A self-induced promoter PgsiB mutant from Bacillus subtilis and its applications

By directionally modifying the nucleotide sequence of the Bacillus subtilis PgsiB promoter, a highly active PgsiB mutant was obtained, solving the problem of low promoter activity and realizing efficient gene expression and industrial enzyme production.

CN120442626BActive Publication Date: 2026-03-13WUHAN POLYTECHNIC UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

The existing PgsiB promoter of Bacillus subtilis has low activity, which limits its application in genetic engineering, especially in achieving efficient gene expression in industrial enzyme production.

Method used

By irrationally and directionally modifying the nucleotide sequence of the PgsiB promoter and introducing mutations at specific positions, highly active PgsiB mutants can be obtained. Corresponding recombinant vectors and recombinant host cells can then be constructed to achieve effective regulation of gene expression.

Benefits of technology

It significantly improved the expression intensity of target genes such as α-amylase and glutamate decarboxylase, enhanced the amino acid production efficiency and exogenous protein expression efficiency of recombinant strains, and reduced production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442626B_ABST
    Figure CN120442626B_ABST
Patent Text Reader

Abstract

This invention discloses a self-inducible promoter PgsiB mutant derived from Bacillus subtilis and its applications. The mutant is obtained by irrationally and directionally modifying the wild-type PgsiB promoter shown in SEQ ID NO:1, through non-directional modification of its nucleotide sequence, as shown in SEQ ID NO:2-4. The mutant promoter significantly improves the expression efficiency of α-amylase and glutamate decarboxylase (GAD) in Bacillus subtilis, with enzyme activities increased by 74.8% and 62.4%, respectively. The promoter of this invention does not require exogenous inducers and can achieve self-inducible gene expression in response to intracellular stress signals (such as heat shock, salt stress, etc.), making it suitable for the efficient production of industrial enzymes, amino acids, and bio-based compounds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a self-inducible promoter PgsiB mutant derived from Bacillus subtilis and its application in gene expression regulation and industrial enzyme production. Background Technology

[0002] Bacillus subtilis is a Gram-positive bacterium widely used in industrial production. It possesses excellent growth characteristics, protein secretion ability, and safety, making it an ideal host bacterium for genetic engineering. It is already widely used in the production of industrial enzymes such as lipases, amylases, and proteases. In genetic engineering, promoters are key elements in gene expression regulation, and their performance directly affects the expression level of the target gene. Traditional promoters often require the addition of exogenous inducers to regulate gene expression, which not only increases production costs but may also introduce environmental pollution and other problems.

[0003] Self-inducible promoters are a class of promoters that can automatically regulate gene expression based on specific physiological states or environmental signals within the cell, achieving efficient expression of the target gene without the need for exogenous inducers. The gsiB gene in Bacillus subtilis encodes a protein related to cell wall synthesis, and its promoter, PgsiB, possesses certain self-inducible properties. It is induced by various stress conditions (such as heat shock, salt stress, ethanol stress, oxygen or nutrient deficiency), thereby increasing the mediated gene transcription level and promoting the expression of the target protein. However, the original PgsiB promoter has relatively low activity, limiting its application in genetic engineering.

[0004] Therefore, in order to solve the problem of low promoter activity in existing technologies, it is urgent to develop a highly active PgsiB promoter. Summary of the Invention

[0005] The purpose of this invention is to provide a self-inducible promoter PgsiB mutant derived from Bacillus subtilis and its application, which can promote the expression of the target gene in Bacillus subtilis.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect of the invention, a promoter mutant of Bacillus subtilis is provided, said mutant being obtained by irrationally and directionally modifying the nucleotide sequence of the wild-type PgsiB promoter shown in SEQ ID NO:1, and said mutant comprising one of the following:

[0008] PgsiB mutant 1: Nucleotide sequence as shown in SEQ ID NO: 2;

[0009] PgsiB mutant 2: Nucleotide sequence as shown in SEQ ID NO: 3;

[0010] PgsiB mutant 3: The nucleotide sequence is shown in SEQ ID NO: 4.

[0011] In the above technical solution, the three mutants are obtained by using the promoter gene shown in SEQ ID NO.1 as the starting gene and by mutating and screening at specific positions (i.e., at positions 64, 106, 110, 112, 121, 164, 179, 246, 249, 266, and 269).

