or sweet potato stem nematodes.
[0016] The parasitic nematode mentioned above is the southern root-knot nematode.
[0017] The control in the above application is to control the growth of parasitic nematodes, control the reproduction of nematodes or kill the parasitic nematodes.
[0018] Use of the Streptomyces nigricans X29, the fermentation broth obtained from Streptomyces nigricans X29 and / or the supernatant of the fermentation broth obtained from Streptomyces nigricans X29 as described above in promoting plant growth.
[0019] The Streptomyces nigricans X29, the fermentation liquid obtained from Streptomyces nigricans X29 and / or the supernatant of the fermentation liquid obtained from Streptomyces nigricans X29 can synthesize indoleacetic acid and siderophore.
[0020] Compared with the prior art, the beneficial effects and new functions discovered by the present invention are as follows:
[0021] The present invention provides a strain of Streptomyces nigra X29 and its application, named Streptomyces nigra X29. The strain was deposited in the China Center for Type Culture Collection on May 17, 2024, with the deposit number CCTCC NO: M 2024976. The Streptomyces nigra X29 provided by the present invention can produce nematicidal active substances, has strong insecticidal activity and high mortality rate against various plant parasitic nematodes, and has a corrected mortality rate of 92.6%, 82.5%, 74.7% and 52.2% against southern root-knot nematodes, pine wood nematodes, rice stem nematodes and sweet potato stem nematodes, respectively. In particular, the corrected mortality rate of the second-instar larvae of southern root-knot nematodes after 48 hours reaches 92.6%. At the same time, Streptomyces nigra X29 can also produce plant growth stimulants indoleacetic acid and plant growth-promoting substances siderophore, which can significantly promote plant growth. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 This is the phylogenetic tree of Streptomyces nigricans X29;
[0023] Figure 2 The death status of five nematodes treated with the fermentation broth of Streptomyces nigricans X29 for 48 hours;
[0024] Figure 3 This is the electrophoresis diagram of the 16S rDNA amplification product of the X29 strain. DETAILED DESCRIPTION
[0025] The test materials used in this embodiment are as follows:
[0026] (1) Streptomyces nigra (S. nigra) X29: isolated and screened from farmland soil in Xuzhou City, Jiangsu Province.
[0027] (2) Tomato variety: Hezuo 903, produced by Shanghai Hongqiao Tianlong Seed Co., Ltd., is a variety that is sensitive to root-knot nematode infection and susceptible to disease.
[0028] (3) Jinyan No. 4 cucumber: cultivated by Tianjin Vegetable Research Institute and produced by Cangzhou Jinkelifeng Seedling Company.
[0029] Example 1 Identification of test strains
[0030] 1. Morphological characteristics:
[0031] Actinomycete X29, identified as a strain with high nematicidal activity, was inoculated using the three-zone streak method onto 10 morphologically characterized media: ISP1, ISP2, ISP3, ISP4, ISP5, ISP7, potato dextrose agar (PDA), Gaudet's medium (GA), Czapek's medium (CDA), and nutrient agar (NA). Single colonies were isolated using the dilution plate smear method. The inoculated plates were incubated inverted at 28°C for 21 days. Colony morphology was then observed and characterized, including size, edge condition, degree of protrusion, surface gloss, and color. The results are shown in Table 1.
[0032] Table 1 Morphological characteristics of Streptomyces nigricans X29 on 10 culture media
[0033]
[0034]
[0035] Note: “++++”, “+++”, “++” and “+” indicate good, relatively good, fair and poor growth respectively.
[0036] 2. Physiological and biochemical characteristics
[0037] The test strains were inoculated or plated in different physiological and biochemical culture media, and the growth of the test bacteria in the culture media was observed and recorded. The results are shown in Table 2.
[0038] Table 2 Physiological and biochemical characteristics of Streptomyces nigricans X29
[0039] Biochemical function Reaction / content Carbon source utilization reaction Milk coagulation and peptization + glucose + Gelatin liquefaction + sucrose - Hydrogen sulfide production + maltose + Melanin production + D-Mannitol + Nitrogen fixation + Soluble starch + Siderophore production + D-fructose + Auxin IAA content (μg / ml) 15.4 D-Sorbitol - Soluble Phosphate - Cellulose decomposition -
[0040] 3. Molecular Identification of Actinomycetes
[0041] 3.1 Amplification and sequencing of 16S rDNA gene fragments: Mycelia of strain X29 cultured on Gao's medium No. 1 were scraped with a sterile blade and collected in a sterile 1.5 mL centrifuge tube. After rapid freezing into powder with liquid nitrogen, 200 μL of Liquid Buffer was added, followed by 20 μL of 20 mg / mL proteinase K solution. After oscillation and mixing, the cells were placed in a 56°C water bath for 1 h to lyse the cells. Purified DNA of the test actinomycetes was extracted according to the instructions of the PCR purification kit Cycle-pure kit (200) and stored frozen at -20°C.
