Recombinant escherichia coli for synthesizing glycine and application thereof

Abstract

The invention provides gene recombinant escherichia coli for synthesizing glycine by using cheap raw materials such as fatty acid and glucose and application of the gene recombinant escherichia coli. The recombinant bacterium contains one or more of the following genetic modifications: knockout or function down-regulation of a tdh gene, a tdcB gene and a gcvP gene; inserting or introducing an ltaE gene; the iclR gene, the sucA gene and the aspC gene are knocked out or down-regulated in function; insertion or introduction of an aspA gene, a thrA gene, a thrB gene and a thrC gene; the fadR gene, the FabF gene and the FabH gene are knocked out or down-regulated in function; the method comprises the following steps of: inserting or introducing an FadD gene, an FadL gene, an atoS gene, an atoC gene and an MhalkL gene; the recombinant Escherichia coli has the prospect of green, efficient and industrial production of amino acid by utilizing the capability of synthesizing glycine from relatively cheap raw materials.

Description

Technical Field

[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial whole-cell catalysis technology, and specifically to a recombinant Escherichia coli for synthesizing glycine using L-threonine and applications thereof. Background Art

[0002] Glycine is the simplest naturally occurring amino acid, boasting advantages such as low molecular weight, simple structure, and high stability. In vivo, glycine not only participates in protein synthesis but also plays a vital role in neurotransmitter regulation, metabolic homeostasis, and cell signaling. In recent years, with the rapid development of biopharmaceuticals, food additives, chemical raw materials, and other fields, glycine, as a key intermediate and functional raw material, has seen continued growth in market demand and a widening range of applications.

[0003] Traditional methods for preparing glycine rely on chemical synthesis, primarily based on the reaction of chloroacetic acid with ammonia to generate glycine via nucleophilic substitution. This method requires strict control of reaction conditions to minimize byproducts. Alternatively, the Strecker chemical synthesis pathway utilizes formaldehyde, ammonia, and cyanide to generate α-aminonitrile, which is then hydrolyzed to yield glycine. However, due to the involvement of toxic intermediates, this approach requires higher safety standards.

[0004] With the continuous advancement of genetic engineering and synthetic biology, the biosynthesis of glycine using genetically modified bacteria has become a green and environmentally friendly approach. However, existing biosynthesis technologies often suffer from issues such as high byproduct counts, low yields of the target product, and poor catalyst stability, making them difficult to meet the requirements of large-scale, continuous industrial synthesis. Therefore, there is an urgent need for a low-cost microbial fermentation technology for the production of bio-based glycine.

[0005] Glucose, a major industrial raw material, is inexpensive and readily available, making it suitable for large-scale fermentation production and reducing industrial costs. The regulatory mechanisms of glucose metabolism in Escherichia coli are well-defined, allowing for targeted enhancement of glycine synthesis through genetic modification while leveraging glucose's high energy efficiency to mitigate acetate accumulation. Fed-batch fermentation strategies based on glucose allow for precise control of the carbon-nitrogen ratio, maintaining a balance between bacterial growth and product synthesis, and improving yields. Oils and fats are rich in carbon and energy, generating large amounts of acetyl-CoA through the β-oxidation pathway, providing ample precursors and energy for glycine biosynthesis. Compared to sugars, oils and fats produce fewer byproducts during metabolism, helping to focus metabolic flux on the glycine synthesis pathway and improving product yields. Many oil and fat feedstocks can be derived from renewable resources, such as vegetable oils or waste oils, aligning with green production and reducing environmental burden. De novo synthesis of glycine from inexpensive glucose or fatty acids (particularly food waste oils and fats) holds great promise for future applications. Summary of the Invention

[0006] Due to the high pollution of chemical methods and the high cost of current microbial fermentation methods, there is an urgent need to develop an efficient biosynthesis method for glycine.

[0007] The technical problem to be solved by the present invention is to provide a stable strain for preparing glycine using cheap substrates such as glucose and oil.

[0008] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Escherichia coli for synthesizing glycine using L-threonine, comprising the following modifications:

[0009] Knockout or inhibitory expression of a gene cluster (1), wherein the gene cluster (1) comprises a gene encoding a threonine dehydrogenase tdh, a gene encoding a threonine dehydratase tdcB, and a gene encoding a glycine decarboxylase gcvP; and

[0010] Insertion or enhanced expression of a gene cluster (2), wherein the gene cluster (2) comprises: a gene encoding L-threonine aldolase ltaE.

[0011] Knockout or inhibitory expression of a gene cluster (3), wherein the gene cluster (3) comprises a gene encoding a glyoxylate pathway transcriptional repressor iclR, a gene encoding an α-ketoglutarate decarboxylase sucA, and a gene encoding an aspartate aminotransferase aspC;

[0012] Insertion or enhanced expression of a gene cluster (4), wherein the gene cluster (4) comprises: a gene encoding aspartate lyase aspA, a gene encoding aspartate kinase thrA, a gene encoding homoserine kinase thrB, and a gene encoding threonine synthase thrC.

[0013] Knockout or inhibitory expression of a gene cluster (5), wherein the gene cluster (5) comprises a gene encoding a fatty acid degradation transcription factor fadR, a gene encoding a β-ketoacyl-ACP synthase II fabF, and a gene encoding a β-ketoacyl-ACP synthase III fabH;

[0014] Insertion or enhanced expression of a gene cluster (6), wherein the gene cluster (6) comprises: a gene encoding acyl-CoA synthase fadD, a gene encoding a long-chain fatty acid transport protein fadL, genes encoding a short-chain fatty acid degradation regulatory gene cluster atoS and atoC, and a gene encoding an alkane uptake outer membrane protein MahalkL.

[0015] Preferably, the recombinant E. coli further comprises the following modifications:

[0016] Insertion or enhanced expression of the gene encoding the L-threonine transporter tdcC.

[0017] Preferably, the recombinant E. coli further comprises the following modifications:

[0018] Insertion or enhanced expression of the gene encoding acetaldehyde dehydrogenase eutE.

[0019] Preferably, the expression of the gene encoding the L-threonine transporter tdcC and the gene encoding the acetaldehyde dehydrogenase eutE is enhanced by replacing the promoter, preferably by replacing the promoter with P 119 promoter to enhance expression.

[0020] Preferably, the encoding product of the gene encoding threonine dehydrogenase tdh is shown in SEQ ID NO. 4;

[0021] Preferably, the encoding product of the gene encoding threonine dehydratase tdcB is shown in SEQ ID NO. 5;

[0022] Preferably, the encoding product of the gene encoding glycine decarboxylase gcvP is shown in the sequence SEQ ID NO. 6; and

[0023] Preferably, the encoding product of the gene encoding L-threonine aldolase ltaE is shown in the sequence SEQ ID NO. 3.

[0024] Preferably, the encoding product of the gene encoding the L-threonine transporter tdcC is shown in the sequence SEQ ID NO. 7.

[0025] Preferably, the encoding product of the gene encoding acetaldehyde dehydrogenase eutE is shown in the sequence SEQ ID NO. 8.

[0026] Preferably, the encoding product of the gene encoding the isocitrate lyase inhibitor iclR is shown in the sequence SEQ ID NO.11;

[0027] Preferably, the encoding product of the gene encoding α-ketoglutarate decarboxylase sucA is shown in SEQ ID NO. 12;

[0028] Preferably, the encoding product of the gene encoding aspartate aminotransferase aspC is shown in the sequence SEQ ID NO. 13.

[0029] Preferably, the expression of the aspartate lyase gene aspA is enhanced by replacing the promoter, preferably by replacing the promoter with P CPA1 Promoter to enhance expression, more preferably, the P CPA1 As shown in SEQ ID No.9;

[0030] Preferably, the C at position 1034 of the gene for editing aspartate kinase thrA is mutated to T, and the encoded product is shown in SEQ ID NO. 15;

[0031] Preferably, the encoding product of the gene encoding homoserine kinase thrB is shown in SEQ ID NO. 16; and

[0032] Preferably, the encoding product of the gene encoding threonine synthase thrC is shown in the sequence SEQ ID NO. 17.

[0033] Preferably, the encoding product of the gene encoding the fatty acid degradation transcription factor fadR is shown in SEQ ID NO. 18;

[0034] Preferably, the encoding product of the gene encoding β-ketoacyl-ACP synthase II fabF is shown in SEQ ID NO. 19;

[0035] Preferably, the encoding product of the gene encoding β-ketoacyl-ACP synthase III fabH is shown in SEQ ID NO.20;

[0036] Preferably, the encoding product of the gene encoding acyl-CoA synthase fadD is shown in SEQ ID NO. 21;

[0037] Preferably, the encoding product of the gene encoding the long-chain fatty acid transport protein fadL is shown in SEQ ID NO. 22;

[0038] Preferably, the encoding products of the genes encoding the short-chain fatty acid degradation regulatory gene clusters atoS and atoC are shown in SEQ ID NOs. 23 and 24;

[0039] Preferably, the encoding product of the gene encoding the alkane uptake outer membrane protein MhalkL is shown in the sequence SEQ ID NO. 25.

[0040] The recombinant E. coli described above can be obtained from the following E. coli: E. coli MG1655, E. coli BW25113, and E. coli MC02 (CGMCC No. 34378). MG1655 and BW25113 can be obtained from the Yale University Escherichia coli Genetic Collection (CGSC), and MC02 can be obtained from CGMCC.

[0041] According to an exemplary embodiment of the present disclosure, the present disclosure provides use of the recombinant Escherichia coli described in any one of the aforementioned items in producing glycine.

[0042] According to an exemplary embodiment of the present disclosure, the present disclosure provides a method for synthesizing glycine, using the recombinant Escherichia coli according to any one of the aforementioned items to perform whole-cell catalytic synthesis of glycine.