[0012] Specifically, in the PgsiB mutant 1, the following mutations occur compared to the wild-type PgsiB promoter shown in SEQ ID NO:1: G121T / C164A / T246A / T249A;

[0013] In the PgsiB mutant 2, the following mutation occurs compared to the wild-type PgsiB promoter shown in SEQ ID NO:1: T64C / G106T / G266A;

[0014] In the PgsiB mutant 3, the following mutations occur compared to the wild-type PgsiB promoter shown in SEQ ID NO:1: G110A / C112T / C179A / A269C.

[0015] SEQ ID NO: 1 (PgsiB - Wild Type)

[0016] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTTTGGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGAGACAGGCATGATGCTGTACAAAAAGAGGCGCATTCTTGAACGACTGAA AGAAACAGAACGAGATGGAATAGCAGAAAGCAGACGGACACCGCGATCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTGTTTAAAAGAATTGTGAGCGGGAATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0017] SEQ ID NO: 2 (PgsiB mutant 1: PgsiB-m1)

[0018] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTTTGGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGAGACAGGCATGATGCT T TACAAAAAGAGGCGCATTCTTGAACGACTGAAAGAAACAGAA A GAGAGATGGAATAGCAGAAAGCAGACGGACACCGCGATCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTT A GT A TAAAAGAATTGTGAGCGGGAATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0019] SEQ ID NO: 3 (PgsiB Mutant 2: PgsiB-m2)

[0020] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTT C GGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGA T ACAGGCATGATGCTGTACAAAAAGAGGCGCATTCTTGAACGACTGAAAGAAACAGAACGAGAGATGGAATAGCAGAAAGCAGACGGACACCGCGATCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTGTTTAAAAGAATTGTGAGC A GGAATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0021] SEQ ID NO: 4 (PgsiB Mutant 3: PgsiB-m3) <B

[0022] CTATCGAGACACGTTTGGCTGGAAAAAACTTTTCCAGATAGTGCCGGTTGCCGGAATGGTTTTTGGCGCCGCTGCCAATCGCTCAACATTAAACGACATTACCGAGACA A GT ATGATGCTGTACAAAAAGAGGCGCATTCTTGAACGACTGAAAGAAACAGAACGAGAGATGGAATAG A AGAAAGCAGACGGACACCGCGATCCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTTGTTTAAAAGAATTGTGAGCGGG C ATACAACAACCAACACCAATTAAAGGAGGAATTCAAA

[0023] In a second aspect, the present invention provides a recombinant vector containing the aforementioned promoter mutant. This recombinant vector can effectively regulate the expression of related genes using the promoter mutant.

[0024] In a third aspect, the present invention provides a recombinant host cell containing the aforementioned promoter mutant. This recombinant host cell can be used for efficient expression of specific genes, providing a good cell model for subsequent research and applications.

[0025] In a fourth aspect of the invention, a nucleic acid molecule is provided that comprises the promoter mutant described above.

[0026] Furthermore, the nucleic acid molecule may also include a gene encoding α-amylase or a gene encoding glutamate decarboxylase (GAD). Such a nucleic acid molecule can provide a foundation for subsequent gene expression and protein production.

[0027] In a fifth aspect of the invention, the above-described promoter mutants, recombinant vectors, or recombinant host cells are provided for use in a variety of applications.

[0028] a. Enhancing gene transcription levels: This can be used to enhance the transcription level of target genes, or to prepare reagents or kits for enhancing gene transcription levels. By increasing gene transcription levels, the expression level of the corresponding protein can be increased, providing more target proteins for subsequent research and production. These recombinant vectors and recombinant host cells can be used for efficient expression of specific genes, improving the expression efficiency of exogenous proteins.

[0029] b. Protein Preparation: This tool can be used to prepare various proteins, or to prepare reagents or kits for protein preparation. These proteins include, but are not limited to, gene expression regulatory proteins, proteins related to the synthesis of target compounds, and proteins related to membrane transport.

[0030] c. Production of target compounds: This can be used to produce specific target compounds, or to prepare reagents or kits for producing target compounds. The production efficiency of the target compound can be improved by increasing the expression level of relevant genes.

[0031] d. Enhancing the activity of expressed proteases: The application of the above-mentioned nucleic acid molecules, recombinant vectors, or recombinant host cells in enhancing the enzyme activity of expressed proteins. By operatively linking specific genes to promoter mutants, the expression intensity of genes can be significantly enhanced, thereby increasing the enzyme activity of the corresponding proteins.