[0042] Purified DNA from the test bacteria was used as a template to amplify the 16S rDNA gene fragment using the universal primer pair 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGACTTAACCCCAATCGC). The primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd. The PCR amplification system consisted of 25 μL of the following: 1 μL of actinomycete DNA template, 1 μL of each upstream and downstream primer, 12.5 μL of 2× GS Taq polymerase, and 9.5 μL of ddH₂O. The amplification reaction conditions were: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 1 min, followed by a total extension at 72°C for 10 min. The amplified product was detected by 1.0% agarose gel electrophoresis at a stable voltage of 110V for 25 minutes. The gel was stained with 1.0% ethidium bromide (EB) for 20 minutes and observed and photographed under a UV gel imager. The target band size was approximately 1400-1500 bp (see Figure 3 The remaining PCR products were sent to Shanghai Sangon Biotechnology Co., Ltd. for purification and sequencing.
[0043] 3.2 16S rDNA gene phylogenetic analysis: The sequenced sequences were spliced and compared using BLAST search software in NCBI. A phylogenetic tree was constructed based on the 16S rDNA gene sequence: a bacterial group with a distant relationship was downloaded as an outgroup, and multiple sequence alignments were performed using the MAFFT (https: / / mafft.cbrc.jp / alignment / server) online platform. The fasta files generated after alignment were converted to the format using ALTER. A maximum likelihood (RAxML) phylogenetic tree was constructed in IQTree, and 1000 bootstrap operations were performed. The 16S rDNA gene phylogenetic tree of the test strain constructed using the maximum likelihood method is detailed in [1]. Figure 1 From the evolutionary tree, it can be seen that strain X29 and Streptomyces nigra are clustered on the same branch, and the strain can be identified as Streptomyces nigra.
[0044] The black Streptomyces X29 obtained by screening was deposited in the China Center for Type Culture Collection on May 17, 2024, with the deposit number CCTCC NO: M2024976. Address: Wuhan University, Wuhan, China, Postal Code: 430072; Tel: (027) 68754052; E-mail: cctcc@whu.edu.cn .
[0045] Example 2 Nematicidal activity of Streptomyces nigricans
[0046] 1. Preparation of Streptomyces nigricans X29 Fermentation Broth
[0047] The black Streptomyces strain X29 preserved on a slant Gao's No. 1 medium was streaked onto a Gao's No. 1 solid medium plate. After culturing at 28°C for 7 days, a single colony was picked and inoculated into a test tube containing 5 mL of Gao's No. 1 liquid medium. The culture was shaken at 28°C and 180 rpm for 7 days to obtain the black Streptomyces X29 fermentation broth; the black Streptomyces X29 fermentation broth was centrifuged at 12000 rpm for 3 minutes to obtain the black Streptomyces X29 fermentation supernatant.
[0048] 2. Determination of Nematicidal Activity of Streptomyces nigricans X29
[0049] In a 96-well cell culture plate, 80 μL of Streptomyces nigricans X29 fermentation supernatant and 20 μL of the test nematode suspension (containing 20-30 nematodes) were placed in one well. The control treatment consisted of 80 μL of liquid Gouldian medium No. 1 and 20 μL of the nematode suspension. Each treatment was repeated in triplicate. After counting the nematodes in each well under a stereomicroscope, the 96-well plate was placed in a 25°C incubator. Nematodes treated with Streptomyces nigricans X29 and the control were observed for activity and mortality at 24 and 48 hours. Nematodes were considered dead if they became rigid. Figure 2 The nematode mortality rate of each treatment was calculated and the corrected mortality rate was calculated using formula (1). The results are shown in Table 3.
[0050]
[0051] Table 3 Corrected mortality of five nematode species by S. nigra X29 fermentation broth for 48 hours (%)
[0052]
[0053]
[0054] 3. Comparison of the insecticidal activity of Streptomyces nigricans X29 and chemical nematicides against southern root-knot nematodes
[0055] The differential antimicrobial activity of Streptomyces nigricans X29 and chemical nematicides was determined using subcultures of the incognita root-knot nematode (M. incognita) in our laboratory. The roots of diseased tomato plants bearing numerous egg masses were cleaned, and the egg masses were removed with pointed tweezers. The eggs were surface-disinfected with 1% sodium hypochlorite for 3 minutes, rinsed five times with sterile water, and incubated in a 28°C incubator. A suspension of second-instar larvae (J2) of the root-knot nematode was collected and diluted to 1000 larvae / mL with sterile water.
