Self-inducible promoter PgsiB mutant derived from bacillus subtilis and application of self-inducible promoter PgsiB mutant

Abstract

The invention discloses a self-inducible promoter PgsiB mutant derived from bacillus subtilis and application thereof, the mutant takes a wild type PgsiB promoter shown as SEQ ID NO: 1 as a starting sequence, the mutant is obtained by irrationally and directionally modifying the nucleotide sequence of the wild type PgsiB promoter, and the sequence is shown as SEQ ID NO: 2-4. The mutant promoter obviously improves the expression efficiency of alpha-amylase and glutamate decarboxylase (GAD) in bacillus subtilis, and the enzyme activities are respectively improved by 74.8% and 62.4%. The promoter does not need an exogenous inducer, can respond to intracellular stress signals (such as heat shock, salt stress and the like) to realize gene self-induced expression, and is suitable for efficient production of industrial enzymes, amino acids and bio-based compounds.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and specifically relates to a PgsiB mutant of an autoinducible promoter derived from Bacillus subtilis and its application in gene expression regulation and industrial enzyme production. Background Art

[0002] Bacillus subtilis is a Gram-positive bacterium widely used in industrial production. Its excellent growth characteristics, protein secretion capacity, and safety make it an ideal host for genetic engineering. It has been widely used in the production of industrial enzymes such as lipase, amylase, and protease. In genetic engineering, promoters are key elements in regulating gene expression, and their performance directly affects the expression level of the target gene. Conventional promoters often require the addition of exogenous inducers to regulate gene expression, which not only increases production costs but also may introduce environmental pollution and other issues.

[0003] Autoinducible promoters are a class of promoters that automatically regulate gene expression in response to specific physiological states or environmental signals within the cell, enabling efficient expression of target genes without the addition of exogenous inducers. The gsiB gene in Bacillus subtilis encodes a protein involved in cell wall synthesis. Its promoter, PgsiB, exhibits certain autoinducing properties and is induced by various stress conditions (such as heat shock, salt stress, ethanol stress, and oxygen or nutrient deprivation), thereby increasing the level of mediated gene transcription and promoting target protein expression. However, the relatively low activity of the original PgsiB promoter has limited its application in genetic engineering.

[0004] Therefore, in order to solve the problem of low promoter activity in the prior art, it is urgent to develop a highly active PgsiB promoter. Summary of the Invention

[0005] The present invention aims to provide a Bacillus subtilis-derived autoinducible promoter PgsiB mutant and its application, wherein the mutant can promote the expression of a target gene in Bacillus subtilis.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect of the present invention, a promoter mutant of Bacillus subtilis is provided. The mutant is obtained by irrational directed modification of the nucleotide sequence of the wild-type PgsiB promoter shown in SEQ ID NO: 1, and the mutant includes one of the following:

[0008] PgsiB mutant 1: the nucleotide sequence is shown in SEQ ID NO: 2;

[0009] PgsiB mutant 2: the nucleotide sequence is shown in SEQ ID NO: 3;

[0010] PgsiB mutant 3: the nucleotide sequence is shown in SEQ ID NO: 4.

[0011] In the above technical solution, the three mutants are obtained by using the promoter gene shown in SEQ ID NO.1 as the starting gene and performing mutations and screening at specific positions (i.e., positions 64, 106, 110, 112, 121, 164, 179, 246, 249, 266, and 269).

[0012] Specifically, in the PgsiB mutant 1, the following mutations occurred compared to the wild-type PgsiB promoter shown in SEQ ID NO: 1: G121T / C164A / T246A / T249A;

[0013] In the PgsiB mutant 2, the following mutations occurred compared to the wild-type PgsiB promoter shown in SEQ ID NO: 1: T64C / G106T / G266A;

[0014] In the PgsiB mutant 3, the following mutations occurred compared to the wild-type PgsiB promoter shown in SEQ ID NO: 1: G110A / C112T / C179A / A269C.