[0032] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0033] Through in-depth research and screening, this invention successfully obtained a highly active promoter PgsiB mutant and constructed the corresponding expression vector and recombinant expression strain. The nucleic acid molecule provided by this invention, which enhances promoter activity, exhibits significantly higher promoter activity than the wild type. This nucleic acid molecule can be used for the expression regulation of target genes; for example, operably linking it to the α-amylase gene can significantly enhance the expression intensity of α-amylase; operably linking it to the glutamate decarboxylase (GAD) gene can also enhance the expression intensity of GAD. This not only improves the amino acid production efficiency of the recombinant strain but also enhances the expression efficiency of exogenous proteins, providing strong technical support for research and production in related fields. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1 Electrophoresis diagram of nucleic acid obtained by PCR for the promoter PgsiB fragment.

[0036] Figure 2 The image shows the spectrum of plasmid pBE-PgsiB-SPapre-amyE.

[0037] Figure 3 This is a screening diagram of α-starch plates. Detailed Implementation

[0038] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0039] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0040] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0041] To address the technical problem of this invention, the overall concept of this invention is as follows:

[0042] Mutant construction: Random mutations were introduced into the PgsiB promoter (SEQ ID NO:1) by error-prone PCR, and high-activity mutants (SEQ ID NO:2-4) were obtained by screening for amylase activity.

[0043] Application validation: The mutant promoter was linked to the α-amylase (amyE) or glutamate decarboxylase (gad) gene and transformed into Bacillus subtilis WB600 to verify its expression efficiency.

[0044] The mutant promoter activity of this application is up to 74.8% higher than that of the wild type; it does not require exogenous induction, reducing production costs; and it is suitable for the efficient production of a variety of industrial enzymes and metabolites.

[0045] The present application will now be described in detail with reference to embodiments and experimental data.

[0046] The experimental procedures and technical solutions involved in the embodiments all adopt conventional technical means in the field, including but not limited to: 1) Experimental methods without explicitly marked specific parameters shall be performed in accordance with the standard conditions recorded in Molecular Cloning: A Laboratory Manual (3rd edition, edited by Sambrook et al., Cold Spring Harbor Laboratory Press, New York, 1989); 2) Reagent preparation and instrument operation parameters not specifically specified shall be in accordance with the standard operating procedures provided by the equipment manufacturer; 3) All biochemical reagents, cell lines and experimental consumables used in the embodiments can be legally obtained through legitimate commercial channels.

[0047] The culture medium used in the examples is as follows:

[0048] LB medium: yeast extract 5 g / L, peptone 10 g / L, NaCl 10 g / L.

[0049] LB solid starch plate: yeast powder 5g / L, peptone 10g / L, NaCl 10g / L, agar powder 20g / L, soluble starch 20g / L.

[0050] TB medium: glycerol 5 g / L, peptone 12 g / L, yeast extract 24 g / L, dipotassium hydrogen phosphate 12.54 g / L, potassium dihydrogen phosphate 2.31 g / L.

[0051] SOC medium: tryptic peptone 20 g / L, yeast extract 5 g / L, sodium chloride 0.5 g / L, potassium chloride 2.5 mM, magnesium sulfate 10 mM, glucose 20 mM.

[0052] RM medium: mannitol 90g / L, sorbitol 90g / L, NaCl 10g / L, peptone 10g / L.

[0053] All culture media were sterilized in an autoclave at 121°C for 20 minutes, and the corresponding antibiotics were added during the use of the culture media.

[0054] Bacillus subtilis 168 was purchased from the China Plasmid Vector Strains Cell Line Gene Collection Center, with accession number ATCC 23857.

[0055] Bacillus subtilis WB600 is commercially available, for example from Shanghai Beinuo Biotechnology Co., Ltd., catalog number addgene0652.

[0056] Example 1. Cloning and plasmid construction of wild-type PgsiB promoter

[0057] (1) Using the genome of Bacillus subtilis 168 (purchased from the China National Library of Plasmid Vectors, Cell Lines and Genetic Preservation Center, accession number ATCC 23857) as a template, the target promoter PgsiB fragment was obtained by PCR technology. The specific nucleotide sequence is shown in SEQ ID NO: 1. The specific PCR reaction system is as follows: 2 μL of Bacillus subtilis 168 genome template (100 ng / μL).

[0058] 2 μL upstream primer P gsiB -F:

[0059] GTTCCTAAACTAGT GGTACC CTATCGAGACACGTTTTGGCT(SEQ ID NO.5),

[0060] 2μL downstream primer P gsiB -R

[0061] TTTTTGCTTCTCAC CTCGAG TTTGAATTCCTCCTTTAATT(SEQ ID NO.6)、

[0062] DNA polymerase 2×Prime STAR Max, DNA 25μL, sterile water to a final volume of 50μL. The PCR reaction program is as follows: PCR amplification program: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 55℃ annealing for 5 sec, 72℃ extension for 30 s, 30 cycles, final extension at 72℃ for 5 min. Take 3μL of the PCR product containing the 1gsiB promoter fragment for nucleic acid verification. The target band is 306bp in size. Figure 1 The size shown is correct. The promoter PgsiB fragment was recovered using the Omega agarose gel recovery kit.

