Streptomyces griseoflavus XZ17 and application thereof
By using Streptocytica chlorophyces XZ17, its fermentation broth and supernatant, the problems of chemical pesticide contamination and insufficient existing bio-defensive species were solved, and efficient prevention and control of plant parasitic nematodes and plant growth promotion effects were achieved.
Patent Information
- Application Number
- CN202510683552.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2025-08-08
AI Technical Summary
Existing chemical pesticides have environmental pollution and food safety threats when controlling plant parasitic nematodes. There are few types of bio-drugs and unstable prevention effects, making it difficult to effectively solve the problem of root knot nematode flooding.
Streptocytica chlorophyces XZ17, its fermentation broth and supernatant are used to prepare parasitic nematode control agents, which have insecticidal activity and can promote plant growth and produce active substances such as indoleacetic acid and ferrite.
It has a high lethality rate for southern root knot nematode and sweet potato stem nematode, which significantly inhibits nematode reproduction and promotes plant growth. After dilution of the fermentation broth, it can significantly increase the length and biomass of the plant radiculogen.
Smart Images

Figure CN120442492A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological control, relates to a Streptomyces and applications, and particularly relates to a Streptomyces spp. XZ17 and applications. Background Art
[0002] Plant parasitic nematodes are an important type of plant pathogens that are widely distributed around the world and have strong adaptability to the environment. They establish long-term and stable parasitic relationships with host plants, seriously harming food, horticultural crops and forest plants, causing global economic losses of up to US$100 billion each year.
[0003] Currently, there are over 5,000 known species of plant-parasitic nematodes belonging to over 200 genera. Based on an assessment of economic losses caused by nematodes, the most important plant-parasitic nematode species in my country are, in order: root-knot nematodes, cyst nematodes, pine wood nematodes, stem nematodes, brachypod nematodes, penetrating nematodes, semi-piercing nematodes, and reniform nematodes. Root-knot nematodes are widely distributed in areas with hot climates or short winters, host over 2,000 plant species, and cause approximately 5% of global crop losses. There are over 90 valid species of the genus Meloidogyne, with over 40 reported and documented in my country. The most common are the southern root-knot nematode, the peanut root-knot nematode, the Javan root-knot nematode, the northern root-knot nematode, and the elephant-ear bean root-knot nematode.
[0004] Biological control of plant parasitic nematodes is currently an important component of agricultural plant disease prevention and control. Root-knot nematodes are soil-borne pests with a wide host range and severe damage, making them the most important and difficult to control.
[0005] Currently, plant root-knot nematode control primarily relies on chemical pesticides. Chemical nematicides are highly toxic, leaving significant residues in soil, water, and agricultural products, severely polluting the environment and food, posing a threat to human health. With increasing attention to food safety and environmental issues, the use of most highly toxic chemical nematicides has been banned or restricted. Currently, only a few nematicides, such as avermectin and thiazophos, maintain market demand. The identification of new, highly effective biocontrol bacteria is a primary challenge in the development of green pesticides for nematode control.
[0006] The main root-knot nematode biocontrol microorganisms discovered and used in production are fungi and bacteria, such as Paecilomyces lilacinus and Pulcinia chlamydospora. Paecilomyces lilacinus has been widely used for root-knot nematode control. Pulcinia chlamydospora is a parasite of root-knot nematode eggs and females, and its commercial preparations are highly effective against vegetable root-knot nematodes. Research on bacterial nematode biocontrol agents primarily focuses on Bacillus amyloliquefaciens, Bacillus thuringiensis, and Pseudomonas fluorescens. Existing fungal and bacterial biocontrol agents for root-knot nematodes are limited in variety and have inconsistent efficacy, making them ineffective in addressing the widespread root-knot nematode infestation. Developing eco-friendly, effective, and stable green biological agents is an urgent challenge in plant parasitic nematode control. Screening for new, highly effective biocontrol bacteria is one of the fundamental solutions to overcoming the current challenges in controlling plant parasitic nematode diseases, primarily root-knot nematodes.