[0043] Through at least one aspect of the above disclosure, the present disclosure provides a precursor by producing L-threonine based on glucose or fatty acid raw materials. L-threonine can ultimately produce glycine and acetaldehyde through an enzymatic reaction, and acetaldehyde is further converted into acetyl-CoA by acetaldehyde dehydrogenase. Glycine synthesized via the L-threonine pathway can be used as an intermediate and directly used in the production of downstream high-value compounds. The acetyl-CoA produced simultaneously can be used to synthesize high-value-added compounds such as polyketides and isoprene, forming a "one carbon, two uses" circular economy model, achieving green, economical, and efficient results. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0045] Figure 1This is a nucleic acid gel image of colony PCR identification results. Lane 6: DNA Marker; Lanes 1 to 5 show rapid PCR verification results for strains TG01-kan to TG05-kan, and Lanes 7 to 11 show rapid PCR verification results for strains TG01 to TG05. DNA Marker was purchased from Lablead (Cat. No. L1000P). The bands, from top to bottom, indicate molecular weights of 12,000, 8,000, 6,000, 5,000, 4,000, 3,000, 2,500, 2,000, 1,500, 1,000, 750, 500, and 250 bp, respectively.

[0046] Figure 2 This is a nucleic acid gel image of colony PCR identification results. Lane 12: DNA Marker; Lanes 1 to 11 show rapid PCR verification results for strains TG07-kan to TG10-kan, and TG12-kan to TG18-kan; Lanes 13 to 23 show rapid PCR verification results for strains TG07 to TG10, and TG12 to TG18. DNA Marker was purchased from Lablead (Cat. No. L1000P). Bands indicate molecular weights of 12,000, 8,000, 6,000, 5,000, 4,000, 3,000, 2,500, 2,000, 1,500, 1,000, 750, 500, and 250 bp, respectively, from top to bottom.

[0047] Figure 3 The glycine production of the recombinant E. coli engineered strain using L-threonine as raw material.

[0048] Figure 4 Glycine production of recombinant E. coli engineered strain using glucose as raw material.

[0049] Figure 5 Glycine production of recombinant E. coli engineered strains using fatty acids as feedstock. DETAILED DESCRIPTION

[0050] definition

[0051] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0052] Throughout this specification and the appended claims, the words "comprise" and "include" and variations thereof should be interpreted inclusively. That is, these words are intended to convey that other elements or integers not specifically listed may be included, where the context permits.

[0053] The articles "a / an" are used herein to refer to one / a or more than one / more than a (i.e., one / an or at least one / at least one) grammatical object of the article. For example, "an element / an element" can mean one element / an element or more than one element / more than one element. When nouns (e.g., compounds, additives, etc.) are referred to in the singular, the plural is intended to be included. Thus, when referring to a particular part (e.g., "a gene"), this means "at least one" of the gene, e.g., "at least one gene," unless otherwise specified.

[0054] Unless explicitly indicated otherwise, the various embodiments of the invention described herein may be cross-combined.

[0055] The term "carbon source" refers to a source of carbon, preferably a compound or molecule containing carbon. Preferably, the carbon source is a carbohydrate, an amino acid and its derivatives, etc. In this article, a carbon source is understood to be an organic compound composed of the elements carbon, oxygen and hydrogen.

[0056] The term "cell" refers to a eukaryotic or prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be a recombinant Escherichia coli. That is, the recombinant cell is selected from a cell population of the genus consisting of Escherichia coli.

[0057] As used herein, the term "recombination" / "engineered" (e.g., mentioning "recombinant E. coli," "recombinant cell," "recombinant microorganism," and / or "recombinant strain") can refer to cells, microorganisms, or strains containing nucleic acids that are the result of one or more genetic modifications. Briefly, cells, microorganisms, or strains contain different combinations of nucleic acids from one or more parents (any of which). In order to construct recombinant cells, microorganisms, or strains, one or more recombinant DNA techniques and / or one or more other mutagenesis techniques can be used. For example, recombinant E. coli and / or recombinant E. coli cells can comprise nucleic acids that are not present in corresponding wild-type E. coli and / or cells, recombinant DNA techniques have been used to introduce this nucleic acid into this E. coli or E. coli cells (i.e., transgenic E. coli and / or cells), or this nucleic acid that is not present in the wild-type E. coli and / or cells is the result of one or more mutations (e.g., using recombinant DNA techniques or another mutagenesis technique such as UV irradiation) in the nucleotide sequence (such as a gene encoding a wild-type polypeptide) present in the wild-type E. coli and / or E. coli cells. Furthermore, the term "recombinant" may suitably refer to a cell, microorganism or strain from which a nucleic acid sequence has been removed, for example using recombinant DNA techniques.

[0058] In this article, the recombinant E. coli comprising or having a certain activity is understood to mean that the recombinant E. coli may comprise one or more nucleic acid sequences encoding a protein having such activity, thereby allowing the recombinant E. coli to functionally express such a protein or enzyme.

[0059] The term "functionally expressed" means that there is functional transcription of the relevant nucleic acid sequence, allowing the nucleic acid sequence to actually be transcribed, for example resulting in the synthesis of a protein.

[0060] As used herein, the term "transgenic" (e.g., with reference to "transgenic E. coli" and / or "transgenic cells") refers to E. coli and / or cells, respectively, that contain a nucleic acid that is not naturally present in the E. coli and / or cells and that has been introduced into the E. coli and / or cells using, for example, recombinant DNA techniques, such as recombinant yeast and / or cells.

[0061] As used herein with respect to a protein or polypeptide, the term "mutation" means that at least one amino acid has been replaced, inserted into, or deleted from an amino acid sequence compared to a wild-type or naturally occurring protein or polypeptide sequence. Amino acid substitution, insertion, or deletion can be achieved, for example, via mutagenesis of nucleic acids encoding these amino acids. Mutagenesis is a method well known in the art and includes, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis, as described in Sambrook et al., Molecular Cloning-A Laboratory Manual, 2nd edition, Vols. 1-3 (1989), published by Cold Spring Harbor Publishing.

[0062] As used herein with respect to a gene, the term "mutation" means that at least one nucleotide in the nucleic acid sequence of a gene or its regulatory sequence has been replaced, inserted into, or deleted from a nucleic acid sequence by a different nucleotide compared to a wild-type or naturally occurring nucleic acid sequence. The replacement, insertion, or deletion of an amino acid can be achieved, for example, via mutagenesis, resulting in, for example, the transcription of a protein sequence having a qualitatively or quantitatively altered function or the knockout of the gene. In the context of the present invention, "altered gene" has the same meaning as a mutant gene.

[0063] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a protein refers to one or more nucleic acid sequences encoding the protein.

[0064] As used herein, the term "nucleic acid" or "nucleotide" refers to a monomeric unit in a deoxyribonucleotide or ribonucleotide polymer (i.e., a polynucleotide) in a single-stranded or double-stranded form, and unless otherwise limited, encompasses known analogs with the essential properties of natural nucleotides because they hybridize with single-stranded nucleic acids (e.g., peptide nucleic acids) in a manner similar to naturally occurring nucleotides. For example, an enzyme defined by a nucleotide sequence encoding an enzyme includes (unless otherwise limited) a nucleotide sequence that hybridizes with a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full length or subsequence of a natural or heterologous structure or regulatory gene. Unless otherwise indicated, the term includes reference to a specified sequence and its complementary sequence. Therefore, a DNA or RNA with a modified backbone for stability or other reasons is a term "polynucleotide" as intended herein. In addition, a DNA or RNA comprising rare bases (such as inosine) or modified bases (such as tritylated bases) (to give only two examples) is a term polynucleotide as used herein. It will be understood that a variety of modifications have been made to DNA and RNA for many useful purposes known to those skilled in the art. The term polynucleotide as used herein includes such chemically, enzymatically, or metabolically modified forms of the polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).

[0065] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0066] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, such as those exhibited by an amino acid sequence. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. An essential property of such analogues of naturally occurring amino acids is that, when incorporated into a protein, the protein is specifically reactive with antibodies elicited against a protein composed entirely of the same naturally occurring amino acids. The terms "polypeptide," "peptide," and "protein" also include modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0067] The term "enzyme" refers to a protein with catalytic function in this article. In the case of a certain biological reaction of protein catalysis, the terms "protein" and "enzyme" can be used interchangeably in this article. When enzymes are mentioned with reference to enzymes (EC), enzymes are such classifications, wherein enzymes are classified or can be classified according to the enzyme nomenclature provided by the International Union of Biochemistry and Molecular Biology Nomenclature Committee (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . It is intended to include other suitable enzymes that have not yet been classified in a given category but can be so classified.

[0068] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, that number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0069] Each nucleic acid sequence encoding a polypeptide herein also includes any conservatively modified variants thereof. By reference to the genetic code, this includes, it describes every possible silent variation of nucleic acid. The term "conservatively modified variant" is applicable to both amino acid and nucleic acid sequences. With regard to a specific nucleic acid sequence, conservatively modified variants refer to those nucleic acids encoding identical amino acid sequences or conservatively modified amino acid sequence variants due to the degeneracy of the genetic code. The term "degeneracy of the genetic code" refers to the fact that a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Therefore, at each position where a codon specifies alanine, the codon can be changed to any described corresponding codon without changing the encoded polypeptide. This type of nucleic acid variation is a "silent variation" and represents a conservatively modified variation.

[0070] As used herein, the term "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence or a gene having a specific sequence (e.g., "SEQ ID NO: X") refers to a polypeptide and / or amino acid sequence comprising the specific sequence, or refers to a nucleic acid sequence comprising a polypeptide and / or amino acid sequence encoding the specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added and / or inserted, and the polypeptide has (qualitatively) the same enzymatic function for substrate conversion.

[0071] As used herein, the term "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO: X") refers to a polynucleotide and / or nucleic acid sequence comprising the specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and that the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and that encode the same polypeptide sequence.

[0072] Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Typically, sequence identity or similarity is compared over the entire length of the compared sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.

[0073] When an amino acid or nucleotide sequence exhibits a certain level of similarity, it is said to be homologous. Two sequences being homologous indicate a common evolutionary origin. Whether two homologous sequences are closely related or more distantly related is indicated by a "percent identity" or "percent similarity," which is high or low, respectively. Although controversial, "level of homology" or "percent homology" are often used interchangeably to indicate "percent identity" or "percent similarity." Comparison of sequences and determination of the percent identity between two sequences can be accomplished using mathematical algorithms. The skilled artisan will be aware of the fact that several different computer programs are available for aligning two sequences and determining homology between them (Kruskal et al., "An overview of sequence comparison: Time warps, string edits, and macromolecules", (1983), Society for Industrial and Applied Mathematics (SIAM), Vol. 25, No. 2, pp. 201-237, and in the handbook edited by D. Sankoff and J.B. Kruskal (eds.), "Time warps, string edits and macromolecules: the theory and practice of sequence comparison", (1983), pp. 1-44, published by Addison-Wesley Publishing Company, Massachusetts USA).