[0063] (2) Construction of commercial original plasmid pBE-S and initial plasmid pBE-SPapre-amyE

[0064] The commercially available original plasmid pBE-S was purchased from B. subtilis Secretory Protein Expression, catalog number CAT#3380.

[0065] To construct a recombinant plasmid carrying the amylase gene amyE, this study inserted the amyE gene (encoding amylase, which hydrolyzes starch, NCBI accession number GenBank accession number AF032864.1) between the HindIII and SaLI restriction endonuclease recognition sites of plasmid pBE-S. Simultaneously, a SPapre signal peptide sequence was introduced upstream of the amyE gene; this signal peptide guides the secretion of the mediated protein extracellularly. After a series of molecular biology operations, the initial plasmid pBE-SPapre-amyE was successfully obtained. Based on this, the linearized plasmid pBE-SPapre-amyE fragment was obtained by PCR. The specific PCR reaction system and procedure are as follows: Template: 2 μL plasmid pBE-SPapre-amyE (concentration 95 ng / μL).

[0066] Primers:

[0067] The sequence of the 2μL upstream primer pBE-F is as follows:

[0068] AGCCAAACGTGTCTCGATAGGGTACCACTAGTTTAGGAAC, (SEQ ID NO. 7);

[0069] The 2μL downstream primer pBE-R sequence is as follows:

[0070] AATTAAA GGAGGAAT TCAAACT CGAG GTG AGAAGCAAAAA (SEQ ID NO. 8). DNA polymerase: 2×Prime STAR Max DNA 25μL. Sterile water: Add to a total volume of 50μL. PCR amplification program: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 55℃ annealing for 5 sec, 72℃ extension for 6 min, 30 cycles, and a final 72℃ extension for 5 min to ensure complete extension of all amplification products. Verification and recovery of linearized plasmid fragments: 3μL of PCR amplification product was used for nucleic acid verification. The expected target band size was 7190bp. The PCR products were separated and detected by agarose gel electrophoresis.

[0071] Electrophoresis results showed that the band size was as expected, indicating successful PCR amplification. Subsequently, the target band was recovered using an Omega agarose gel extraction kit to obtain the linearized fragment pBE-SPapre-amyE after double enzyme digestion, laying the foundation for subsequent gene cloning and expression experiments.

[0072] (3) The linearized fragments PgsiB and pBE-SPapre-amyE obtained above were used to construct recombinant plasmids. The specific process is as follows: 2 μL of linearized promoter fragment PgsiB, 2 μL of linearized plasmid fragment pBE-SPapre-amyE, 5 μL of Novizan ClonExpress II Mix, and 1 μL of ddHO were added. The reaction conditions were: incubation at 37℃ for 30 min (Exnase II enzyme catalyzes homologous recombination); transformation of competent cells (such as DH5α) was performed, and 5 μL of the recombinant product was added to 50 μL of ice-cold competent cells. The cells were then incubated on ice for 30 min. Heat shock was performed at 42℃ for 90 s, followed by immediate ice incubation for 2 min. 900 μL of SOC medium was added, and the cells were cultured at 37℃ with shaking for 1 h; plate screening was performed by spreading the bacterial culture on LB plates containing a final concentration of 100 μg / mL ampicillin and incubating upside down at 37℃ overnight. Single-clonal strains were selected and cultured in LB medium. Plasmids were then extracted, identified, and sequenced to obtain the recombinant plasmid pBE-PgsiB-SPapre-amyE. The diagram is shown below. Figure 2 As shown.

[0073] Example 2. Construction and Screening of Mutant Libraries

[0074] (1) Literature studies have shown that introducing manganese ions into the PCR system can increase the mutation rate of PCR products. Therefore, manganese ions were added to the reaction system for obtaining the promoter PgsiB fragment by PCR to obtain the promoter PgsiB mutant fragment. The specific process is as follows: 2 μL Bacillus subtilis 168 genome template (100 ng / μL), 2 μL upstream primer PgsiB-FGTTCCTAAACTAGTGGTACCCTATCGAGACACGTTTGG CT (SEQ ID NO.9), 2 μL downstream primer PgsiB-RTTTTTGCTTCTCACCTCGAGTTTGAATTCCTCCTTTAATT (SEQ ID NO.10), 25 μL DNA polymerase 2×Prime STAR Max DNA, 2 μL manganese ion solution (the final manganese ion concentration in the reaction system is 0.1 mM), and sterile water was added to make up to 50 μL. PCR amplification program: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 58℃ annealing for 5 sec, 72℃ extension for 30 s, 30 cycles, and a final extension at 72℃ for 5 min to obtain the nucleotide sequence fragment of the promoter PgsiB with random mutation (denoted as PgsiB*).