[0015] SEQ ID NO: 1 (PgsiB-wild type)

[0016] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTTTGGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGAGACAGGCATGATGCTGTACAAAAAGAGGCGCATTCTTGAACGACTGAA AGAAACAGAACGAGATGGAATAGCAGAAAGCAGACGGACACCGCGATCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTGTTTAAAAGAATTGTGAGCGGGAATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0017] SEQ ID NO: 2 (PgsiB mutant 1: PgsiB-m1)

[0018] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTTTGGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGAGACAGGCATGATGCT T TACAAAAAGAGGCGCATTCTTGAACGACTGAAAGAAACAGAA A GAGAGATGGAATAGCAGAAAGCAGACGGACACCGCGATCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTT A GT A TAAAAGAATTGTGAGCGGGAATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0019] SEQ ID NO: 3 (PgsiB Mutant 2: PgsiB-m2)

[0020] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTT C GGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGA T ACAGGCATGATGCTGTACAAAAAGAGGCGCATTCTTGAACGACTGAAAGAAACAGAACGAGAGATGGAATAGCAGAAAGCAGACGGACACCGCGATCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTGTTTAAAAGAATTGTGAGC A GGAATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0021] SEQ ID NO: 4 (PgsiB Mutant 3: PgsiB-m3)

[0022] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTTTGGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGAGACA A GT ATGATGCTGTACAAAAAGAGGCGCATTCTTGAACGACTGAAAGAAACAGAACGAGAGATGGAATAG A AGAAAGCAGACGGACACCGCGATCCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTTGTTTAAAAGAATTGTGAGCGGG C ATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0023] In a second aspect of the present invention, a recombinant vector containing the aforementioned promoter mutant is provided, which can effectively regulate the expression of related genes with the help of the promoter mutant.

[0024] In a third aspect of the present invention, a recombinant host cell containing the aforementioned promoter mutant is provided. This recombinant host cell can be used to efficiently express specific genes, providing a good cell model for subsequent research and applications.

[0025] In the fourth aspect of the present invention, a nucleic acid molecule is provided, which comprises the above-mentioned promoter mutant.

[0026] Furthermore, the nucleic acid molecule may also include a gene encoding α-amylase or a gene encoding glutamate decarboxylase (GAD). Such a nucleic acid molecule can provide a basis for subsequent gene expression and protein production.

[0027] In a fifth aspect of the present invention, uses of the aforementioned promoter mutant, recombinant vector or recombinant host cell in the following various application scenarios are provided.

[0028] a. Enhancing gene transcription: These can be used to enhance the transcription of target genes or to prepare reagents or kits for this purpose. By increasing gene transcription, the expression of the corresponding protein can be increased, providing more target protein for subsequent research and production. These recombinant vectors and recombinant host cells can be used to efficiently express specific genes and improve the expression efficiency of exogenous proteins.

[0029] b. Protein Preparation: These can be used to prepare various proteins, or to prepare reagents or kits for protein preparation. These proteins include, but are not limited to, proteins that regulate gene expression, proteins involved in the synthesis of target compounds, and proteins involved in membrane transport.

[0030] c. Production of target compounds: This can be used to produce specific target compounds or to prepare reagents or kits for producing target compounds. This can improve the production efficiency of target compounds by increasing the expression level of related genes.

[0031] d. Improving the activity of expressed proteases: Use of the aforementioned nucleic acid molecules, recombinant vectors, or recombinant host cells to enhance the enzymatic activity of expressed proteins. By operably linking a specific gene to a promoter mutant, the expression intensity of the gene can be significantly enhanced, thereby increasing the enzymatic activity of the corresponding protein.

[0032] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0033] After in-depth research and screening, the present invention successfully obtained a highly active promoter PgsiB mutant and constructed a corresponding expression vector and recombinant expression strain. The nucleic acid molecule with enhanced promoter activity provided by the present invention has a promoter activity significantly higher than that of the wild type. The nucleic acid molecule can be used for regulating the expression of target genes. For example, it can be operably connected to the α-amylase gene to significantly enhance the expression intensity of α-amylase; it can also be operably connected to the glutamate decarboxylase (GAD) gene to enhance the expression intensity of GAD. This not only improves the amino acid production efficiency of the recombinant strain, but also enhances the expression efficiency of exogenous proteins, providing strong technical support for research and production in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0035] Figure 1 This is the nucleic acid electrophoresis diagram of the promoter PgsiB fragment obtained by PCR.

[0036] Figure 2 This is a map of plasmid pBE-PgsiB-SPapre-amyE.

[0037] Figure 3 This is a picture of α-starch plate screening. DETAILED DESCRIPTION

[0038] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0039] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.

[0040] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained through existing methods.