[0074] The percent identity between two amino acid sequences can be determined by aligning two sequences using the Needleman and Wunsch algorithm (Needleman et al. "A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins" (1970) J. Mol. Biol. 48, 443-453). This algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purposes of the present invention, the NEEDLE program from the EMBOSS package (version 2.8.0 or higher, see Rice et al., "EMBOSS: The European Molecular Biology Open Software Suite", (2000), Trends in Genetics, Vol. 16, (6) pp. 276-277, http: / / emboss.bioinformatics.nl / ) is used. For protein sequences, EBLOSUM62 is used as the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices may be specified. Optional parameters for amino acid sequence alignments are a gap opening penalty of 10 and a gap extension penalty of 0.5. The skilled person will appreciate that all of these different parameters will produce slightly different results, but the overall percent identity of the two sequences does not change significantly when different algorithms are used.

[0075] Homology or identity is the percentage of identical matches between two complete sequences over the total aligned area including any gaps or extensions. Homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing identical amino acids in the two sequences divided by the total length of the alignment including gaps. Identity as defined herein can be obtained from NEEDLE and is labeled "IDENTITY" in the program's output.

[0076] The homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing the identical amino acid in the two sequences divided by the total length of the alignment after subtracting the total number of gaps in the alignment. Identity as defined herein can be obtained from NEEDLE using the NOBRIEF option and is labeled "longest-identity" in the program's output.

[0077] Variants of the nucleotide or amino acid sequences disclosed herein may also be defined as nucleotide or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0078] Optionally, when determining the degree of amino acid similarity, the skilled person may also consider so-called "conservative" amino acid substitutions, which will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, a group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids with aliphatic-hydroxy side chains is serine and threonine; a group of amino acids with amide-containing side chains is asparagine and glutamine; a group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids with basic side chains is lysine, arginine, and histidine; and a group of amino acids with sulfur-containing side chains is cysteine and methionine. In one embodiment, a conservative amino acid substitution group is: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are variants in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid changes are conservative. In one embodiment, conservative substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0079] The nucleotide sequences of the present invention can also be defined by their ability to hybridize to portions of the specific nucleotide sequences disclosed herein, respectively, under moderate hybridization conditions or, preferably, under stringent hybridization conditions. Stringent hybridization conditions are defined herein as conditions that allow a nucleic acid sequence of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, most preferably about 200 or more nucleotides to hybridize at a temperature of about 65° C. in a solution comprising about 1M salt (preferably 6xSSC or any other solution with comparable ionic strength), and washed at 65° C. in a solution comprising about 0.1M or less salt (preferably 0.2x SSC or any other solution with comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow a nucleic acid sequence of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize at a temperature of about 45° C. in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength) and washed at room temperature in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with up to 50% sequence identity. One skilled in the art will be able to modify these hybridization conditions to specifically identify sequences with identities varying between 50% and 90%.

[0080] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), and subsequent translation into protein.

[0081] "Overexpression" refers to the expression of a gene (corresponding to a nucleic acid sequence) by a recombinant cell in excess of its expression in a corresponding wild-type cell. Such overexpression can be achieved, for example, by increasing the frequency of transcription of one or more nucleic acid sequences, for example by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a nucleic acid sequence.

[0082] The term "upregulation" and its variants refer to a process by which a cell increases the amount of a cellular component, such as RNA or protein. Such upregulation can be in response to or caused by a genetic modification.

[0083] The term "pathway" or "metabolic pathway" is understood herein as a series of chemical reactions that build and break down molecules in a cell.

[0084] The nucleic acid sequence (ie, polynucleotide) or protein (ie, polypeptide) may be native or heterologous to the genome of the host cell.

[0085] "Native," "homologous," or "endogenous" with respect to a host cell means that the nucleic acid sequence does exist naturally in the genome of the host cell, or that the protein is naturally produced by the cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0086] As used herein, "heterologous" or "exogenous" can refer to nucleic acid sequences or proteins. For example, with respect to host cells, "heterologous" can refer to polynucleotides that are not naturally present in the genome of the host cell in this way, or polypeptides or proteins that are not naturally produced by the cell in this way. A heterologous nucleic acid sequence is a nucleic acid derived from an alien species, or if from the same species, it is substantially modified in composition and / or genomic locus relative to its native form by deliberate human intervention. For example, a promoter operably linked to a natural structural gene is from a species different from the species from which the structural gene was derived, or if from the same species, one or both are substantially modified relative to their original form. A heterologous protein can be derived from an alien species, or if from the same species, it is substantially modified relative to its original form by deliberate human intervention. In other words, heterologous protein expression relates to the expression of a protein that is not naturally expressed in this way in a host cell. The term "heterologous expression" refers to the expression of heterologous nucleic acids in a host cell. The expression of heterologous proteins in eukaryotic host cell systems (such as Escherichia coli) is well known to those skilled in the art. Polynucleotides containing nucleic acid sequences encoding genes for proteins or enzymes having specific activities can be expressed in such eukaryotic systems. In some embodiments, transformed / transfected cells can be used as expression systems for expressing enzymes. The expression of heterologous proteins in E. coli is well known. Published by Cold Spring Harbor Laboratory, is a recognized work describing various methods for expressing proteins in E. coli.

[0087] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Suitably, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible or repressible. In one embodiment, no (external) inducer is required.

[0088] As used herein, the term "vector" includes reference to autosomal expression vectors and integration vectors for integration into a chromosome.

[0089] The term "expression vector" refers to a linear or circular DNA molecule comprising a segment encoding a polypeptide of interest, which segment is under the control of (i.e., operably linked to) another nucleic acid segment that provides for its transcription. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, and the like. Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both.

[0090] "Plasmid" refers to autonomously replicating extrachromosomal DNA that is not integrated into the genome of a microorganism and is typically circular in nature.

[0091] "Host cell" is understood herein to be a cell (such as an E. coli cell) that is transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, a transformed cell can contain a vector and can support replication and / or expression of the vector.

[0092] As used herein, "conversion" refers to that exogenous polynucleotides are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome. As used herein, "conversion" refers to that exogenous polynucleotides (i.e., exogenous nucleic acid sequence) are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome.

[0093] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0094] In the following examples, Escherichia coli BW25113 (Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000; 97(12):6640-6645.) is a non-pathogenic bacterium with a clear genetic background, a short generation time, easy cultivation, and low-cost culture medium raw materials.

[0095] It will be understood by those skilled in the art that the genes disclosed herein or their functional homologs comprise nucleic acid sequences having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the exemplified sequences, or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions when compared to the amino acid sequences encoded thereby.

[0096] Preferably, the amino acid sequence encoded by any functional homolog of a gene has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 amino acid mutations, substitutions, insertions and / or deletions compared to the amino acid sequence encoded by a gene.

[0097] By way of example and not limitation, a functional homolog of the gene set forth in SEQ ID NO. 3 comprises a nucleic acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to any of those nucleic acid sequences, or a functional homolog thereof comprises a nucleic acid sequence having one or more mutations, substitutions, insertions and / or deletions when compared to any of those nucleic acid sequences; preferably, the nucleic acid sequence of any such functional homolog has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 nucleic acid mutations, substitutions, insertions and / or deletions compared to such nucleic acid sequence. More preferably, the functional homolog of the gene shown by SEQ ID NO.3 comprises an amino acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with the polypeptide displayed by SEQ ID NO.3.

[0098] Those skilled in the art will appreciate that other sequences include the above situations.

[0099] Unless otherwise specified herein, the nouns and terms used herein should be understood in accordance with the common knowledge and usage of persons of ordinary skill in the art. Unless otherwise noted, the specific operating methods employed in this application (including preparation processes, experimental procedures, detection methods, etc.) employ conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (e.g., recombinant DNA technology), zoology experiments, and related techniques in the art. These techniques are well described in the existing literature, see Sam Brook et al., Molecular Cloning: a Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Publishing, updated from time to time; Kursad Turksen et al., Embryonic Stem Cell Protocols, 3rd edition, Springer, 2016; P. Nagarajan et al., Essentials of Laboratory Animal Science: Principles and Practices, Springer, 2021; and Jann Hau et al., Handbook of Laboratory Animal Science: Essential Principles and Practices, 4th edition, CRC Press, 2021.