[0007] Actinomycetes are the primary producers of antibiotics. Approximately 70% of existing antibiotics are produced by microorganisms; approximately 70% of microbial antibiotics are produced by actinomycetes; and approximately 70% of actinomycete-produced antibiotics are produced by Streptomyces. Therefore, Streptomyces is a major producer of antibiotics and a key target for screening biocontrol agents against root-knot nematodes. Streptomyces is the largest genus in the order Actinomycetales, currently comprising over 500 active species. Antibiotics synthesized by Streptomyces are primarily used in medicine, with strong antibacterial and antifungal properties. However, their application in agriculture is limited, and their role in controlling plant-parasitic nematodes has not received widespread attention. In addition to producing a wide variety of antibiotics, Streptomyces possesses a key characteristic: it produces large numbers of highly stress-resistant spores that can survive for long periods in dry conditions. This characteristic gives Streptomyces significant commercial value: live bacterial preparations have a long shelf life. If strains of Streptomyces that are highly effective against plant-parasitic nematodes can be identified, this would provide a promising avenue for biological control of plant-parasitic nematodes and a valuable resource for the development of biocontrol products for root-knot nematodes. Currently, there are no Streptomyces products on the market that have been successfully used for root-knot nematode control. Summary of the Invention
[0008] In order to solve the above technical problems existing in the background technology, the present invention provides a Streptomyces spp. XZ17 having strong insecticidal activity against plant parasitic nematodes and capable of promoting plant growth and its application.
[0009] In order to achieve the above object, the present invention adopts the following technical solutions:
[0010] A brown-gray-yellow Streptomyces XZ17, characterized in that: the brown-gray-yellow Streptomyces XZ17 is named Streptomyces phaeoluteigriseus XZ17, and the brown-gray-yellow Streptomyces XZ17 has been deposited in the China Center for Type Culture Collection on May 17, 2024, and the preservation number is CCTCC NO: M 2024977.
[0011] The fermentation broth obtained based on the aforementioned Streptomyces serrata XZ17.
[0012] The supernatant of the fermentation broth obtained based on the aforementioned Streptomyces fuchsii XZ17.
[0013] Use of Streptomyces fruticosus XZ17, the fermentation liquid obtained from Streptomyces fruticosus XZ17 and / or the supernatant of the fermentation liquid obtained from Streptomyces fruticosus XZ17 in preparing a parasitic nematode control agent and / or in controlling parasitic nematodes.
[0014] The above-mentioned parasitic nematodes are plant-parasitic nematodes.
[0015] The parasitic nematodes are root-knot nematodes, sweet potato stem nematodes and / or Caenorhabditis elegans.
[0016] The parasitic nematode mentioned above is the southern root-knot nematode.
[0017] The control in the above application is to control the growth of parasitic nematodes, control the reproduction of nematodes or kill the parasitic nematodes.
[0018] Application of Streptomyces fruticosus XZ17, fermentation liquid obtained from Streptomyces fruticosus XZ17 and / or supernatant of fermentation liquid obtained from Streptomyces fruticosus XZ17 in promoting plant growth.
[0019] Streptomyces fruticosus XZ17, the fermentation liquid obtained by Streptomyces fruticosus XZ17 and / or the supernatant of the fermentation liquid obtained by Streptomyces fruticosus XZ17 can synthesize indoleacetic acid and siderophore.
[0020] Compared with the prior art, the present invention has the following beneficial effects:
[0021] The present invention provides a Streptomyces phaeoluteigriseus XZ17, named Streptomyces phaeoluteigriseus XZ17. This Streptomyces phaeoluteigriseus XZ17 was deposited with the China Center for Type Culture Collection on May 17, 2024, with the deposit number CCTCCNO: M 2024977. The present invention discloses the use of Streptomyces phaeoluteigriseus XZ17 for controlling southern root-knot nematodes and sweet potato stem nematodes in crops. Furthermore, the present invention discloses the use of this strain in promoting plant growth. The Streptomyces phaeoluteigriseus XZ17 can produce a nematicidal active substance with strong insecticidal activity and a high mortality rate against southern root-knot nematodes. The 48-hour corrected mortality rates against southern root-knot nematodes and sweet potato stem nematodes are 90.6% and 29.2%, respectively. Furthermore, the strain can produce the plant growth stimulator indoleacetic acid and the plant growth-promoting siderophore siderophore, significantly promoting plant growth. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 This is the phylogenetic tree of Streptomyces fuscae XZ17;
[0023] Figure 2 The death status of five nematodes treated with the fermentation liquid of Streptomyces styracifluum XZ17 for 48 hours;
[0024] Figure 3 This is the electrophoresis gel image of the 16S rDNA amplification product of the XZ17 strain. DETAILED DESCRIPTION
[0025] The test materials used in this embodiment are as follows:
[0026] (1) Streptomyces phaeoluteigriseus XZ17: isolated and screened from farmland soil in Xuzhou City, Jiangsu Province.