[0056] In a 96-well cell culture plate, 80 μL of Streptomyces nigricans X29 fermentation supernatant and 20 μL of incognita root-knot nematode J2 suspension (containing 20-30 nematodes) were placed in one well. The control treatment (CK) consisted of 80 μL of liquid Gao's medium No. 1 and 20 μL of nematode suspension. Each treatment was repeated in triplicate. After counting the nematodes in each well under a stereomicroscope, the 96-well plate was placed in a 25°C incubator. Nematode activity in the Streptomyces nigricans X29-treated and control treatments was observed for 24 h and 48 h, and the number of nematode deaths was counted. To avoid statistical errors caused by nematode pseudo-animation, 1 mol / L NaOH was added to observe whether the nematodes revived. If the nematodes were wriggling, they were considered alive, and if they were rigid, they were considered dead. The nematode mortality rate for each treatment was calculated, and the corrected mortality rate was calculated using formula (1). The disease index and control efficacy were calculated using formulas (2) and (3).
[0057]
[0058] The results are shown in Table 4. After treatment with black Streptomyces X29, the number of root-knot nematode eggs, the number of female nematodes, the number of root knots and the disease index decreased by 54.7%, 55.2%, 44.5% and 56.4% respectively compared with the control, that is, black Streptomyces X29 had a significant inhibitory effect on the growth, reproduction and pathogenicity of root-knot nematodes.
[0059] Table 4 Effects of Streptomyces nigricans X29 and chemical nematicides on the reproduction and disease index of southern root-knot nematode
[0060]
[0061] Note: 1. J2 is the second-instar larva of root-knot nematodes. 2. The same lowercase letters in the same column indicate no significant difference between groups; different lowercase letters indicate significant difference between groups (P < 0.05). 3. CK1% refers to the increase rate of each parameter relative to CK1. The following table is the same.
[0062] Example 3 Determination of the ability of Streptomyces nigricans X29 to produce siderophores
[0063] Siderophore production was detected using Chrome Azurol S (CAS) solid culture medium. Hexadecytrimethylammoniumbromide (HDTMA) forms a bright blue complex with iron ions. When iron ions in the culture medium are removed by the siderophore secreted by the strain, the area surrounding the colony turns orange. Well-growing single colonies were selected and inoculated onto modified CAS solid culture medium. Cultured at 28°C for 7 days, the growth of the test bacteria on the culture medium was observed. The appearance of an orange ring around the colony indicated siderophore production, and the inner and outer diameters of the orange ring were recorded. The results showed that Streptomyces nigricans produced siderophores, as shown in Table 2.
[0064] Example 4 Determination of the ability of Streptomyces nigricans X29 to produce elongin
[0065] The ability of the test bacteria to produce auxin (IAA) was determined by the Salkowski colorimetric method.
[0066] Auxin Production: Inoculate the test strain Streptomyces nigricans X29 into liquid Gao's medium No. 1 containing 0.5 g / L tryptophan. Cultivate at 28°C and 220 rpm for 7 days to obtain the Streptomyces nigricans X29 fermentation broth, which is then centrifuged at 12,000 rpm for 2 minutes to obtain the fermentation supernatant.
[0067] Prepare Salkowski colorimetric solution: Mix 1 mL of 0.5 mol / L FeCl₃ with 35% HClO₃ and store in the dark. Add 1 mL of Streptomyces nigricans fermentation supernatant and 2 mL of Salkowski colorimetric solution to five new sterile test tubes. A blank culture medium is used as a control. Incubate the tubes at room temperature in the dark for 30 minutes and observe their color. If the color turns red, auxin is produced. Measure the OD value at 530 nm to calculate the auxin content.
[0068] Weigh 0.010g of pure IAA and dissolve it in a small amount of ethanol. The volume was then diluted to 100mL with distilled water to create a stock solution with a concentration of 100μg / mL. This stock solution was then prepared with distilled water into gradient dilutions of 0, 5, 10, 15, 20, 25, 30, 35, and 40μg / mL. Nine sterile test tubes were sequentially added with 1mL of the IAA gradient dilutions and 2mL of Salkowski colorimetric solution, mixed thoroughly, and incubated at room temperature in the dark for 30 minutes. The absorbance of the various IAA concentrations at a wavelength of 530nm was measured using a UV spectrophotometer. The results showed that Streptomyces nigricans was capable of synthesizing auxin, with the IAA content in the fermentation broth reaching 15.4μg / mL. The results are shown in Table 2.