[0100] The primer sequences in the following examples are as follows:

[0101] Table 1 Primer sequences

[0102] Primer name Sequence (5'-3') Remark tdh-1 <![CDATA[aattacgcgtgcagtagaagcatttacgcgtattggtaaacaactgggcgttatcgcctgaggatgtgag ATTCCGGGGATCCGTCGACC ]]> TDH knockout tdh-2 <![CDATA[ctgacaggattttacatatttaacagattatcctcagataaaagggctggaataccagcccttgttcgtg TGTAGGCTGGAGCTGCTTCG ]]> TDH knockout tdh-3 ggtcgaagcgggcagcgaactg Verification of tdh knockout kan-R TTAGAAGAACTCGTCAAGAAGGCGATAGAA Verification of gene knockout tdcB-1 <![CDATA[tccacctgtctgtcttgcaggtgtcggttacggttacctacatatttaattcaggcgaagaggttttata ATTCCGGGGATCCGTCGACC ]]> tdcB knockout tdcB-2 <![CDATA[aggacgattgttttgtctggctggatacaatgctatctgaagtactcatatcctatcctcaacgaattaa TGTAGGCTGGAGCTGCTTCG ]]> tdcB knockout tdcB-3 gatatgacgtcaccttttgg Verification of tdcB knockout gcvp-1 <![CDATA[tgcctcaccctcactctcttcgtaaggagagaggttcacaattcactgcacgtttcaggaaccatcgctc ATTCCGGGGATCCGTCGACC ]]> Knockout of gcvP gcvp-2 <![CDATA[gcacttttgtactttgtcatctgactaaaaaggcgccgaagcgcctttagaaaatagtcgaatcagtgaa TGTAGGCTGGAGCTGCTTCG ]]> Knockout of gcvP gcvp-3 ggtaaaagcggcgtcagacatttatgc Verification of gcvP knockout tdcC up tattatttccggcggcaatatcgatctttctcgcgtctctcaaatcaccggtttcgttgacgcttaa Enhance tdcC tdcC down atgagtacttcagatagcattgtatccagccagacaaaacaatcgtcctggcgtaaatcagataccacat Enhance tdcC tdcC-1 tattatttccggcggcaat Enhance tdcC tdcC-2 atgtggtatctgatttacgccag Enhance tdcC tdcC-3 acggactggcgcatgacaaattg Verification of tdcC enhancement eutE up ggtcgatctgtgcgtgattggcattgtcgatgaggtggtgtctggcggtcaggtaattttccacaaataa Strengthen eutE eutE down atgaatcaacaggatattgaacaggtggtgaaagcggtactgctgaaaatgcaaagcagtgacacgccgt Strengthen eutE eutE-1 ggtcgatctgtgcgtgattggcat Strengthen eutE eutE-2 acggcgtgtcactgctttgca Strengthen eutE eutE-3 acggactggcgcatgacaaattgc Verify eutE enhancement ltaE-1F <![CDATA[Aatttcacacaggaaacaga atgattgatttacgcagtgatacc ]]> Plasmid construction ltaE-1R <![CDATA[Gcatgcctgcaggtcgactc ttaacgcgccaggaatgcacgcc ]]> Plasmid construction pTrc99a-01F gagtcgacctgcaggcatgcaagcttggct Plasmid construction pTrc99a-01R tctgtttcctgtgtgaaattgttatccgct Plasmid construction RV-M TTATGAATCGTCGTGCAGATCTGGTTCATA Plasmid construction verification pTrcHis-R attctgttttatcagaccgcttctgcgttc Plasmid construction verification fadR-1 <![CDATA[GCTATCAGCGTAGTTAGCCCTCTGGTATGATGAGTCCAACTTTGTTTTGCTGTGTTATGGAAATCTCACT ATTCCGGGGATCCGTCGACC ]]> Knockout of fadR fadR-2 <![CDATA[AAGAATGGGAAATCTGTAAAAACAACAAAAAACCCCTCGTTTGAGGGGTTTGCTCTTTAAACGGAAGGGA TGTAGGCTGGAGCTGCTTCG ]]> Knockout of fadR fadR-3 agccttgatccctttttcttctttttgtct Validation of fadR knockout fabF-1 <![CDATA[gtcgttcgaccgcctgagttttatctttttgtcccactagaatcattttttccctccctggaggacaaac ATTCCGGGGATCCGTCGACC ]]> fabF knockout fabF-2 <![CDATA[aacaagtcggaataaaagctaagaaaaaaggcccgcaagcggaccttttataagggtggaaaatgacaac TGTAGGCTGGAGCTGCTTCG ]]> fabF knockout fabF-3 ccaccaggcgtaagtgaacatctccaggcg Verification of fabF knockout fabH-1 <![CDATA[tagcaggacgctgccagcgaactcgcagtttgcaagtgacggtatataaccgaaaagtgactgagcgtac ATTCCGGGGATCCGTCGACC ]]> fabH knockout fabH-2 <![CDATA[gcattccaacggtttgagaaccctgtccagggaacacaaatgcaaattgcgtcatgttttaatccttatc TGTAGGCTGGAGCTGCTTCG ]]> fabH knockout fabH-3 ctggacggtggcaaaagcggaactctgcgg Verification of fabH knockout fadD up ctgtttctgcattcttacggtaaagataaaaataaatagtgacgcgcttcgcaaccttttcgttgggtaa Strengthen fadD fadD down ttgaagaaggtttggcttaaccgttatcccgcggacgttccgacggagatcaaccctgac cgttatcaat Strengthen fadD fadD-1 ctgtttctgcattcttacggt Strengthen fadD fadD-2 attgataacggtcagggttgatctccgtcg Strengthen fadD fadD-3 ggccccgcgagagtacaaacagttg Verify fadD enhancement fadL up gcgccacctccaaattttgccagctggatcgcgtttcttagatcatatttgaaaaaagatagaaacatac Strengthen fadL fadL down atgagccagaaaaccctgtttacaaagtctgctctcgcagtcgcagtggcacttatctccacccaggcct Enhance fadL fadL-1 gcgccacctccaaattttgcca Enhance fadL fadL-2 aggcctgggtggagataagtgccactgcga Enhance fadL fadL-3 cggaaagtgctgctccagttg Verify fadL strengthening atoS up caccgccgagaaatcatcaccttaacctctgataatcgtcatataccggacaagactagt ggatttcagc Strengthen atoS atoS down atgcattatatgaagtggatttatccacgccgcttacgcaatcaaatgatcctgatggca atcctgatgg Strengthen atoS atoS-1 caccgccgagaaatcatcaccttaacctct Strengthen atoS atoS-2 ccatcaggattgccatcaggatcatttgat Strengthen atoS atoS-3 gcaatgttctctcttctctggaatatgata Verify atoS strengthening lpxM-1 <![CDATA[tggtgcggggcaagttgcgccgctacactatcaccagattgatttttgccttatccgaaactggaaaagc ATTCCGGGGATCCGTCGACC ]]> lpxM knockout lpxM-2 <![CDATA[agatttcgaatattctgaagcaaacttgaacttatcatcaggcgaaggcctctcctcgcgagaggctttt TGTAGGCTGGAGCTGCTTCG ]]> lpxM knockout lpxM-3 cgcgataaaggttacttgat Validation of lpxM knockout iclR-1 <![CDATA[tcagtaactattgcattagctaacaataaaaatgaaaatgatttccacgatacagaaaaaagagactgtc ATTCCGGGGATCCGTCGACC ]]> Knockout of iclR iclR-2 <![CDATA[aacagacacccttattctattgccactcaggtatgatgggcagaatattgcctctgcccgccagaaaaag TGTAGGCTGGAGCTGCTTCG ]]> Knockout of iclR iclR-3 atttgttcaacattaactcatcggatcagt Verification of iclR knockout sucA-1 <![CDATA[gcacgcacatcactgtgcgtggtagtatccacggcgaagtaagcataaaaaagatgcttaagggatcacg ATTCCGGGGATCCGTCGACC ]]> sucA knockout sucA-2 <![CDATA[gtggcatcggctacggattcaggcaggtcagggaccagaatatctacgctactcattgtgtatcctttat TGTAGGCTGGAGCTGCTTCG ]]> sucA knockout sucA-3 taccggcgctgttgccttc Verification of sucA knockout aspC-1 <![CDATA[ttggaattttgtaaatctcccgttaccctgatagcggacttcccttctgtaaccataatggaacctcgtc ATTCCGGGGATCCGTCGACC ]]> aspC knockout aspC-2 <![CDATA[cgcatcaggcaatgttgcgtttgtcatcagtctcagcccgcttttcagcgggcttcattgtttttaatgc TGTAGGCTGGAGCTGCTTCG ]]> aspC knockout aspC-3 tccacacttggttatgaacgcctg Verification of aspC knockout aspA up tcccaaagcggtgatctatttcacaaattaataattaaggggtaaaaaccgacacttaaagtgatccaga Strengthen aspA aspA down atgtcaaacaacattcgtatcgaagaagatctgttgggtaccagggaagttccagctgatgcctactatg Strengthen aspA aspA-1 tcccaaagcggtgatctatttcacaaat Strengthen aspA aspA-2 catagtaggcatcagctggaact Strengthen aspA aspA-3 gttgcgaatcgcgtttagcttatattg Verify aspA strengthening thrA*-1F <![CDATA[Aatttcacacaggaaacaga atgcgagtgttgaagttcggcgg ]]> Plasmid construction thrA*-1R ccacggaaatacgggcgcgtgac Plasmid construction thrA*-2F gtcacgcgcccgtatttccgtgg Plasmid construction thrA*-2R tcagactcctaacttccatgag Plasmid construction ltaE-2F <![CDATA[ctcatggaagttaggagtctgaaggaggaattaacc atgattgatttacgcagtgatacc ]]> Plasmid construction

[0103] In the following exemplary embodiments, the strains were modified using the CRISPR technology shown in Jiang Y et al. (Multigene editing in theEscherichiacoli genome via the CRISPR-Cas9system. Appl Environ Microbiol 2015, 81: 2506-2514), Chinese patent CN108728470B, and the gene editing technology listed in Zhao L et al. (Expressionregulation of multiple key genes to improve L-threonine in Escherichia coli. Microb Cell Fact. 2020 Feb 24; 19(1): 46.), which are incorporated herein by reference in their entirety.

[0104] In this paper, Escherichia coli BW25113 (CGSC#: 7636), plasmids pKD46 (CGSC#: 7739), pKD4 (CGSC#: 7682), and pCP20 (CGSC#: 7629) were purchased from the Yale Escherichia coli Collection (CGSC).

[0105] In the following examples, unless otherwise specified, substitutions refer to complete substitutions and knockouts refer to complete knockouts.

[0106] The primers and partial fragment sequences in the following examples are shown in Table 1.

[0107] Example 1. Construction of recombinant Escherichia coli engineered strain TG05.

[0108] This example prepared a strain, TG05, that can be used to produce glycine. It can synthesize glycine from L-threonine. This strain primarily blocks the consumption pathways of L-threonine and glycine, enhances the uptake pathway of L-threonine, and strengthens the consumption pathway of the byproduct acetaldehyde. The strain was constructed as follows; the primers used are shown in Table 1.

[0109] (1) Knockout of the threonine dehydrogenase (TDH) gene

[0110] First, the threonine dehydrogenase gene tdh of Escherichia coli BW25113 was knocked out to obtain the recombinant strain TG01. The specific steps are as follows:

[0111] (1-a) Preparation of the targeting fragment tdh up-kan-tdh down

[0112] PCR amplification was performed using tdh-1 / tdh-2 as primers and the frt-kan-frt (SEQ ID No. 2) screening marker fragment as a template to obtain the targeting fragment tdh up-kan-tdh down.