[0041] In order to solve the technical problems of the present invention, the overall concept of the present invention is as follows:

[0042] Mutant construction: Random mutations were introduced into the PgsiB promoter (SEQ ID NO: 1) by error-prone PCR, and high-activity mutants (SEQ ID NO: 2-4) were obtained by combining amylase activity screening.

[0043] Application verification: The mutant promoter was connected to the α-amylase (amyE) or glutamate decarboxylase (gad) gene and transformed into Bacillus subtilis WB600 to verify its expression efficiency.

[0044] The mutant promoter activity of the present application is increased by up to 74.8% compared with the wild type; no exogenous induction is required, reducing production costs; and it is suitable for the efficient production of various industrial enzymes and metabolites.

[0045] The present application will be described in detail below with reference to examples and experimental data.

[0046] The experimental procedures and technical solutions involved in the examples were all conventional techniques in the art, including but not limited to: 1) experimental methods without specific parameters clearly marked were performed with reference to the standard conditions described in Molecular Cloning Laboratory Manual (3rd edition, edited by Sambrook et al., published by Cold Spring Harbor Laboratory Press, New York in 1989); 2) reagent preparation and instrument operating parameters not otherwise specified were subject to the standard operating procedures provided by the equipment manufacturers; 3) all biochemical reagents, cell lines and experimental consumables used in the examples were legally obtained through regular commercial channels.

[0047] The culture medium used in the examples is as follows:

[0048] LB medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L.

[0049] LB solid starch plate: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar powder 20 g / L, soluble starch 20 g / L.

[0050] TB medium: glycerol 5 g / L, peptone 12 g / L, yeast extract 24 g / L, dipotassium hydrogen phosphate 12.54 g / L, potassium dihydrogen phosphate 2.31 g / L.

[0051] SOC medium: tryptone 20 g / L, yeast extract 5 g / L, sodium chloride 0.5 g / L, potassium chloride 2.5 mM, magnesium sulfate 10 mM, glucose 20 mM.

[0052] RM medium: mannitol 90 g / L, sorbitol 90 g / L, NaCl 10 g / L, peptone 10 g / L.

[0053] All culture media were sterilized in an autoclave at 121°C for 20 min, and corresponding antibiotics were added to the culture media during use.

[0054] Bacillus subtilis 168 was purchased from the China Plasmid Vector, Bacteria, and Cell Line Gene Collection Center with the accession number being ATCC 23857.

[0055] Bacillus subtilis WB600 can be purchased commercially, for example, from Shanghai Beinuo Biotechnology Co., Ltd., product number addgene0652.

[0056] Example 1. Cloning and plasmid construction of wild-type PgsiB promoter

[0057] (1) Using the genome of Bacillus subtilis 168 (purchased from the China Plasmid Vector Strains and Cell Lines Collection Center with the deposit number ATCC 23857) as a template, the target promoter PgsiB fragment was obtained by PCR technology. The specific nucleotide sequence is shown in SEQ ID NO: 1. The specific PCR reaction system is as follows: 2 μL of Bacillus subtilis 168 genome template (100 ng / μL),

[0058] 2 μL upstream primer Primer P gsiB -F:

[0059] GTTCCTAAACTAGT GGTACC CTATCGAGACACGTTTTGGCT(SEQ ID NO.5),

[0060] 2 μL downstream primer P gsiB -R

[0061] TTTTTGCTTCTCAC CTCGAG TTTGAATTCCTCCTTTAATT(SEQ ID NO.6)、

[0062] DNA polymerase 2× Prime STAR Max DNA 25 μL, and sterile water to make up to 50 μL. PCR reaction program is as follows: 98°C pre-denaturation for 5 minutes, 98°C denaturation for 30 seconds, 55°C annealing for 5 seconds, 72°C extension for 30 seconds, 30 cycles, and a final extension at 72°C for 5 minutes. Take 3 μL of the PGsiB promoter fragment PCR product for nucleic acid verification. The target band size is 306 bp. Figure 1 The size shown is correct and the promoter PgsiB fragment was recovered using the Omega agarose gel extraction kit.

[0063] (2) Construction of the commercial original plasmid pBE-S and the initial plasmid pBE-SPapre-amyE

[0064] The commercial original plasmid pBE-S was purchased from B. subtilis Secretory Protein Expression with the product number CAT#3380.