[0075] (2) The linearized plasmid pBE-SPapre-amyE fragment was obtained by PCR, following the same procedure as in Example 1. The linearized plasmid pBE-SPapre-amyE fragment and the randomly mutated promoter PgsiB* nucleotide sequence fragment were ligated using Novizan ClonExpress II Mix via a one-step cloning method. Then, competent cells were transformed to obtain the recombinant plasmid, following the same procedure as in Example 1. A single-clone bacterial strain containing the recombinant plasmid pBE-PgsiB*-SPapre-amyE was placed on a solid plate. Finally, the single-clone bacterial cells were eluted from the solid plate using liquid LB and cultured at 37°C and 200 rpm for 2 hours. The plasmid was then extracted to obtain the mixed recombinant plasmid pBE-PgsiB*-SPapre-amyE (PgsiB* represents a mutant of PgsiB), containing the mutated promoter PgsiB*. This served as a PgsiB promoter mutant library, preparing for subsequent screening of highly active PgsiB promoters.

[0076] Example 3. Screening for highly active promoter PgsiB mutants

[0077] (1) Screening for the dominant promoter PgsiB mutant with strong activity using starch plates. The mixed recombinant plasmid pBE-PgsiB*-SPapre-amyE obtained in Example 2 was transformed into Bacillus subtilis WB600 competent cells. The process is as follows: First, Bacillus subtilis WB600 competent cells were taken from a -80℃ freezer and placed on ice for 10 min to thaw. At the same time, the electroporated mixed plasmid was placed on ice for pre-cooling. Second, an appropriate amount of plasmid (about 1 μg, whose volume does not exceed 10% of the competent cell volume) was taken and thoroughly mixed with Bacillus subtilis WB600 competent cells and placed on ice for 20 min. Third, the mixture was transferred to a pre-cooled 2 mm diameter electrode cup, and the electroporator was set to 25 μF, 200 Ω, 2400 V for electroporation. The cell membrane was broken down by high voltage, and the plasmid entered the competent cells. Immediately add 1 mL of RM medium, mix well by pipetting, transfer to a 1.5 mL EP tube, and incubate at 37℃ and 200 rpm for 3 h. Fourth, centrifuge the revived bacterial culture at 3000-4000 rpm for 3-5 min, discard some of the supernatant, resuspend, and spread on LB agar plates containing kanamycin antibiotic (60 μg / mL). Incubate at 37℃ for 10-12 h until a single colony grows; this is the experimental group, and the control strain is designated D0. Transform Bacillus subtilis WB600 with the recombinant plasmid pBE-PgsiB-SPapre-amyE containing the wild-type promoter PgsiB as the control group; the procedure is the same as for the experimental group.

[0078] (2) Because Bacillus subtilis WB600 / pBE-PgsiB-SPapre-amyE contains the amylase gene amyE (amyE serves as a reporter gene), it secretes amylase AmyE during culture. Amylase hydrolyzes starch, so the activity of the promoter PgsiB mutant can be determined by the size of the clear zone around the single clone WB600 / pBE-PgsiB*-SPapre-amyE on a starch plate (LB solids + 10% starch). Single clones with larger clear zones on the experimental group starch plates than those in the control group were selected, such as... Figure 3 As shown. From approximately 1500 single clones, four mutant strains with larger clear zones than the control group were screened and numbered m1, m2, m3, and m4. Shake-flask fermentation was then performed for validation. First, the dominant mutant strains m1-m4, obtained from the initial screening on starch plates, were transferred to 50mL Erlenmeyer flasks containing 5mL LB for activation. Kanamycin was added to a final concentration of 60μg / mL, and the mixture was cultured at 37℃ and 200rpm for 11h. Next, 1mL of the bacterial culture was transferred to a 250mL Erlenmeyer flask containing 50mL TB and cultured at 37℃ and 200rpm for 36h. OD was then measured. 600The fermentation broth was centrifuged to obtain the fermentation supernatant, and the activity of amylase AmyE in the fermentation supernatant was detected. The enzyme activity of the control strain D0 (WB600 / pBE-PgsiB-SPapre-amyE) was defined as 100%, and the relative enzyme activity values ​​of the other mutants were used.