[0113] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0114] Plasmid pKD46 (from the Yale Genetic Collection of Escherichia coli CGSC) was transformed into Escherichia coli BW25113 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, clones were selected to obtain E. coli BW25113-pKD46 containing plasmid pKD46. A single clone of BW25113-pKD46 was inoculated into LB medium containing 100 μg / mL and 2 g / L L-arabinose and cultured to the logarithmic phase (OD 600nm =0.6-0.8), then washed with pre-chilled 10% glycerol to prepare competent cells for BW25113-pKD46. After induction with L-arabinose, BW25113-pKD46 expressed the three recombinant proteins Gam, Beta, and Exo of bacteriophage lambda, thereby enhancing its homologous recombination capacity.

[0115] (1-c) Homologous recombination

[0116] (1-d) Elimination of resistance

[0117] Plasmid pcP20 was transformed into TG01-kan prepared in (1-c) using the calcium chloride method. The transformed cells were plated onto LB solid medium supplemented with 100 µg / mL ampicillin and cultured overnight at 30°C. A single colony was then picked and inoculated onto LB medium supplemented with 100 µg / mL ampicillin and 2 g / L L-arabinose and cultured at 30°C. The bacterial suspension was then streaked onto LB solid medium without antibiotics and onto LB solid medium supplemented with 50 µg / mL kanamycin and cultured overnight at 42°C. After confirming the elimination of kanamycin resistance, a single colony was picked from the LB solid medium without antibiotics and inoculated onto LB solid medium supplemented with 100 µg / mL ampicillin, 50 µg / mL kanamycin, or without antibiotics, and cultured overnight at 30°C. Positive clones were identified as those that grew in the medium without antibiotics but not in the medium supplemented with ampicillin or kanamycin. PCR amplification was performed using primers tdh-3 and tdh-2, and the positive clone was approximately 400 bp. The positive clone obtained by screening was named recombinant strain TG01.

[0118] The recombinant bacterium TG01 is a strain in which the tdh gene is knocked out. The NCBI Reference Sequence number (NCBI Reference Sequence) of the L-threonine dehydrogenase (hereinafter referred to as tdh) is NP_418073.1, the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948139 (2024.12.17), and its encoded product is shown in SEQ ID NO. 4.

[0119] (2) Knockout of the threonine dehydratase (hereinafter referred to as tdcB) gene

[0120] The recombinant bacteria TG01 obtained in step (1) was used as the starting strain, and the threonine dehydratase gene tdcB was knocked out to obtain the recombinant bacteria TG02. The specific steps are as follows:

[0121] (2-a) Preparation of the targeting fragment tdcB up-kan-tdcB down:

[0122] PCR amplification was performed using tdcB-1 / tdcB-2 as primers and the frt-kan-frt (SEQ ID No. 2) screening marker fragment as a template to obtain the targeting fragment tdcB up-kan-tdcB down.

[0123] (2-b) Follow the steps in (1) (steps 1-b to 1-d), except that the primers tdh-1 / tdh-2 / tdh-3 are replaced with tdcB-1 / tdcB-2 / tdcB-3. The target fragment tdcB up-kan-tdcB down is obtained, and the transformed strain is replaced with TG01 instead of BW25113.

[0124] In step (2-c), PCR amplification and identification were performed using tdcB-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0125] In step (2-d), PCR amplification and identification were performed using tdcB-3 / tdcB-2 as primers, and the amplified target band of about 400 bp was considered positive.

[0126] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the threonine dehydratase (hereinafter referred to as tdcB) is NP_417587, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947633 (2025.2.19), and its encoded product is shown in SEQ ID NO. 5.

[0127] (3) Knockout of the glycine decarboxylase (gcvP) gene

[0128] The recombinant bacteria TG02 obtained in step (2) was used as the starting strain, and the glycine decarboxylase gene gcvP was knocked out to obtain the recombinant bacteria TG03. The specific steps are as follows:

[0129] (3-a) Preparation of the targeting fragment gcvP up-kan-gcvP down:

[0130] PCR amplification was performed using gcvP-1 / gcvP-2 as primers and the frt-kan-frt (SEQ ID No. 2) screening marker fragment as a template to obtain the targeting fragment gcvP up-kan-gcvP down.

[0131] (3-b) Follow the steps of (1) (steps 1-b to 1-d), except that the primers tdh-1 / tdh -2 / tdh-3 are replaced with gcvP-1 / gcvP-2 / gcvP-3. The target fragment gcvP up-kan-gcvP down is obtained, and the transformed strain is replaced by TG02 instead of BW25113.

[0132] In step (3-c), PCR amplification and identification were performed using gcvP-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0133] In step (3-d), PCR amplification and identification were performed using gcvP-3 / gcvP-2 as primers, and the amplified target band of about 400 bp was considered positive.

[0134] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the transglycine decarboxylase (hereinafter referred to as gcvP) is NP_417379.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947394 (2025.2.19), and its encoded product is shown in SEQ ID NO. 6.

[0135] (4) Enhanced expression of the threonine transporter (tdcC) gene by promoter replacement

[0136] The recombinant bacteria TG03 obtained in step (3) was used as the starting strain. Starting from the recombinant bacteria TG03, the promoter of the threonine transporter tdcC gene in the strain was replaced with the constitutive promoter P of Escherichia coli. 119(SEQ ID No. 1), and recombinant Escherichia coli TG04 was obtained. The specific steps are as follows:

[0137] (4-a) Targeting fragment tdcC up-kan-P 119 Preparation of -tdcC down:

[0138] The DNA fragments synthesized (GenScript) were as follows: from 5' to 3', they contained the 70 bp homology arm fragment upstream of the tdcC gene (denoted as tdcC up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 2), the P 119 The promoter fragment (SEQ ID No. 1) and the first 70 bp fragment of the tdcC gene (denoted as sequence tdcC down, see Table 1) were amplified by PCR using tdcC-1 / tdcC-2 as primers and the gene-synthesized DNA fragment as template to obtain the target fragment tdcC up-kan-P 119 -tdcC down.

[0139] (4-b) Follow the steps of (1) (steps 1-b to 1-d), except that in step 1-c, the primers used for identification were changed to tdcC-3 / Kan-R, and a positive clone of approximately 1400 bp was identified. In step 1-d, the primers used for identification were changed to tdcC-3 / tdcC-2, and a positive clone of approximately 400 bp was identified.

[0140] The NCBI Reference Sequence number (NCBI Reference Sequence) of the threonine transporter (tdcC) is NP_417586.1, the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947629 (2024.12.3), and its encoding product is shown in SEQ ID NO. 7.

[0141] (5) Enhanced expression of the acetaldehyde dehydrogenase (eutE) gene by promoter replacement

[0142] Starting from the recombinant strain TG04, the promoter of the acetaldehyde dehydrogenase eutE gene in the strain was replaced with the Escherichia coli constitutive promoter P 119 (SEQ ID No. 1), and recombinant Escherichia coli TG05 was obtained by the following steps:

[0143] (5-a) Preparation of the targeting fragment eutE up-kan-P 119 -eutE down

[0144] The DNA fragments synthesized (GenScript) were as follows: from 5' to 3', they consisted of the following: a 70 bp homology arm fragment upstream of the eutE gene (denoted as eutEup, see Table 1), an frt-kan-frt selection marker fragment (SEQ ID No. 2), a P 119 The promoter fragment (SEQ ID No. 1) and the first 70 bp fragment of the eutE gene (denoted as sequence eutEdown, see Table 1) were amplified by PCR using eutE-1 / eutE-2 as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment eutE up-kan-P 119 -eutEdown.

[0145] (5-b) The subsequent operations refer to (1) (steps 1-b to 1-d) to obtain the constitutive promoter P 119 The recombinant strain TG05 with the eutE promoter replaced was different in that the host strain BW25113 was replaced by TG04, and the primers talB-1 / talB-2 / talB-3 were replaced by eutE-1 / eutE-2 / eutE-3.

[0146] In step (5-c), PCR amplification and identification were performed using eutE-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0147] In step (5-d), PCR amplification and identification were performed using eutE-2 / eutE-3 as primers, and the amplified target band of about 400 bp was considered positive.

[0148] The NCBI Reference Sequence number of the acetaldehyde dehydrogenase (eutE) is NP_416950.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 946943 (2024.12.3), and its encoded product is shown in SEQ ID NO. 8.

[0149] Example 2. Preparation of strain TG06 for producing glycine and production of glycine.

[0150] 1. Preparation of strain TG06 for glycine production

[0151] In this example, a strain TG06 capable of converting L-threonine into glycine was prepared. The construction method of the strain is as follows, and the primers used are shown in Table 1.

[0152] (1) Construction of a plasmid overexpressing the L-threonine aldolase ltaE gene

[0153] Escherichia coli BW25113 genomic DNA was extracted using the Zhuangmeng Bacterial Genomic DNA Miniprep Kit (ZP301). PCR amplification was performed using the extracted E. coli genomic DNA as a template, using primers ltaE-1F and ltaE-1R, and high-fidelity TransStart FastPfu DNA Polymerase. The resulting PCR product, designated ltaE, was obtained by agarose gel electrophoresis and recovery. The target fragment, ltaE, was then amplified and recovered using primers pTrc99a-01F and pTrc99a-01R and plasmid pTrc99a (Beijing Zhuangmeng International Biogene Technology Co., Ltd., Cat. No. ZK1610) as a template. The large vector fragment, pTrc, was then amplified and recovered. Using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods. 2009; 6(5):343-345), the pTrc and ltaE fragments were Gibson ligated and transformed into competent E. coli DH5α cells (purchased from Beijing Qingke Biotechnology Co., Ltd., product catalog TSC-C01). After recovery, the cells were evenly plated onto the corresponding resistance LB plates and cultured overnight at 37°C. Clones were selected and verified for successful assembly by PCR amplification using primers RV-M and pTrcHis-R. Sequencing was then performed. Positive clones were screened and the plasmid was extracted and named pTrc99a-ltaE.