[0065] To construct a recombinant plasmid carrying the amylase gene amyE, this study inserted the amyE gene (encoding amylase, which hydrolyzes starch; NCBI GenBank accession number AF032864.1) into the plasmid pBE-S between the HindIII and SaLI restriction endonuclease recognition sites. Furthermore, a SPapre signal peptide sequence was introduced upstream of the amyE gene to direct protein secretion. After a series of molecular biology manipulations, the initial plasmid pBE-SPapre-amyE was successfully obtained. From this, a linearized pBE-SPapre-amyE fragment was obtained by PCR. The specific PCR reaction system and procedure are as follows: Template: 2 μL of plasmid pBE-SPapre-amyE (concentration: 95 ng / μL).

[0066] Primers:

[0067] 2 μL upstream primer pBE-F sequence is:

[0068] AGCCAAACGTGTCTCGATAGGGTACCACTAGTTTAGGAAC, (SEQ ID NO. 7);

[0069] 2 μL downstream primer pBE-R sequence is:

[0070] AATTAAA GGAGGAAT TCAAACT CGAG GTG AGAAGCAAAAA (SEQ ID NO. 8). DNA polymerase: 2× Prime STAR Max DNA 25 μL. Sterile water: Make up to a total volume of 50 μL. PCR amplification procedure: 98°C pre-denaturation for 5 min, 98°C denaturation for 30 s, 55°C annealing for 5 sec, 72°C extension for 6 min, 30 cycles, and a final extension at 72°C for 5 min to ensure complete extension of all amplified products. Verification and recovery of the linearized plasmid fragment: 3 μL of the PCR amplification product was collected for nucleic acid verification. The expected target band size was 7190 bp, and the PCR products were separated and detected by agarose gel electrophoresis.

[0071] Electrophoresis results showed that the expected band size was consistent, indicating successful PCR amplification. Subsequently, the target band was recovered using the Omega Agarose Gel Extraction Kit, yielding the linearized fragment pBE-SPapre-amyE after double enzyme digestion, laying the foundation for subsequent gene cloning and expression experiments.

[0072] (3) The linearized fragment PgsiB and the linearized fragment pBE-SPapre-amyE obtained above were used to construct a recombinant plasmid. The specific process is as follows: 2 μL linearized promoter fragment PgsiB, 2 μL linearized plasmid fragment pBE-SPapre-amyE, 5 μL Norwegian ClonExpress II Mix, 1 μL ddHO, reaction conditions, incubate at 37°C for 30 minutes (Exnase II enzyme catalyzes homologous recombination); transform competent cells (such as DH5α), take 5 μL of recombinant product and add 50 μL ice-cold competent cells, and ice bath for 30 minutes. Heat shock at 42°C for 90 seconds, and quickly ice bath for 2 minutes. Add 900 μL SOC medium and shake culture at 37°C for 1 hour; plate screening, spread the bacterial liquid on LB plates containing a final concentration of 100 μg / mL ampicillin, and culture inverted at 37°C overnight. The monoclonal strain was selected and cultured in LB medium, and then the plasmid was extracted for identification and sequencing to obtain the recombinant plasmid pBE-PgsiB-SPapre-amyE. Figure 2 shown.

[0073] Example 2. Construction and screening of mutant library

[0074] (1) Literature studies have shown that the introduction of manganese ions into the PCR system can increase the mutation rate of PCR products. Therefore, manganese ions were added to the reaction system for obtaining the promoter PgsiB fragment by PCR to obtain the promoter PgsiB mutant fragment. The specific process is as follows: 2 μL of Bacillus subtilis 168 genome template (100 ng / μL), 2 μL of upstream primer PgsiB-FGTTCCTAAACTAGTGGTACCCTATCGAGACACGTTTGG CT (SEQ ID NO.9), 2 μL of downstream primer PgsiB-RTTTTTGCTTCTCACCTCGAGTTTGAATTCCTCCTTTAATT (SEQ ID NO.10), 25 μL of DNA polymerase 2×Prime STAR Max DNA, 2 μL of manganese ion solution (the manganese ion concentration in the final reaction system is 0.1 mM), and sterile water was added to 50 μL. The PCR amplification program was as follows: 98°C pre-denaturation for 5 min, 98°C denaturation for 30 s, 58°C annealing for 5 sec, 72°C extension for 30 s, 30 cycles, and finally 72°C extension for 5 min to obtain a promoter PgsiB nucleotide sequence fragment with random mutations (denoted as PgsiB*).