[0027] (2) Tomato variety: Hezuo 903, produced by Shanghai Hongqiao Tianlong Seed Co., Ltd., is a variety that is sensitive to root-knot nematode infection and susceptible to disease.
[0028] (3) Jinyan No. 4 cucumber: cultivated by Tianjin Vegetable Research Institute and produced by Cangzhou Jinkelifeng Seedling Company.
[0029] Example 1 Identification of test strains
[0030] 1. Morphological characteristics
[0031] The strain XZ17, identified as a strain with high nematicidal activity, was inoculated using the three-zone streak method onto ten morphologically characterized media: ISP1, ISP2, ISP3, ISP4, ISP5, ISP7, potato dextrose agar (PDA), Gaudet's medium (GA), Czapek's medium (CDA), and nutrient agar (NA). Single colonies were isolated using the dilution plate smear method. The inoculated plates were incubated inverted at 28°C for 21 days. Colony morphology was observed and characterized, including size, edge condition, degree of protrusion, surface gloss, and color. The results are shown in Table 1.
[0032] Table 1 Morphological characteristics of Streptomyces serrata XZ17 on 10 culture media
[0033]
[0034]
[0035] Note: “++++”, “+++”, “++” and “+” indicate good, relatively good, fair and poor growth respectively.
[0036] 2. Physiological and biochemical characteristics
[0037] The test strains were inoculated or spread in different physiological and biochemical culture media, and the growth of actinomycetes in each culture medium was observed and recorded. The results are shown in Table 2.
[0038] Table 2 Physiological and biochemical characteristics of Streptomyces serrata XZ17
[0039] Biochemical function Reaction / content Carbon source utilization reaction Milk coagulation and peptization + glucose + Gelatin liquefaction + sucrose + Hydrogen sulfide production + maltose + Flavin production + D-Mannitol + Nitrogen fixation + Soluble starch + Siderophore production + D-fructose + Auxin IAA content (μg / ml) 8.7 D-Sorbitol - Soluble Phosphate - Cellulose decomposition +
[0040] 3. Molecular Identification of Actinomycetes
[0041] 3.1 Amplification and sequencing of 16S rDNA gene fragments: Mycelia of strain XZ17 cultured on Gao's medium No. 1 were scraped with a sterile blade and collected in a sterile 1.5 mL centrifuge tube. After rapid freezing into powder with liquid nitrogen, 200 μL of Liquid Buffer was added, followed by 20 μL of 20 mg / mL proteinase K solution. After oscillation and mixing, the cells were placed in a 56°C water bath for 1 h to lyse the cells. Purified DNA of the test actinomycetes was extracted according to the instructions of the PCR purification kit Cycle-pure kit (200). The purified DNA was stored in a freezer at -20°C.
[0042] Purified DNA from the test bacteria was used as a template to amplify the 16S rDNA gene fragment using the universal primer pair 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGACTTAACCCCAATCGC). The primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd. The PCR amplification system consisted of 25 μL of the following: 1 μL of actinomycete DNA template, 1 μL of each upstream and downstream primer, 12.5 μL of 2× GS Taq polymerase, and 9.5 μL of ddH₂O. The amplification reaction conditions were: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 1 min, followed by a total extension at 72°C for 10 min. The amplified product was detected by 1.0% agarose gel electrophoresis at a stable voltage of 110V for 25 minutes. The gel was stained with 1.0% ethidium bromide (EB) for 20 minutes and observed and photographed under a UV gel imager. The target band size was approximately 1400-1500 bp. Figure 3 The remaining PCR products were sent to Shanghai Sangon Biotechnology Co., Ltd. for purification and sequencing.