[0154] (2) Construction of production strain TG06

[0155] The plasmid pTrc99a-ltaE constructed in step (1) of Example 2 was transferred to the recombinant bacteria TG05 obtained in step (5) of Example 1 by the calcium chloride transformation method. After overnight culture at 37°C on an LB plate containing 100 μg / mL ampicillin, clones were selected to obtain a production strain containing the plasmid pTrc99a-ltaE, which was named recombinant bacteria TG06.

[0156] Escherichia coli TG06 contains the coding sequence of the ltaE gene and can express glycine aldolase with the amino acid sequence of SEQ ID No. 3.

[0157] (3) Construction of strain TG00

[0158] Plasmid pTrc99a was transferred into the recombinant bacteria TG05 obtained in step (8) of Example 1 by the calcium chloride transformation method. After overnight culture at 37°C on an LB plate containing 100 μg / mL ampicillin, a clone was selected. This strain was used as a control and named recombinant bacteria TG00.

[0159] 2. Preparation of Glycine

[0160] 1. Preparation of culture medium:

[0161] Composition and final concentrations of medium A: 5 g / L yeast extract, 5 g / L glycerol, 25 mM Na2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2Mo4, 2 μM Na2SeO3 and 2 μM H3BO3.

[0162] The composition and final concentrations of medium B are: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, and 50 g / L L-threonine.

[0163] 2. Preparation of glycine

[0164] The experiment was repeated three times, and the specific steps for each experimental repetition were as follows:

[0165] 2.1 Culture of bacteria and induction of related enzymes:

[0166] The strain TG06 obtained in step 1 was cultured overnight and inoculated into 20 ml of medium A (medium A containing ampicillin at a final concentration of 50 mg / L) at a 1% inoculum size. The culture was then incubated at 30°C and 220 rpm for 3-4 h until the OD 600nm After the cell density was 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured at 30°C and 220 rpm for 16 h. The cells were collected by centrifugation at 10,000 g for 10 min to obtain TG06 cells.

[0167] According to the above method, TG00 was cultured and collected using A medium (A medium containing ampicillin at a final concentration of 50 mg / L) to obtain TG00 bacteria.

[0168] 2.2 Whole-cell catalytic production of glycine

[0169] The 30 mg (i.e. 1 x 1011 cfu) dry weight of TG06 and TG00 bacteria were resuspended in shake flasks containing 20 mL of B medium and cultured at 37°C for 24 h.

[0170] 2.3 Product collection and testing

[0171] Centrifuge 0.5 ml of the whole-cell catalytic sample obtained in step 2.2 at 4000 g and 4°C for 20 min. Filter the supernatant. Assay the glycine content using HPLC. The HPLC instrument and assay conditions are as follows:

[0172] Testing instrument: SHIMADZU LC-20AT

[0173] Detection conditions: mobile phase A: 10 mM KH2PO4; mobile phase B: acetonitrile-methanol-water solution (volume ratio 45:45:10); detection wavelength 360 nm; detection time: 35 min; detection temperature: 40°C; flow rate: 1 mL / min; chromatographic column: Extnd-C18 (5 μm, 4.6 mm i.d. × 250 mm); gradient elution: 1 min 12% B; 2.5 min 12% B; 2.51 min 16% B; 13 min 36% B; 13.01 min 38% B; 25 min 100% B; 28 min 100% B; 28.01 min 10% B; 35 min controller stop.

[0174] The results showed that the glycine yield of recombinant strain TG00 was 1.25 g / L, while that of engineered strain TG06 averaged 30.82 g / L, with a conversion rate of 61.64%. This is shown in Figure 1. Therefore, engineered strain TG06 can be used to synthesize glycine from L-threonine.

[0175] Example 3 Preparation of strain TG11 for producing glycine and production of glycine.

[0176] 1. Preparation of strain TG11 for glycine production

[0177] In this example, a strain TG11 capable of converting glucose into glycine was prepared. This strain mainly strengthens the L-threonine synthesis pathway. The construction method of this strain is as follows, and the primers used are shown in Table 1.

[0178] (1) Knockout of the glyoxylate pathway transcriptional repressor gene iclR, the α-ketoglutarate decarboxylase gene sucA, and the aspartate aminotransferase gene aspC

[0179] Referring to the steps of Example 1, on the basis of TG05, the coding regions of the glyoxylate pathway transcriptional repressor gene iclR, α-ketoglutarate decarboxylase gene sucA, and aspartate aminotransferase gene aspC were transcribed in sequence to obtain recombinant bacteria TG07, TG08, and TG09.

[0180] The specific operation steps are the same as those in Example 1 (1) Steps 1-a to 1-d. The difference is that the primer combination tdh-1 / tdh-2 / tdh-3 is replaced by iclR-1 / iclR-2 / iclR-3, sucA-1 / sucA-2 / sucA-3, and aspC-1 / aspC-2 / aspC-3, respectively.

[0181] Among them, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the isocitrate lyase inhibitor (iclR) is AAC76988.2, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948524 (2023.4.14) or as shown in SEQ ID NO. 11.

[0182] The NCBI Reference Sequence number (NCBI Reference Sequence) of α-ketoglutarate decarboxylase (sucA) is AAC73820.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945303 (2023.4.14) or as shown in SEQ ID NO. 12.

[0183] Among them, the NCBI Reference Sequence number (NCBI Reference Sequence) of aspartate aminotransferase (aspC) is AAC74014.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 945553 (2023.4.14) or as shown in SEQ ID NO. 13.

[0184] (2) Enhancing the expression of the aspA gene by promoter replacement

[0185] Starting from the recombinant strain TG09, the promoter of the aspartate lyase aspA gene in the strain was replaced with the Escherichia coli constitutive promoter P CPA1 (SEQ ID No. 9), the specific steps for obtaining recombinant E. coli TG10 are as follows:

[0186] (2-a) Preparation of the targeting fragment aspA up-kan-PCPA1- aspA down The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the aspA gene (denoted as aspA up), the frt-kan-frt selection marker fragment (SEQ ID No. 2), the P CPA1 The promoter fragment (SEQ ID No. 9) and the first 70 bp fragment of the aspA gene (denoted as the sequence aspA down) were amplified by PCR using aspA -1 / aspA -2 as primers and the gene synthesized DNA fragment as a template to obtain the targeting fragment aspAup-kan-P CPA1 -aspAdown.

[0187] (2-b) The subsequent operations refer to (1) (steps 1-b to 1-d)), and the constitutive promoter P is obtained. CPA1 The number of recombinant strains with aspA promoter replacement increased by 7. In step 1-c, the 1400bp positive clone identified by primers tdh-3 / Kan-R became the 1400bp positive clone identified by primers aspA-3 / Kan-R. In step 1-d, the 300bp positive clone identified by primers tdh-2 / tdh-3 became the approximately 400bp positive clone identified by primers aspA-2 / aspA-3.

[0188] The NCBI Reference Sequence number (NCBI Reference Sequence) of aspartate lyase (aspA) is AAC77099.2, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948658 (2023.4.14) or as shown in SEQ ID NO. 14.

[0189] (3) Construction of plasmids overexpressing the aspartate kinase mutant thrA* gene (C at position 1034 of thrA mutated to T), thrB, thrC, and L-threonine aldolase ltaE genes

[0190] Using the Escherichia coli genomic DNA extracted in step (1) of Example 2 as a template, thrA*-1F and thrA*-1R as primers, and high-fidelity TransStart FastPfu DNA polymerase for PCR amplification, a PCR amplification product was obtained, which was recorded as thrAup*. Using thrA*-2F and thrC-R as primers, and high-fidelity TransStart FastPfu DNA polymerase for PCR amplification, a PCR amplification product was obtained, which was recorded as thrAdown*-BC. Using the extracted Escherichia coli genomic DNA as a template, and ltaE-1F and ltaE-2R as primers, and high-fidelity TransStart FastPfu DNA polymerase for PCR amplification, a PCR amplification product, ltaE, was obtained. The coding sequence of each gene also contains the sequence AGGAGGAATTAACC as a ribosome binding site (RBS) sequence and a spacer sequence between the RBS and the start codon. Agarose gel electrophoresis was performed and the target fragments thrAup*, thrAdown*, and ltaE were recovered. Using primers pTrc99a-01F and pTrc99a-01R, plasmid pTrc99a (Beijing Zhuangmeng International Biogene Technology Co., Ltd., catalog number ZK1610) was used as a template for PCR amplification and recovery of the large vector fragment pTrc. Using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods. 2009; 6(5):343-345), the pTrc fragment was Gibson ligated with thrAup*, thrAdown*-BC, and ltaE. The fragment was then transformed into competent Escherichia coli DH5α cells (purchased from Beijing Qingke Biotechnology Co., Ltd., catalog number TSC-C01). After recovery, the cells were evenly plated onto the corresponding resistance LB plates and cultured at 37°C overnight. Clones were selected and verified for successful assembly by PCR amplification using primers RV-M and pTrcHis-R, and sequenced. Finally, positive clones were obtained by screening, and the plasmid was extracted and named pTrc99a-thrA*BC-ltaE.

[0191] (4) Construction of production strain TG11

[0192] The plasmid pTrc99a-thrA*BC-ltaE constructed in step (3) of Example 3 was transferred to the recombinant bacteria TG10 obtained in step (2) of Example 3 by the calcium chloride transformation method. After overnight culture at 37°C on an LB plate containing 100 µg / mL ampicillin, clones were selected to obtain a production strain containing the plasmid pTrc99a-thrA*BC-ltaE, which was named recombinant bacteria TG11.

[0193] Escherichia coli TG11 contains the coding sequences of the thrA*, thrB, thrC, and ltaE genes, and can express the amino acid sequences of aspartate kinase shown in SEQ ID NO. 15, homoserine kinase shown in SEQ ID NO. 16, threonine synthetase shown in SEQ ID NO. 17, and L-threonine aldolase shown in SEQ ID NO. 3, respectively.

[0194] 2. Preparation of Glycine from Glucose

[0195] 1. Preparation of culture medium:

[0196] Composition and final concentrations of medium A: 5 g / L yeast extract, 5 g / L glycerol, 25 mM Na2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2Mo4, 2 μM Na2SeO3 and 2 μM H3BO3.