[0075] (2) Now, a linearized plasmid pBE-SPapre-amyE fragment is obtained by PCR. The specific process is the same as in Example 1. The linearized plasmid pBE-SPapre-amyE fragment and the promoter PgsiB* nucleotide sequence fragment with random mutations are connected. Using ClonExpress II Mix, the two fragments are connected by a one-step cloning method. Then, competent cells are transformed to obtain a recombinant plasmid. The specific method is the same as in Example 1. A monoclonal strain containing the recombinant plasmid pBE-PgsiB*-SPapre-amyE is grown on a solid plate. Finally, the monoclonal bacteria on the solid plate are eluted using liquid LB and cultured in a shaker at 37°C and 200 rpm for 2 hours. The plasmid is then extracted to obtain a mixed recombinant plasmid pBE-PgsiB*-SPapre-amyE containing the mutated promoter PgsiB* (PgsiB* represents a mutant of PgsiB), which is used as a promoter PgsiB mutation library to prepare for the subsequent screening of promoter PgsiB with strong activity.

[0076] Example 3. Screening of highly active promoter PgsiB mutants

[0077] (1) Using starch plates to screen for mutants of the dominant promoter PgsiB with strong activity. The mixed recombinant plasmid pBE-PgsiB*-SPapre-amyE obtained in Example 2 was transformed into Bacillus subtilis WB600 competent cells. The process was as follows: Step 1: Take the Bacillus subtilis WB600 competent cells from a -80°C refrigerator, place them on ice for 10 minutes, and wait for them to thaw. At the same time, place the electroporated mixed plasmid on ice for pre-cooling; Step 2: Take an appropriate amount of plasmid (about 1 μg, its volume does not exceed 10% of the competent volume), mix it thoroughly with the Bacillus subtilis WB600 competent cells, and place it on ice for 20 minutes; Step 3: Transfer the mixture to a pre-cooled electrode cup with a diameter of 2 mm, adjust the electroporator equipment to 25 μF, 200 Ω, and 2400V electric shock, and use high voltage electric shock to penetrate the cell membrane, so that the plasmid enters the competent cells. Immediately add 1 mL of RM medium, pipette to mix thoroughly, transfer to a 1.5 mL EP tube, and incubate in a shaker at 37°C, 200 rpm for 3 hours. Fourth, centrifuge the revived bacterial solution at 3000-4000 rpm for 3-5 minutes, discard some of the supernatant, resuspend, and spread on a plate containing LB solid medium containing kanamycin antibiotics (60 μg / mL). Incubate in a 37°C incubator for 10-12 hours to grow a single colony, which serves as the experimental group. The control strain is designated as D0. The recombinant plasmid pBE-PgsiB-SPapre-amyE containing the wild-type promoter PgsiB was transformed into Bacillus subtilis WB600 as a control group, following the same procedures as the experimental group.

[0078] (2) Since Bacillus subtilis WB600 / pBE-PgsiB-SPapre-amyE contains the amylase gene amyE (amyE is used as a reporter gene) and secretes amylase AmyE during the culture process, which can hydrolyze starch. Therefore, the activity of the promoter PgsiB mutant can be judged based on the size of the transparent zone around the single clone WB600 / pBE-PgsiB*-SPapre-amyE on the starch plate (LB solid + 10% starch). Select the single clone with a larger transparent zone on the starch plate in the experimental group than in the control group, such as Figure 3 As shown. Four mutant strains with transparent circles larger than those of the control group were screened out from approximately 1,500 single clones and numbered as m1, m2, m3 and m4. Shake flask fermentation verification was performed. First, the dominant mutant strains m1-m4 were obtained by initial screening on the starch plate, and were transferred to 50 mL triangular flasks containing 5 mL LB for activation, and kanamycin with a final concentration of 60 μg / mL was added, and cultured in a shaker at 37°C and 200 rpm for 11 hours. Secondly, 1 mL of bacterial solution was transferred to a 250 mL triangular flask containing 50 mL TB and cultured in a shaker at 37°C and 200 rpm for 36 hours. Detect OD 600The fermentation broth was centrifuged to obtain the fermentation supernatant, and the AmyE activity in the fermentation supernatant was detected. The enzyme activity of the control strain D0 (WB600 / pBE-PgsiB-SPapre-amyE) was defined as 100%, and the corresponding enzyme activities of the other mutants were relative values.