[0043] 3.2 16S rDNA gene phylogenetic analysis: After sequencing, the obtained sequences were spliced and compared using BLAST search software in NCBI. A phylogenetic tree was constructed based on the 16S rDNA gene sequences: a bacterial population with a distant relationship was downloaded as an outgroup, and multiple sequence alignments were performed using the MAFFT (https: / / mafft.cbrc.jp / alignment / server) online platform. The resulting fasta files were converted to the format using ALTER. A maximum likelihood (RAxML) phylogenetic tree was constructed in IQTree, and 1000 bootstrap operations were performed. A larger Bootstrap value (BS) indicates a higher confidence level (Stamatakis et al., 2014). The 16S rDNA gene phylogenetic tree of the test strains constructed using the maximum likelihood method is detailed in [ 1 ]. Figure 1 From the evolutionary tree, we can see that strain XZ17 and Streptomyces phaeoluteigriseus are clustered on the same branch, so the strain can be identified as Streptomyces phaeoluteigriseus.
[0044] The strain S. phaeoluteigriseus XZ17 screened by the present invention was deposited in the China Center for Type Culture Collection on May 17, 2024, with the deposit number CCTCC NO: M 2024977. Address: Wuhan University, Wuhan, China, Postal Code: 430072. Tel: (027) 68754052; E-mail: cctcc@whu.edu.cn .
[0045] Example 2 Nematicidal activity of Streptomyces fuscae
[0046] 1. Preparation of Fermentation Broth of Streptomyces spp. XZ17
[0047] The brown-gray-yellow Streptomyces XZ17 strain preserved on a slant Gao's No. 1 medium was streaked and inoculated on a Gao's No. 1 solid medium plate. After culturing at 28°C for 7 days, a single colony was picked and inoculated into a test tube containing 5 mL of Gao's No. 1 liquid medium. The culture was shaken at 28°C and 180 rpm for 7 days to obtain the brown-gray-yellow Streptomyces XZ17 fermentation broth; the brown-gray-yellow Streptomyces XZ17 fermentation broth was centrifuged at 12000 rpm for 3 minutes to obtain the brown-gray-yellow Streptomyces XZ17 fermentation supernatant.
[0048] 2. Determination of nematicidal activity of XZ17
[0049] In a 96-well cell culture plate, 80 μL of fermentation supernatant of Streptomyces spp. XZ17 and 20 μL of test nematode suspension (containing 20-30 nematodes) were placed in one well. The control treatment consisted of 80 μL of liquid Gao's medium No. 1 and 20 μL of nematode suspension. Each treatment was repeated in 3 wells. After counting the nematodes in each well under a stereomicroscope, the 96-well plate was placed in a 25°C incubator. The activity of nematodes treated with Streptomyces spp. XZ17 and the control treatment was observed for 24 hours and 48 hours, and the number of nematode deaths was counted. Rigor mortis was considered death. The results are shown in the table below. Figure 2 The nematode mortality rate of each treatment was calculated, and the corrected mortality rate was calculated using formula (1). The results are shown in Table 3.
[0050]
[0051] Table 3 Corrected mortality of three nematodes by fermentation broth of Streptomyces fuscae XZ17 for 48 hours
[0052]
[0053]
[0054] 3. Comparison of the insecticidal activity of Streptomyces serrata XZ17 and chemical nematicides against southern root-knot nematodes
[0055] The differential antimicrobial activity of Streptomyces fuscae XZ17 and chemical nematicides was determined using subcultures of the incognita root-knot nematode (M. incognita) in our laboratory. The roots of diseased tomato plants bearing numerous egg masses were cleaned, and the egg masses were removed with pointed tweezers. The eggs were surface-disinfected with 1% sodium hypochlorite for 3 minutes, rinsed five times with sterile water, and incubated in a 28°C incubator. A suspension of second-instar larvae (J2) of the root-knot nematode was collected and diluted to 1000 larvae / mL with sterile water.
[0056] In a 96-well cell culture plate, 80 μL of the test bacteria fermentation supernatant and 20 μL of the southern root-knot nematode J2 suspension (containing 20-30 nematodes) were placed in one well. The control treatment (CK) consisted of 80 μL of liquid Gao's medium No. 1 and 20 μL of the nematode suspension. Each treatment was repeated in triplicate. After counting the nematodes in each well under a stereomicroscope, the 96-well plate was placed in a 25°C incubator. The activity of the nematodes treated with Streptomyces stygophora XZ17 and the control treatment was observed for 24 h and 48 h, and the number of nematode deaths was counted. To avoid statistical errors caused by nematode pseudo-death, 1 mol / L NaOH was added to observe whether the nematodes revived. If the nematodes were wriggling, they were considered alive, and if they were stiff, they were considered dead. The nematode mortality rate for each treatment was calculated. The corrected mortality rate was calculated using formula (1). The disease index and control efficacy were calculated using formulas (2) and (3). The results are shown in Table 4.