[0079] (3) Enzyme activity detection

[0080] a. Methods for detecting amylase activity

[0081] Substrate solution: Prepare a 1% soluble starch solution as the substrate for the α-amylase activity assay. Buffer solution: Use a 20 mmol / L phosphate buffer solution with a pH of 6.0 as the reaction buffer for the enzyme activity assay. Add 1 mL of the prepared substrate solution and 900 μL of phosphate buffer solution to a 15 mL stoppered test tube. Mix thoroughly and preheat in a 70°C water bath for 10 min to ensure the reaction system reaches stable temperature conditions.

[0082] Dilute the amylase solution to be tested appropriately with phosphate buffer. Take 100 μL of the diluted enzyme solution and quickly add it to a stoppered test tube containing the substrate and buffer solution. Immediately and gently vortex to mix, ensuring full contact between the enzyme solution and the substrate to initiate the enzymatic reaction. The reaction is carried out at a constant temperature of 70°C for 5 min. After the reaction is complete, immediately add 3 mL of DNS (3,5-dinitrosalicylic acid reagent) to the stoppered test tube and quickly vortex to mix. DNS reagent reacts with the reducing sugars generated in the reaction to produce a colorimetric reaction. Subsequently, place the stoppered test tube in a boiling water bath for 7 min to promote the complete colorimetric reaction. After heating, immediately transfer the test tube to ice water to cool, rapidly terminating the reaction. After cooling in an ice water bath for 3-5 min, add 10 mL of deionized water to the stoppered test tube and gently mix to reach the appropriate volume of reaction solution for subsequent detection. Use a spectrophotometer to measure the absorbance of the reaction solution at a wavelength of 540 nm.

[0083] b. Definition of enzyme activity unit

[0084] Under the specific experimental conditions described above, the amount of enzyme released per minute, equivalent to 1 μmol of glucose reducing sugar, is defined as 1 enzyme activity unit (U). By measuring the absorbance of the reaction solution at a wavelength of 540 nm and combining it with a standard curve, the amount of reducing sugar generated in the reaction can be calculated, thereby determining the enzyme activity of amylase.

[0085] (4) The experimental results are shown in Table 1.

[0086] Table 1. Shake-flask verification of α-amylase activity in different mutants

[0087] D0 m1 m2 m3 m4 <![CDATA[OD 600 ]]> 9.2 9.1 9.3 9.2 9.2 Relative enzyme activity (%) 100 153.4 177.2 168.9 114.6 <![CDATA[Relative enzyme activity / OD 600 > 10.9 16.9 19.1 18.4 12.5 <![CDATA[Relative enzyme activity / OD 600 Increase (%)]]> - 54.7 74.8 68.4 14.3

[0088] As shown in Table 1, the relative enzyme activities of mutant strains m1, m2, m3, and m4 were increased by 153.4%, 177.2%, 168.9%, and 114.6% respectively compared to the control group D0; in addition, the unit OD of these mutant strains... 600 The enzyme activities of the control group increased by 54.7%, 74.8%, 68.4%, and 14.3%, respectively.

[0089] Recombinant plasmids were extracted from strains m1-m3 and sent to Sangon Biotech for sequencing. The results are shown below. The nucleotide sequences corresponding to m1, m2, and m3 are SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively.

[0090] Example 4: Verification of the universality of the superior mutant promoter PgsiB and its application in γ-aminobutyric acid 1. Construction of the corresponding recombinant plasmids for the mutant promoters PgsiB, m1, m2 and m3

[0091] To verify the universality of the promoters corresponding to the above mutants m1, m2 and m3 and their application in the production of γ-aminobutyric acid, the GAD gene from Enterococcus faecalis (accession number: WP_033598563.1) was used to construct a recombinant plasmid by a one-step cloning method. The specific process is as follows: 2 μL of plasmid pET28(+)-Efgad template (90 ng / μL) [Catalysts 2024, 14(12), 905; Synthesis ofγ-Aminobutyric Acid from MonosodiumGlutamate Using an Engineered Glutamate DecarboxylaseActive at a Neutral pH],

[0092] 2 μL upstream primer gad-F:

[0093] TCGGATCCGAATTCAAGCTT ATG ACCAAGAAGAACGATCT(SEQ ID NO.11),

[0094] 2μL downstream primer gad-R:

[0095] TGTCTAGACTGCAGGTCGACTTAGATGATGGACTGGTTTG (SEQ ID NO.12),

[0096] DNA polymerase 2×Prime STAR Max, DNA 25μL, sterile water to a final volume of 50μL. The PCR reaction program is as follows: PCR amplification program: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 58℃ annealing for 5 sec, 72℃ extension for 2 min, 30 cycles, and a final extension at 72℃ for 5 min to obtain the Efgad gene fragment.