[0197] The composition and final concentrations of medium B are: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 10 g / L NH4Cl, and 10 g / L glucose.

[0198] 2. Preparation of glycine

[0199] The experiment was repeated three times, and the specific steps for each experimental repetition were as follows:

[0200] 2.1 Culture of bacteria and induction of related enzymes:

[0201] The strain TG11 obtained in step 1 was cultured overnight and inoculated into 20 ml of medium A (medium A containing ampicillin at a final concentration of 50 mg / L) at a 1% inoculum size. The culture was then incubated at 30°C and 220 rpm for 3-4 h until the OD 600nmAfter the pH value was 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured at 30°C and 220 rpm for 16 h. The cells were collected by centrifugation at 10,000 g for 10 min to obtain TG11 cells.

[0202] According to the above method, TG11 and TG06 were cultured and collected using A medium (A medium containing ampicillin at a final concentration of 50 mg / L) to obtain TG18 and TG00 bacteria.

[0203] 2.2 Whole-cell catalytic production of glycine

[0204] The 30 mg (i.e. 1 x 10 11 cfu) dry weight of TG18 and TG00 bacteria were resuspended in shake flasks containing 20 mL of B medium and cultured at 37°C for 24 h.

[0205] 2.3 Product collection and testing

[0206] 0.5 ml of the whole-cell catalytic sample obtained in 2.2 was centrifuged at 4000 g and 4°C for 20 min. The amino acid assay was performed as in Example 2.

[0207] The results showed that the glycine production of recombinant strain TG06 was 0.36 g / L, while the average glycine production of engineered strain TG11 was 4.56 g / L, as shown in Figure 2. Therefore, engineered strain TG11 can synthesize glycine from glucose.

[0208] Example 4 Preparation of strain TG19 for producing glycine and production of glycine.

[0209] 1. Preparation of strain TG19 for glycine production

[0210] In this example, a strain TG19 capable of converting fatty acids into glycine was prepared. This strain has an enhanced fatty acid utilization module. The construction method of this strain is as follows, and the primers used are shown in Table 1.

[0211] (1) Knockout of the fatty acid degradation transcription factor fadR.

[0212] Starting from E. coli TG10, the fadR gene of E. coli TG10 was knocked out to obtain the mutant TG12 of E. coli TG10. The specific steps are as follows:

[0213] Referring to the steps of Example 1, based on TG10, the coding region of the fatty acid degradation transcription factor fadR was knocked out to obtain the recombinant bacteria TG12.

[0214] The specific operation steps are the same as those in Example 1, such as (1) steps 1-a to 1-d in Example 1. The difference is that the primer combination tdh-1 / tdh-2 / tdh-3 is replaced by fabF-1 / fabF-2 / fabF-3 and fabH-1 / fabH-2 / fabH-3 in sequence.

[0215] The NCBI Reference Sequence number (NCBI Reference Sequence) of the fatty acid degradation transcription factor (hereinafter referred to as fadR) is CAA30881.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948652 (2023.4.14) or as shown in SEQ ID NO. 18.

[0216] (2) Knockout of β-ketoacyl-ACP synthase II (fabF) gene and β-ketoacyl-ACP synthase III (fabH) gene

[0217] Referring to the steps of (1), on the basis of TG12, the coding regions of the β-ketoacyl-ACP synthase II gene fabF and the β-ketoacyl-ACP synthase III gene fabH were knocked out in sequence to obtain recombinant bacteria TG13 and TG14.

[0218] The specific operation steps are the same as those in Example 1, such as (1) steps 1-a to 1-d in Example 1. The difference is that the primer combination tdh-1 / tdh-2 / tdh-3 is replaced by fabF-1 / fabF-2 / fabF-3 and fabH-1 / fabH-2 / fabH-3 in sequence.

[0219] The NCBI Reference Sequence number (NCBI Reference Sequence) of β-ketoacyl-ACP synthase II (fabF) is AAC74179.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946665 (2023.4.14) or as shown in SEQ ID NO. 19.

[0220] The NCBI Reference Sequence number (NCBI Reference Sequence) of β-ketoacyl-ACP synthase III (fabH) is AAC74175.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946003 (2023.4.14) or as shown in SEQ ID NO. 20.

[0221] (3) Enhanced expression of the fatty acyl-CoA synthase (fadD) gene by promoter replacement

[0222] Starting from the recombinant strain TG14, the promoter of the fatty acyl-CoA synthase fadD gene in the strain was replaced with the Escherichia coli constitutive promoter P CPA1 (SEQ ID No. 9), and recombinant Escherichia coli TG15 was obtained by the following steps:

[0223] (3-a) Preparation of the targeting fragment fadDup-kan-PCPA1-fadDdown

[0224] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp upstream homology arm fragment of the fadD gene (denoted as fadD up), the frt-kan-frt selection marker fragment (SEQ ID No. 2), the P CPA1 The promoter fragment (SEQ ID No. 9) and the first 70 bp fragment of the fadD gene (denoted as sequence fadD down) were amplified by PCR using fadD-1 / fadD-2 as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment fadDup-kan-PCPA1-fadDdown.

[0225] (3-b) The subsequent operation refers to step (1) in Example 1 to obtain the constitutive promoter P CPA1 Recombinant strain TG15 with the fadD promoter replaced. The 1400bp positive clone identified in step 1-c using primers tdh-3 / Kan-R becomes a 1400bp positive clone identified in step 1-d using primers tdh-2 / tdh-3. The 300bp positive clone identified in step 1-d using primers tdh-2 / tdh-3 becomes a 300bp positive clone identified in step 1-d using primers fadD-2 / fadD-3.

[0226] The NCBI Reference Sequence number (NCBI Reference Sequence) of fatty acyl-CoA synthase (hereinafter referred to as fadD) is QPD63730.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 15 946327 (2023.4.14) or as shown in SEQ ID NO. 21.

[0227] (4) Enhanced expression of the long-chain fatty acid transporter (fadL) gene by promoter replacement

[0228] Following the same method, starting from the recombinant strain TG15, the fadL gene promoter of TG15 was replaced with the constitutive promoter P CPA1 The mutant TG16 of Escherichia coli TG15 was obtained by culturing the strain. The operation process was similar to that in Example 1 (3), with the only difference being that the target fragment fadLup-kan-PCPA1-fadLdown was obtained and the primers fadL-1 / fadL-2 / fadL-3 were used to replace the primers fadD-1 / fadD-2 / fadD-3. The specific steps are as follows:

[0229] (4-a) Preparation of targeting fragments fadLup-kan-PCPA1-fadLdown The following DNA fragments were synthesized (GenScript): from 5' to 3', they contained the 70 bp upstream homology arm of the fadL gene (denoted as fadLup), the frt-kan-frt selection marker fragment (SEQ ID No. 2), the P CPA1 The promoter fragment (SEQ ID No. 9) and the first 70 bp fragment of the fadL gene (denoted as sequence fadL down) were amplified by PCR using fadL-1 / fadL-2 as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment fadLup-kan-PCPA1-fadLdown.

[0230] (4-b) The subsequent operations are as in Example 1 (1) (steps 1-b to 1-d), and the constitutive promoter P is obtained. CPA1 Recombinant strain TG16 with the fadL promoter replaced. The 1400bp positive clone identified in step 1-c using primers tdh-3 / Kan-R became a 1400bp positive clone identified in step 1-d using primers tdh-2 / tdh-3. The 300bp positive clone identified in step 1-d using primers tdh-2 / tdh-3 became a 300bp positive clone identified in step 1-d using primers fadL-2 / fadL-3.

[0231] The NCBI Reference Sequence number (NCBIReference Sequence) of the long-chain fatty acid transport protein (hereinafter referred to as fadL) is CAD6007925.1, and the NCBI Reference Sequence number (NCBIReference Sequence) of its encoding gene is Gene ID: 946820 (2023.4.14) or as shown in SEQ ID NO. 22.

[0232] (5) Enhanced expression of the short-chain fatty acid degradation regulatory gene cluster atoS and atoC by promoter replacement

[0233] Following the same method, starting from the recombinant strain TG16, the atoS and atoC gene cluster promoters were replaced with the constitutive promoter PCPA1 to obtain the mutant TG17 of Escherichia coli TG16. The operation process was the same as in Example 1 (3), and the targeting fragment atoSup-kan-P was obtained. CPA1- atoSdown, and use primers atoS-1 / atoS-2 / atoS-3 to replace primers fadD-1 / fadD-2 / fadD-3. The specific steps are as follows:

[0234] (5-a) Preparation of targeting fragment atoSup-kan-PCPA1-atoSdown The following DNA fragments were synthesized (GenScript): from 5' to 3', they contained the 70 bp homology arm fragment upstream of the atoS gene (denoted as atoS up), the frt-kan-frt screening marker fragment (SEQ ID No. 2), the P CPA1 The promoter fragment (SEQ ID No. 9) and the first 70 bp fragment of the atoS gene (denoted as sequence atoS down) were amplified by PCR using atoS-1 / atoS-2 as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment atoSup-kan-P CPA1 -atoSdown.

[0235] (5-b) The subsequent operations refer to Example 1 (1) (steps 1-b to 1-d)), and the constitutive promoter P is obtained. CPA1Recombinant strain TG17 with the atoS promoter replaced. In step 1-c, the 1400bp positive clone identified and amplified using primers tdh-3 / Kan-R was replaced with a 1400bp positive clone identified and amplified using primers tdh-2 / tdh-3. In step 1-d, the 300bp positive clone identified and amplified using primers tdh-2 / tdh-3 was replaced with a 300bp positive clone identified and amplified using primers atoS-2 / atoS-3.

[0236] The NCBI Reference Sequence numbers (NCBI Reference Sequence) of the short-chain fatty acid degradation regulatory gene cluster atoS and atoC genes are Gene ID: 949011 and 947444 (2023.4.14), respectively, and the NCBI Reference Sequence numbers (NCBI Reference Sequence) of the proteins they encode are AAC75279.1 and AAC75280.1 or as shown in SEQ ID NOs. 23 and 24.