[0057]
[0058] Table 4 Effects of Streptomyces spp. XZ17 and chemical nematicides on the reproduction and disease index of southern root-knot nematode
[0059]
[0060] Note: 1. J2 is the second-instar larva of root-knot nematodes. 2. Different lowercase letters in the same column indicate significant differences at P < 0.05.
[0061] Example 3 Determination of the ability of Streptomyces spp. to produce siderophores
[0062] Siderophore production was detected using modified Chrome Azurol S (CAS) solid medium. Hexadecyltrimethylammonium bromide (HDTMA) forms a bright blue complex with iron ions. When iron ions in the culture medium are removed by the siderophore secreted by the strain, the surrounding area of the colony turns orange. Well-growing single colonies were selected and inoculated onto modified CAS solid medium. The culture was incubated at 28°C for 7 days, and the growth of the test bacteria on the medium was observed. The appearance of an orange ring around the colony indicated siderophore production. The inner and outer diameters of the orange ring were recorded. The results showed that Streptomyces fuscaensis produced siderophores. The results are shown in Table 2.
[0063] Example 4 Determination of the ability of Streptomyces spp. to produce auxin
[0064] The ability to produce auxin (IAA) was determined by the Salkowski colorimetric method.
[0065] Auxin production: Inoculate the test strain Streptomyces serrata XZ17 into liquid Gao's medium No. 1 containing 0.5 g / L tryptophan. Cultivate at 28°C and 220 rpm for 7 days to obtain a fermentation broth of Streptomyces serrata XZ17. Centrifuge the broth at 12,000 rpm for 2 minutes to obtain the fermentation supernatant.
[0066] Prepare Salkowski colorimetric solution: Mix 1 mL of 0.5 mol / L FeCl₃ with 35% HClO₃ and store in the dark. Add 1 mL of fermentation supernatant from Streptomyces fuscaensis XZ17 and 2 mL of Salkowski colorimetric solution to five new sterile test tubes. A blank culture medium is used as a control. Incubate the tubes in the dark at room temperature for 30 minutes and observe their color. If the color turns red, auxin is produced. Measure the OD value at 530 nm.
[0067] Weigh 0.010 g of pure IAA and dissolve it in a small amount of ethanol. The volume was then adjusted to 100 mL with distilled water to create a stock solution with a concentration of 100 μg / mL. Serial dilutions of the stock solution were prepared with distilled water at concentrations of 0, 5, 10, 15, 20, 25, 30, 35, and 40 μg / mL. Nine sterile test tubes were sequentially added with 1 mL of the IAA dilution solution and 2 mL of Salkowski colorimetric solution, mixed thoroughly, and incubated at room temperature in the dark for 30 minutes. The absorbance of the various IAA concentrations at a wavelength of 530 nm was measured using a UV spectrophotometer. The results showed that Streptomyces styracifluum XZ17 was capable of synthesizing auxin. The IAA content in the fermentation broth of Streptomyces styracifluum XZ17 was 8.7 μg / mL (see Table 2 for details).
[0068] Example 5 Determination of the ability of Streptomyces spp. XZ17 to promote seed radicle growth
[0069] The fermentation supernatant of Streptomyces serrata XZ17 was diluted 10-fold, 100-fold, and 1000-fold with sterile water. 5 mL of each of the fermentation solution, 10-fold, 100-fold, and 1000-fold dilutions were transferred to sterile test tubes. Gao's medium (GA) No. 1 was used as a control. Twenty-four seeds of Hezuo 903 tomato and Jinyan No. 4 cucumber, each of which had the same plumpness, were placed in each test tube. The seeds were soaked in the dark at room temperature (approximately 25°C) for 12 hours. After discarding the soaking solution, the seeds were removed and dried with absorbent paper. Eight seeds were placed in each dish, evenly spaced, in Petri dishes lined with sterile filter paper. Three replicates were used for each treatment. The filter paper was soaked with sterile water, and the dishes were covered and incubated in the dark at approximately 25°C for 72 hours. Radicle length was measured after germination. During the incubation period, water evaporation from the filter paper in the Petri dishes was checked daily, and water was added if insufficient. The experimental results are shown in Table 5.