[0097] The linearized plasmid pBE-PgsiB-SPapre fragment was obtained by PCR. The specific PCR procedure is as follows: 2 μL of plasmid pBE-PgsiB-SPapre-amyE (95 ng / μL) was used as a template.

[0098] 2 μL upstream primer pBE-F1:

[0099] AGATCGTTCTTCTTGGTCATAAGCTTGAATTCGGATCCGA (SEQ ID NO. 13),

[0100] 2 μL downstream primer pBE-R1:

[0101] CAAACCAGTCCATCATCTAAGTCGACCTGCAGTCTAGACA (SEQ ID NO.14), DNA polymerase 2×Prime STAR Max, DNA 25 μL, and sterile water to a final volume of 50 μL. The PCR reaction program was as follows: PCR amplification program: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 55℃ annealing for 5 sec, 72℃ extension for 6 min, 30 cycles, and a final extension at 72℃ for 5 min. 3 μL of the linearized plasmid pBE-PgsiB-SPapre was used for nucleic acid verification. The target band was 6053 bp in size. Verification was performed by agarose gel electrophoresis, and the linearized fragment pBE-PgsiB-SPapre was recovered using an Omega agarose gel extraction kit.

[0102] The linearized fragments Efgad and pBE-PgsiB-SPapre obtained above were recombined to construct plasmids. The specific process is as follows: 2 μL of the linearized promoter fragment Efgad, 2 μL of the linearized plasmid fragment pBE-PgsiB-SPapre, 5 μL of Novizan ClonExpress II Mix, and 1 μL of ddHO were added. The reaction conditions were: incubation at 37°C for 30 min (Exnase II enzyme catalyzed homologous recombination); transformation of competent cells (e.g., DH5α) was performed, and 5 μL of the recombinant product was added to 50 μL of ice-cold competent cells, and the cells were incubated on ice for 30 min. Heat shock was performed at 42°C for 90 s, followed by immediate ice incubation for 2 min. 900 μL of SOC medium was added, and the cells were cultured at 37°C with shaking for 1 h; plating was performed to screen the bacterial culture by spreading the culture onto LB agar plates containing the corresponding antibiotics and incubating overnight at 37°C with the plates inverted. Single-clonal strains were selected and cultured in LB medium. Plasmids were then extracted, identified, and sequenced to obtain the recombinant plasmid pBE-PgsiB-SPapre-Efgad. The remaining mutant promoters PgsiB were further identified using the corresponding recombinant plasmids pBE-M1PgsiB-SPapre-Efgad, pBE-M2PgsiB-SPapre-Efgad, and pBE-M3PgsiB-SPapre-Efgad for strains m1, m2, and m3, respectively. M1PgsiB, M2PgsiB, and M3PgsiB represent the PgsiB mutant promoter sequences corresponding to strains m1, m2, and m3, respectively. These plasmids were then transformed into Bacillus subtilis WB600.

[0103] Bacillus subtilis WB600 is a commercially available strain. This strain is a Bacillus subtilis strain that has precisely knocked out six protease genes (aprE, nprE, epr, mpr, bpr, vpr) from the genome of Bacillus subtilis 168, which significantly reduces the activity of extracellular proteases. For details, please refer to the literature Engineering a Bacillus subtilis Expression-Secretion System with a Strain Deficient in Six Extracellular Proteases.

[0104] The recombinant strains were experimental groups 1, 2, and 3, respectively; the plasmid pBE-PgsiB-SPapre-Efgad was transformed into Bacillus subtilis WB600, which served as the control group strain D1.

[0105] 2. Measuring enzyme activity

[0106] Enzyme activity is defined as the amount of enzyme required per minute to convert a substrate into 1 μmol of γ-aminobutyric acid (GABA), which is defined as one unit of enzyme activity (U).