[0237] (6) Replace the gene encoding myristoyltransferase (lpxM) for lipid A biosynthesis with the gene encoding the outer membrane protein for alkane uptake (MhalkL)

[0238] Following the same method, starting from the recombinant strain TG17, the gene encoding lipid A biosynthesis myristoyltransferase (lpxM) in the strain was replaced with the constitutive promoter P 119 and the gene encoding the alkane uptake outer membrane protein (MhalkL) to obtain recombinant Escherichia coli TG18. The specific steps are as follows:

[0239] (6-a) Preparation of the targeting fragment lpxMup-kan-P 119 -MhalkL-lpxMdown

[0240] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the lpxM gene (denoted as lpxM up), the frt-kan-frt selection marker fragment (SEQ ID No. 2), the P 119 The promoter fragment (SEQ ID No. 1), MhalkL gene, TrrnB terminator fragment (SEQ ID No. 10), and 70 bp fragment downstream of the lpxM gene (denoted as lpxMdown) were amplified by PCR using lpxM-1 / lpxM-2 as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment lpxMup-kan-P 119 -MhalkL-lpxMdown.

[0241] (6-b) The subsequent operations refer to (1) (steps 1-b to 1-d) to obtain the constitutive promoter P 119 Recombinant strain TG18, in which the lpxM gene is replaced by the MhalkL gene, differs in that the host strain is TG17 and the primers lpxM-1 / lpxM-2 / lpxM-3 are replaced by tdh-1 / tdh-2 / tdh-3. In step (6-c), PCR amplification using primers lpxM-2 / Kan-R was performed, and amplification of a target band of approximately 1400 bp was considered positive. In step (6-d), PCR amplification using primers lpxM-2 / lpxM-3 was performed, and amplification of a target band of approximately 1100 bp was considered positive.

[0242] The NCBI Reference Sequence number (NCBI Reference Sequence) of the lipid A biosynthesis myristoyltransferase (lpxM) is AAC74925.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945143 (2023.4.14) (or as shown in SEQ ID NO. 26).

[0243] Escherichia coli TG18 contains the coding sequence of the MhalkL gene and can express the alkane uptake outer membrane protein with the amino acid sequence of SEQ ID No. 25.

[0244] (7) Construction of production strain TG19

[0245] The plasmid pTrc99a-thrA*BC-ltaE constructed in step (3) of Example 3 was transferred to the recombinant bacteria TG18 obtained in step (6) of Example 4 by the calcium chloride transformation method. After overnight culture at 37°C on an LB plate containing 100 µg / mL ampicillin, clones were selected to obtain a production strain containing the plasmid pTrc99a-thrA*BC-ltaE, which was named recombinant bacteria TG19.

[0246] 2. Preparation of Glycine from Fatty Acids

[0247] 1. Preparation of culture medium:

[0248] Composition and final concentrations of medium A: 5 g / L yeast extract, 5 g / L glycerol, 25 mM Na2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2Mo4, 2 μM Na2SeO3 and 2 μM H3BO3.

[0249] The composition and final concentrations of medium B are: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 10 g / L NH4Cl, and 10 g / L palmitic acid.

[0250] 2. Preparation of glycine

[0251] The experiment was repeated three times, and the specific steps for each experimental repetition were as follows:

[0252] 2.1 Culture of bacteria and induction of related enzymes:

[0253] The strain TG19 obtained in step 1 was cultured overnight and inoculated into 20 ml of medium A (medium A containing ampicillin at a final concentration of 50 mg / L) at a 1% inoculum size. The culture was then incubated at 30°C and 220 rpm for 3-4 h until the OD 600nm After the cell viability was 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured at 30°C and 220 rpm for 16 h. The cells were collected by centrifugation at 10,000 g for 10 min to obtain TG19 cells.

[0254] According to the above method, TG19 and TG11 were cultured and collected using A medium (A medium containing ampicillin at a final concentration of 50 mg / L) to obtain TG11 and TG19 bacteria.

[0255] 2.2 Whole-cell catalytic production of glycine

[0256] The 30 mg (i.e. 1 x 10 11 cfu) dry weight of TG11 and TG19 bacteria were resuspended in shake flasks containing 20 mL of B medium and cultured at 37°C for 24 h.

[0257] 2.3 Product collection and testing

[0258] 0.5 ml of the whole-cell catalytic sample obtained in 2.2 was centrifuged at 4000 g and 4°C for 20 min. The amino acid assay was performed as in Example 2.

[0259] The results showed that the glycine production of recombinant strain TG11 was zero, while the average glycine production of engineered strain TG19 was 3.68 g / L, as shown in Figure 2. Therefore, engineered strain TG19 can synthesize glycine from palmitic acid.

Claims

1. A recombinant Escherichia coli for synthesizing glycine, comprising the following modifications: Knockout or inhibitory expression of a gene cluster (1), wherein the gene cluster (1) comprises a gene encoding a threonine dehydrogenase tdh, a gene encoding a threonine dehydratase tdcB, and a gene encoding a glycine decarboxylase gcvP; and Insertion or enhanced expression of a gene cluster (2), wherein the gene cluster (2) comprises: a gene encoding L-threonine aldolase ltaE.

2. The recombinant Escherichia coli according to claim 1, further comprising the following modifications: Insertion or enhanced expression of the gene encoding the L-threonine transporter tdcC.

3. The recombinant Escherichia coli according to claim 1, further comprising the following modifications: Insertion or enhanced expression of the gene encoding acetaldehyde dehydrogenase eutE.

4. The recombinant Escherichia coli according to claim 2 or 3, wherein The expression of the gene encoding the L-threonine transporter tdcC and the gene encoding the acetaldehyde dehydrogenase eutE is enhanced by replacing the promoter, preferably by replacing the promoter with P 119 promoter to enhance expression.

5. The recombinant Escherichia coli according to claim 1, wherein The encoding product of the gene encoding threonine dehydrogenase tdh is shown in SEQ ID NO. 4; The encoding product of the gene encoding threonine dehydratase tdcB is shown in SEQ ID NO. 5; The encoding product of the gene encoding glycine decarboxylase gcvP is shown in SEQ ID NO. 6; and The encoding product of the gene encoding L-threonine aldolase ltaE is shown in the sequence SEQ ID NO.

3.

6. The recombinant Escherichia coli according to claim 2, wherein The encoding product of the gene encoding the L-threonine transporter tdcC is shown in the sequence SEQ ID NO.

7.

7. The recombinant Escherichia coli according to claim 3, wherein The encoding product of the gene encoding acetaldehyde dehydrogenase eutE is shown in the sequence SEQ ID NO.

8.

8. The recombinant Escherichia coli according to claims 1-7, further comprising the following modifications: Knockout or inhibitory expression of a gene cluster (3), wherein the gene cluster (3) comprises a gene encoding a glyoxylate pathway transcriptional repressor iclR, a gene encoding an α-ketoglutarate decarboxylase sucA, and a gene encoding an aspartate aminotransferase aspC; Insertion or enhanced expression of a gene cluster (4), wherein the gene cluster (4) comprises a gene encoding aspartate lyase aspA, a gene encoding aspartate kinase thrA, a gene encoding homoserine kinase thrB, and a gene encoding threonine synthase thrC.

9. The recombinant Escherichia coli according to claim 8, wherein The encoding product of the gene encoding the isocitrate lyase inhibitor iclR is shown in SEQ ID NO. 11; The encoding product of the gene encoding α-ketoglutarate decarboxylase sucA is shown in SEQ ID NO. 12; The encoding product of the gene encoding aspartate aminotransferase aspC is shown in the sequence SEQ ID NO.

13.

10. The recombinant Escherichia coli according to claim 8, wherein The expression of the aspartate lyase gene aspA is enhanced by replacing the promoter, preferably by replacing the promoter with P CPA1 Promoter to enhance expression, more preferably, the PCPA1 is as shown in SEQ ID No. 9; The C at position 1034 of the aspartate kinase thrA gene was mutated to a T, and the encoded product is shown in SEQ ID NO.15; The encoding product of the gene encoding homoserine kinase thrB is shown in SEQ ID NO. 16; and The encoding product of the gene encoding threonine synthase thrC is shown in the sequence SEQ ID NO.

17.

11. The recombinant Escherichia coli according to claims 1-10, further comprising the following modifications: Knockout or inhibitory expression of a gene cluster (5), wherein the gene cluster (5) comprises a gene encoding a fatty acid degradation transcription factor fadR, a gene encoding a β-ketoacyl-ACP synthase II fabF, and a gene encoding a β-ketoacyl-ACP synthase III fabH; Insertion or enhanced expression of a gene cluster (6), comprising a gene encoding acyl-CoA synthase fadD, a gene encoding a long-chain fatty acid transporter fadL, genes encoding a short-chain fatty acid degradation regulatory gene cluster atoS and atoC, and a gene encoding an alkane uptake outer membrane protein MahalkL.

12. The recombinant Escherichia coli according to claim 11, wherein The coding product of the gene encoding the fatty acid degradation transcription factor fadR is shown in SEQ ID NO. 18; The encoding product of the gene encoding β-ketoacyl-ACP synthase II fabF is shown in SEQ ID NO. 19; The encoding product of the gene encoding β-ketoacyl-ACP synthase III fabH is shown in the sequence SEQ ID NO.

20.

13. The recombinant Escherichia coli according to claim 11, wherein The encoding product of the gene encoding acyl-CoA synthase fadD is shown in SEQ ID NO. 21; The encoded product of the gene encoding the long-chain fatty acid transport protein fadL is shown in SEQ ID NO. 22; The encoded products of the genes encoding the short-chain fatty acid degradation regulatory gene clusters atoS and atoC are shown in SEQ ID NOs. 23 and 24; The encoding product of the gene encoding the alkane uptake outer membrane protein MhalkL is shown in the sequence SEQ ID NO.

25.

14. Use of the recombinant Escherichia coli according to any one of the preceding claims in the production of glycine.

15. A method for synthesizing glycine, comprising using the recombinant Escherichia coli according to any one of claims 1 to 13 to carry out whole-cell catalytic synthesis of glycine.

Images