[0079] (3) Enzyme activity detection

[0080] a. Amylase activity detection method

[0081] Substrate Solution: Prepare a 1% soluble starch solution as the substrate for the α-amylase activity assay. Buffer: Use 20 mmol / L phosphate buffer at a pH of 6.0 as the reaction buffer for the activity assay. To a 15 mL stoppered test tube, add 1 mL of the prepared substrate solution and 900 μL of phosphate buffer. Mix thoroughly and preheat the tube in a 70°C water bath for 10 minutes to ensure a stable reaction temperature.

[0082] Dilute the amylase solution to be tested appropriately with phosphate buffer. Quickly add 100 μL of the diluted enzyme solution to a stoppered test tube containing the substrate and buffer. Immediately and gently shake to ensure full contact between the enzyme and substrate, initiating the enzymatic reaction. The reaction is carried out at a constant temperature of 70°C for 5 minutes. After the reaction is complete, immediately add 3 mL of DNS (3,5-dinitrosalicylic acid reagent) to the stoppered test tube and rapidly shake to mix. DNS reagent reacts with the reducing sugars produced by the reaction to form a colorimetric reaction. Subsequently, heat the stoppered test tube in a boiling water bath for 7 minutes to promote the colorimetric reaction. After heating, immediately transfer the test tube to ice water to cool and terminate the reaction. After cooling in the ice water bath for 3-5 minutes, add 10 mL of deionized water to the stoppered test tube and gently mix to bring the reaction to an appropriate volume for subsequent analysis. Measure the absorbance of the reaction solution at 540 nm using a spectrophotometer.

[0083] b. Definition of enzyme activity units

[0084] Under the specific experimental conditions described above, the amount of enzyme that releases reducing sugars equivalent to 1 μmol of glucose per minute is defined as one unit of enzyme activity (U). By measuring the absorbance of the reaction solution at a wavelength of 540 nm and combining it with a standard curve, the amount of reducing sugars generated in the reaction can be calculated, and the enzymatic activity of the amylase can be derived.

[0085] (4) The experimental results are shown in Table 1.

[0086] Table 1 α-amylase activity of different mutants verified by shake flask

[0087] D0 m1 m2 m3 m4 <![CDATA[OD 600 ]]> 9.2 9.1 9.3 9.2 9.2 Relative enzyme activity (%) 100 153.4 177.2 168.9 114.6 <![CDATA[Relative enzyme activity / OD 600 > 10.9 16.9 19.1 18.4 12.5 <![CDATA[Relative enzyme activity / OD 600 Increase (%)]]> - 54.7 74.8 68.4 14.3

[0088] As shown in Table 1, the relative enzyme activities of mutant strains m1, m2, m3 and m4 were increased by 153.4%, 177.2%, 168.9% and 114.6% respectively compared with the control group D0; 600 The enzyme activities of the three compounds were increased by 54.7%, 74.8%, 68.4% and 14.3% respectively compared with the control group.

[0089] Recombinant plasmids were extracted from strains m1-m3 and sent to Sangon for sequencing. The results are shown below: The nucleotide sequences of m1, m2, and m3 are SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively.

[0090] Example 4: Verification of the universality of the dominant mutant promoter PgsiB and its application in γ-aminobutyric acid 1. Construction of mutant promoter PgsiB, corresponding recombinant plasmids m1, m2 and m3

[0091] To verify the versatility of the promoters corresponding to the above mutants m1, m2 and m3 and their application in the production of γ-aminobutyric acid, the GAD gene from Enterococcus faecalis (accession number: WP_033598563.1) was used to construct a recombinant plasmid by a one-step cloning method. The specific process is as follows: 2 μL plasmid pET28(+)-Efgad template (90 ng / μL) [Catalysts2024, 14(12), 905; Synthesis ofγ-Aminobutyric Acid from MonosodiumGlutamate Using an Engineered Glutamate DecarboxylaseActive at a Neutral pH],

[0092] 2 μL upstream primer gad-F:

[0093] TCGGATCCGAATTCAAGCTT ATG ACCAAGAAGAACGATCT(SEQ ID NO.11),

[0094] 2 μL downstream primer gad-R:

[0095] TGTCTAGACTGCAGGTCGACTTAGATGATGGACTGGTTTG (SEQ ID NO.12),

[0096] DNA polymerase 2× Prime STAR Max DNA (25 μL) was added to the final volume of 50 μL with sterile water. The PCR reaction protocol was as follows: 98°C initial denaturation for 5 min, followed by denaturation at 98°C for 30 s, annealing at 58°C for 5 sec, and extension at 72°C for 2 min for 30 cycles, with a final extension at 72°C for 5 min to obtain the Efgad gene fragment.