[0070] Table 5 Effects of Streptomyces spp. fermentation broth on radicle length (mm) of cucumber and tomato
[0071]
[0072]
[0073] Example 6 Determination of the ability of Streptomyces spp. XZ17 to promote root and stem growth
[0074] Sixty days after inoculation with root-knot nematodes, the tomato plants were carefully removed from their pots and their roots were gently washed with tap water. The fresh weights of the stems and leaves and the roots were weighed. Plant height, stem diameter, and root length were measured, and photographs were taken. The effect of the fermentation liquid of Streptomyces styracifluum XZ17 on the biomass of the tomato plants was calculated. The experimental results are shown in Table 6.
[0075] Table 6 Growth-promoting effect of Streptomyces spp. XZ17 on tomatoes
[0076]
[0077] Note: The same lowercase letters in the same column indicate no significant difference between the groups, and different lowercase letters indicate significant difference between the groups (P < 0.05).
[0078] In summary, the strain Streptomyces fuscae XZ17 screened in this study produces compounds with nematicidal activity, demonstrating a strong lethal effect against plant-parasitic nematodes. The strain achieved a 48-hour adjusted mortality rate of 90.6% against the southern root-knot nematode and 29.2% against the sweet potato stem nematode. The strain significantly inhibited the reproduction of the southern root-knot nematode, reducing the number of root knots and disease index. The strain treated with Streptomyces fuscae XZ17 reduced the number of egg masses, female worms, root knots, and disease index per plant by 58.8%, 55.5%, 40.9%, and 50.0%, respectively, compared to the control. The strain achieved a 50.1% efficacy against the southern root-knot nematode, slightly lower than the 70.0% efficacy of the chemical nematode thiazolyl.
[0079] Streptomyces fuscae XZ17 also produces the auxin indoleacetic acid and the growth-promoting chemical siderophore, both of which promote plant growth. When the fermentation broth was diluted 10-fold, it increased the radicle length of cucumbers and tomatoes by 50.0% and 64.0%, respectively, compared to the control. The root length and fresh weight of potted tomatoes increased by 19% and 26%, respectively, compared to the control.
Claims
1. A strain of Streptomyces serratus XZ17, characterized by: The name of the brown-gray-yellow Streptomyces XZ17 is Streptomyces phaeoluteigriseus XZ17, and the brown-gray-yellow Streptomyces XZ17 has been deposited in the China Center for Type Culture Collection on May 17, 2024, and the preservation number is CCTCC NO: M 2024977.
2. The fermentation liquid obtained based on the Streptomyces serrata XZ17 according to claim 1.
3. The supernatant of the fermentation broth obtained based on the Streptomyces spp. XZ17 according to claim 1.
4. Use of the fermentation liquid obtained by the Streptomyces fruticosus XZ17 according to claim 1, the Streptomyces fruticosus XZ17 according to claim 2, and / or the supernatant of the fermentation liquid obtained by the Streptomyces fruticosus XZ17 according to claim 3 in the preparation of a parasitic nematode control agent and / or in controlling parasitic nematodes.
5. The use according to claim 4, characterized in that: The parasitic nematode is a plant-parasitic nematode.
6. The use according to claim 5, characterized in that: The parasitic nematode is root-knot nematode, Ditylenchus elegans and / or Caenorhabditis elegans.
7. The use according to claim 6, characterized in that: The parasitic nematode is the southern root-knot nematode.
8. The use according to claim 4, 5, 6 or 7, characterized in that: The control in the application is to control the growth of parasitic nematodes, control the reproduction of nematodes or kill the parasitic nematodes.
9. Use of the fermentation liquid obtained by the Streptomyces fruticosus XZ17 according to claim 1, the Streptomyces fruticosus XZ17 according to claim 2, and / or the supernatant of the fermentation liquid obtained by the Streptomyces fruticosus XZ17 according to claim 3 in promoting plant growth.
10. The use according to claim 9, characterized in that: The fermentation broth obtained by the Streptomyces fruticosus XZ17 according to claim 1, the Streptomyces fruticosus XZ17 according to claim 2, and / or the supernatant of the fermentation broth obtained by the Streptomyces fruticosus XZ17 according to claim 3 can synthesize indoleacetic acid and siderophore.