[0107] The specific process is as follows:

[0108] Preparation of substrate solution for recombinant glutamate decarboxylase (GAD) activity assay: Dissolve 0.1 mol / L sodium glutamate monohydrate and 0.15 mmol / L pyridoxal phosphate (PLP) in 50 mmol / L disodium hydrogen phosphate-citrate buffer (pH 4.5) to prepare the substrate solution. Store the substrate solution at 4°C protected from light to prevent component decomposition or other chemical reactions that could affect subsequent experiments. Reaction system: Take a 1.5 mL EP tube and add 360 μL of the prepared substrate solution. Preheat the EP tube in a 37°C water bath for 10 min to ensure the substrate solution reaches a suitable reaction temperature and the subsequent reaction proceeds stably. After preheating, add 40 μL of crude GAD enzyme solution to the EP tube, then quickly return the EP tube to the 37°C water bath to begin the reaction, which lasts for 4 min. After the reaction was completed, 600 μL of 0.2 mol / L borate buffer (pH 10) was immediately added to the EP tube to terminate the reaction. To ensure complete enzyme inactivation, the EP tube was boiled in boiling water for 10 min. The amount of GABA generated was determined using HPLC-OPA amino acid pre-column derivatization. Specific operational details of this method can be found in the reference [Liu Tiebing, Gong Jinyan, Zhu Yinbang, et al. Study on the detection method of γ-aminobutyric acid in agricultural products by pre-column derivatization].

[0109] The recombinant plasmids corresponding to the above mutant promoters PgsiB, m1, m2 and m3 were verified by shake-flask fermentation and enzyme activity measurement. The results are shown in Table 2.

[0110] Table 2: Effect of the PgsiB promoter mutant on the activity of GAD enzyme recombinantly expressed in the strain

[0111] control group Experimental group 1 Experimental group 2 Experimental group 3 <![CDATA[OD 600 ]]> 9.2 9.1 9.2 9.0 Relative enzyme activity (%) 100 154.3 146.8 159.3 <![CDATA[Relative enzyme activity / OD 600 > 10.9 17.0 16.0 17.7 <![CDATA[Relative enzyme activity / OD 600 Increase (%)]]> - 55.6 46.4 62.4

[0112] Table 2 shows that the relative enzyme activity / OD ratios in experimental groups 1-3 are... 600 Compared with the control group, the results were increased by 55.6%, 46.4%, and 62.4%, respectively, indicating that the promoter PgsiB mutant is beneficial to the recombination expression of the Efgad enzyme gene. It also shows that the promoter PgsiB mutant has a certain degree of universality and can be used for the efficient production of γ-aminobutyric acid.

[0113] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

[0114] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0115] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0116] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A PgsiB mutant of the self-inducible promoter derived from Bacillus subtilis, characterized in that: The mutant was obtained by irrationally and directionally modifying the nucleotide sequence of the wild-type PgsiB promoter shown in SEQ ID NO:1, and the mutant was selected from one of the following: PgsiB mutant 1: Nucleotide sequence as shown in SEQ ID NO: 2; PgsiB mutant 2: Nucleotide sequence as shown in SEQ ID NO: 3; PgsiB mutant 3: The nucleotide sequence is shown in SEQ ID NO:

4.

2. The promoter mutant according to claim 1, characterized in that, In the PgsiB mutant 1, the following mutations occur compared to the wild-type PgsiB promoter shown in SEQ ID NO:1: G121T / C164A / T246A / T249A; In the PgsiB mutant 2, the following mutation occurs compared to the wild-type PgsiB promoter shown in SEQ ID NO:1: T64C / G106T / G266A; In the PgsiB mutant 3, the following mutations occur compared to the wild-type PgsiB promoter shown in SEQ ID NO:1: G110A / C112T / C179A / A269C.

3. A recombinant vector comprising the promoter mutant of claim 1 or 2, and a target gene operatively linked thereto.

4. The recombinant vector according to claim 3, characterized in that, The target gene is either the α-amylase gene (amyE) or the glutamate decarboxylase gene (gad).

5. A recombinant Bacillus subtilis host cell, characterized in that, It includes the recombinant vector as described in claim 3 or 4.

6. The application of the promoter mutant of any one of claims 1-2, the recombinant vector of claims 3-4, or the host cell of claim 5, characterized in that, The application includes at least one of the following: a. Enhance gene transcription levels; b. Preparation of recombinant proteins; c. Producing the target compound, wherein the target compound is γ-aminobutyric acid; d. Increase the activity of expressed protease.

Citation Information

Patent Citations

  • Bacillus subtilis for expressing ademetionine synthase and application of bacillus subtilis

    CN112266923A

  • Alkaline protease gene, hybrid promoter, recombinant expression vector, recombinant expression engineering bacterium, alkaline protease, method and application

    CN113699138A