[0097] Now, the linearized plasmid pBE-PgsiB-SPapre fragment is obtained by PCR. The specific PCR process is as follows: 2 μL of plasmid pBE-PgsiB-SPapre-amyE (95 ng / μL) is used as the template.

[0098] 2 μL upstream primer pBE-F1:

[0099] AGATCGTTCTTCTTGGTCATAAGCTTGAATTCGGATCCGA (SEQ ID NO. 13),

[0100] 2 μL downstream primer pBE-R1:

[0101] CAAACCAGTCCATCATCTAAGTCGACCTGCAGTCTAGACA (SEQ ID NO. 14) was prepared using 25 μL of 2× Prime STAR Max DNA polymerase and a 50 μL buffer with sterile water. The PCR reaction protocol was as follows: 98°C initial denaturation for 5 minutes, followed by 30 cycles of denaturation at 98°C for 30 seconds, annealing at 55°C for 5 seconds, and extension at 72°C for 6 minutes, with a final extension at 72°C for 5 minutes. A 3 μL PCR product of the linearized plasmid pBE-PgsiB-SPapre was collected for nucleic acid verification. The target band was 6053 bp in size, which was confirmed by agarose gel electrophoresis and recovered using the Omega Agarose Gel Recovery Kit to obtain the linearized fragment pBE-PgsiB-SPapre.

[0102] The linearized Efgad fragment obtained above and the linearized pBE-PgsiB-SPapre fragment were recombined to construct a plasmid. The specific process is as follows: 2 μL of the linearized promoter fragment Efgad, 2 μL of the linearized plasmid fragment pBE-PgsiB-SPapre, 5 μL of Norwegian ClonExpress II Mix, and 1 μL of ddHO. The reaction conditions are: incubate at 37°C for 30 minutes (Exnase II enzyme catalyzes homologous recombination). Transform competent cells (such as DH5α) and add 5 μL of the recombinant product to 50 μL of ice-cold competent cells. Incubate on ice for 30 minutes. Heat shock at 42°C for 90 seconds, then quickly incubate on ice for 2 minutes. Add 900 μL of SOC medium and incubate at 37°C with shaking for 1 hour. For plate selection, spread the bacterial liquid on LB plates containing the corresponding antibiotic and incubate inverted at 37°C overnight. Single clones were selected and cultured in LB medium. Plasmids were then extracted, identified, and sequenced to obtain the recombinant plasmid pBE-PgsiB-SPapre-Efgad. The corresponding recombinant plasmids for the remaining mutant promoters PgsiB, m1, m2, and m3, pBE-M1PgsiB-SPapre-Efgad, pBE-M2PgsiB-SPapre-Efgad, and pBE-M3PgsiB-SPapre-Efgad, where M1PgsiB, M2PgsiB, and M3PgsiB represent the promoter PgsiB mutation sequences corresponding to strains m1, m2, and m3, respectively, were then transformed into Bacillus subtilis WB600.

[0103] Bacillus subtilis WB600 is a commercially available strain that precisely knocks out six protease genes (aprE, nprE, epr, mpr, bpr, and vpr) from the genome of Bacillus subtilis 168, significantly reducing extracellular protease activity. For details, see the reference Engineering a Bacillus subtilis Expression-Secretion System with a Strain Deficient in Six Extracellular Proteases.

[0104] They are the recombinant strains of experimental group 1, experimental group 2 and experimental group 3 respectively; the plasmid pBE-PgsiB-SPapre-Efgad was transformed into Bacillus subtilis WB600, which is the control group strain D1.

[0105] 2. Measure enzyme activity

[0106] Enzyme activity definition: The amount of enzyme required to convert the substrate into 1 μmol γ-aminobutyric acid (GABA) per minute is defined as one enzyme activity unit (U).