[0069] Example 5 Determination of the ability of Streptomyces nigricans X29 to promote seed radicle growth
[0070] The prepared Streptomyces nigricans X29 fermentation supernatant was diluted 100-fold and 1000-fold with sterile water. 5 mL of the fermentation solution, 100-fold dilution, and 1000-fold dilution were transferred to sterile test tubes. Gao's medium (GA) No. 1 was used as a control. Twenty-four seeds of Hezuo 903 tomato and Jinyan No. 4 cucumber, each of uniform plumpness, were placed in each test tube. The seeds were soaked in the dark at room temperature (approximately 25°C) for 12 hours. After discarding the soaking solution, the seeds were removed and dried with absorbent paper. Eight seeds were placed in each dish, evenly spaced, in a culture dish lined with sterile filter paper. Three replicates were used for each treatment. The filter paper was soaked with sterile water, and the dishes were covered and incubated in the dark at approximately 25°C for 72 hours. Radicle length was measured after germination. During the incubation period, water evaporation from the filter paper in the culture dish was checked daily, and water was added if insufficient. The experimental results are shown in Table 5.
[0071] Table 5 Effects of Streptomyces nigricans X29 fermentation liquid on the radicle length (mm) of cucumber and tomato
[0072]
[0073] Example 6 Determination of the Growth-Promoting Ability of Streptomyces nigricans X29
[0074] Sixty days after inoculation with root-knot nematodes, the tomato plants were carefully removed from their pots, and the roots were gently washed with tap water. The fresh weights of the stems and leaves and the roots were weighed. Plant height, stem diameter, and root length were measured, and photographs were taken. The effect of the fermentation liquid of Streptomyces nigricans X29 on the biomass of the tomato plants was calculated. The results are shown in Table 6.
[0075] Table 6 The growth promoting effect of Streptomyces nigricans X29 on tomato
[0076]
[0077] Note: The same lowercase letters in the same column indicate no significant difference between the groups, and different lowercase letters indicate significant difference between the groups (P < 0.05).
[0078] In summary, the strain Streptomyces nigricans X29 screened in this study produces compounds with nematicidal activity, demonstrating a strong lethal effect against plant-parasitic nematodes. The strain achieved a 48-hour adjusted lethality of 92.6% against the southern root-knot nematode, 82.5% against the pine wood nematode, 74.7% against the rice stem nematode, and 52.2% against the sweet potato stem nematode. The strain significantly inhibited the reproduction of the southern root-knot nematode, reducing the number of root knots and disease index. The number of egg masses, number of female nematodes, number of root knots, and disease index per plant treated with Streptomyces nigricans X29 decreased by 54.7%, 55.2%, 44.5%, and 56.4%, respectively, compared to the control. The strain achieved a 56.7% efficacy against the southern root-knot nematode, slightly lower than the 70.0% efficacy of the chemical nematode thiazolyl.
[0079] Streptomyces nigricans X29 also produces the auxin indoleacetic acid and siderophores, promoting plant growth. After treatment with the fermentation solution, the radicle length of cucumbers and tomatoes increased by 28.8% and 19.0%, respectively, compared to the control. The stem diameter and fresh weight of potted tomatoes increased by 13.3% and 26.0%, respectively.
Claims
1. A strain of Streptomyces nigricans X29, characterized by: The name of the black Streptomyces X29 is Streptomyces nigra X29, and the black Streptomyces X29 has been deposited in the China Center for Type Culture Collection on May 17, 2024, and the preservation number is CCTCC NO: M 2024976.
2. The fermentation broth obtained based on the Streptomyces nigricans X29 according to claim 1.
3. The supernatant of the fermentation broth obtained based on the Streptomyces nigricans X29 according to claim 1.
4. Use of the fermentation liquid obtained from the Streptomyces nigricans X29 according to claim 1, the Streptomyces nigricans X29 according to claim 2, and / or the supernatant of the fermentation liquid obtained from the Streptomyces nigricans X29 according to claim 3 in the preparation of a parasitic nematode control agent and / or in controlling parasitic nematodes.
5. The use according to claim 4, characterized in that: The parasitic nematode is a plant-parasitic nematode.
6. The use according to claim 5, characterized in that: The parasitic nematodes are root-knot nematodes, pine wood nematodes, rice stem-tip nematodes and / or sweet potato stem nematodes.
7. The use according to claim 6, characterized in that: The parasitic nematode is the southern root-knot nematode.
8. The use according to claim 4, 5, 6 or 7, characterized in that: The control in the application is to control the growth of parasitic nematodes, control the reproduction of nematodes or kill the parasitic nematodes.
9. Use of the fermentation liquid obtained by the Streptomyces nigricans X29 according to claim 1, the fermentation liquid obtained by the Streptomyces nigricans X29 according to claim 2, and / or the supernatant of the fermentation liquid obtained by the Streptomyces nigricans X29 according to claim 3 in promoting plant growth.
10. The use according to claim 9, characterized in that: The fermentation liquid obtained by the Streptomyces nigricans X29 according to claim 1, the Streptomyces nigricans X29 according to claim 2, and / or the supernatant of the fermentation liquid obtained by the Streptomyces nigricans X29 according to claim 3 can synthesize indoleacetic acid and siderophore.