[0107] The specific process is as follows:

[0108] Preparation of the substrate solution for the recombinant glutamate decarboxylase (GAD) enzyme activity assay: Dissolve 0.1 mol / L sodium glutamate monohydrate and 0.15 mmol / L pyridoxal phosphate (PLP) in 50 mmol / L sodium hydrogen phosphate-citrate buffer (pH 4.5) to prepare the substrate solution. Store the solution at 4°C in the dark to prevent component decomposition or other chemical reactions that could affect subsequent experiments. For the reaction system, add 360 μL of the prepared substrate solution to a 1.5 mL EP tube. Preheat the tube in a 37°C water bath for 10 minutes to allow the substrate solution to reach the appropriate reaction temperature and ensure stable subsequent reaction progress. After preheating, add 40 μL of crude GAD enzyme solution to the tube. The tube is then quickly returned to the 37°C water bath to initiate the reaction, which lasts for 4 minutes. After the reaction, 600 μL of 0.2 mol / L, pH 10 boric acid buffer was immediately added to the EP tube to terminate the reaction. To ensure complete enzyme inactivation, the EP tube was placed in boiling water for 10 minutes. GABA production was determined using HPLC-OPA pre-column amino acid derivatization. Detailed procedures for this method can be found in the reference [Liu Tiebing, Gong Jinyan, Zhu Yinbang, et al. Study on the detection of γ-aminobutyric acid in agricultural products by pre-column derivatization].

[0109] The corresponding recombinant plasmids of the mutant promoter PgsiB, m1, m2 and m3 were verified by shake flask fermentation and enzyme activity measurement. The results are shown in Table 2.

[0110] Table 2: Effects of promoter PgsiB mutants on the activity of recombinant GAD enzyme expressed in strains

[0111] control group Experimental Group 1 Experimental Group 2 Experimental Group 3 <![CDATA[OD 600 ]]> 9.2 9.1 9.2 9.0 Relative enzyme activity (%) 100 154.3 146.8 159.3 <![CDATA[Relative enzyme activity / OD 600 > 10.9 17.0 16.0 17.7 <![CDATA[Relative enzyme activity / OD 600 Increase (%)]]> - 55.6 46.4 62.4

[0112] As shown in Table 2, the relative enzyme activity / OD 600 The results were 55.6%, 46.4% and 62.4% higher than those of the control group, indicating that the promoter PgsiB mutant is beneficial to the recombinant expression of the Efgad enzyme gene. It also shows that the promoter PgsiB mutant has certain versatility and can be used for the efficient production of γ-aminobutyric acid.

[0113] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

[0114] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0115] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0116] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A Bacillus subtilis-derived autoinducible promoter PgsiB mutant, characterized in that: The mutant is obtained by irrational directed modification of the nucleotide sequence of the wild-type PgsiB promoter shown in SEQ ID NO: 1, and the mutant includes one of the following: PgsiB mutant 1: the nucleotide sequence is shown in SEQ ID NO: 2; PgsiB mutant 2: the nucleotide sequence is shown in SEQ ID NO: 3; PgsiB mutant 3: the nucleotide sequence is shown in SEQ ID NO:

4.

2. The promoter mutant according to claim 1, characterized in that In the PgsiB mutant 1, the following mutations occurred compared to the wild-type PgsiB promoter shown in SEQ ID NO: 1: G121T / C164A / T246A / T249A; In the PgsiB mutant 2, the following mutations occurred compared to the wild-type PgsiB promoter shown in SEQ ID NO: 1: T64C / G106T / G266A; In the PgsiB mutant 3, the following mutations occurred compared to the wild-type PgsiB promoter shown in SEQ ID NO: 1: G110A / C112T / C179A / A269C.

3. A recombinant vector comprising the promoter mutant according to claim 1 or 2, and a target gene operably linked thereto.

4. The recombinant vector according to claim 3, characterized in that The target gene is an α-amylase gene (amyE) or a glutamic acid decarboxylase gene (gad).

5. A recombinant Bacillus subtilis host cell, characterized in that Comprising the recombinant vector according to claim 3 or 4.

6. Use of the promoter mutant according to any one of claims 1-2, the recombinant vector according to claims 3-4, or the host cell according to claim 5, characterized in that: The application includes at least one of the following: a. Enhance gene transcription levels; b. Preparation of recombinant protein; c. Producing target compounds; d. Improve the activity of expressed protease.

7. The use according to claim 6, characterized in that The target compound is gamma-aminobutyric acid (GABA).

Images