Cotton gene for improving aphid resistance and application

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a cotton gene for improving aphid resistance and application. The aphid-resistant cotton gene is CYP82A3.12, and the nucleotide sequence of the aphid-resistant cotton gene is as shown in SEQ ID NO. 1. By constructing CYP82A3.12 gene overexpression cotton and CYP82A3.12 gene silencing cotton, it is proved that CYP82A3.12 gene overexpression can improve the aphid resistance of cotton, CYP82A3.12 gene silencing can reduce the aphid resistance of cotton, data support is provided for further research of application of the CYP82A3.12 gene in aphid resistance of cotton, and a new thought is provided for cultivation of aphid-resistant cotton.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a cotton gene for improving aphid resistance and its application. Background Art

[0002] As a major pest in cotton-producing areas, cotton aphids seriously damage the quality and yield of cotton, thereby reducing farmers' planting income. They use their piercing-sucking mouthparts to absorb nutrients from the growing points and tender leaves of cotton, causing yellowish spots or curling of the leaves in the affected areas, affecting photosynthesis, and in severe cases even causing leaf deformation, drying up, or falling off. In addition, the honeydew secreted by cotton aphids can also induce sooty mold and act as a vector to spread plant viruses. Aphids and plants have formed a delicate and complex interactive relationship through a long process of co-evolution. Aphids have developed a variety of feeding strategies to obtain food, and accordingly, parasitic plants have developed a variety of effective defense response mechanisms to resist the damage caused by aphids.

[0003] Traditional cotton breeding for insect resistance relies primarily on morphological and biochemical traits. After entering the 20th century, breakthroughs in transgenic technology opened up new avenues for insect-resistant cotton breeding. In the 1970s, my country launched a national research program for insect-resistant cotton breeding, resulting in the development of a number of varieties with morphological or biochemical resistance. In recent years, with the rapid advancement of biotechnology, particularly the latest advances in RNA interference technology, genome-wide association analysis, QTL mapping, and expression analysis, significant progress has been made in the discovery of insect-resistant genes in cotton. The widespread use of transgenic insect-resistant cotton has greatly improved cotton's insect resistance and achieved important breakthroughs in increasing yield, optimizing fiber quality, and enhancing environmental adaptability. However, current cotton breeding for pest and disease resistance still faces the severe challenge of a shortage of resistance gene resources, and there is an urgent need to further explore and discover more new pest and disease resistance genes.

[0004] Cytochrome P450 (CYP) is a well-known family of enzymes involved in NADPH- and O2-dependent hydroxylation processes in biological metabolism. CYPs are crucial for the detoxification of xenobiotics in plants. CYPs also act as flexible catalysts, crucial for the production of secondary metabolites, antioxidants, and phytohormones in higher plants. The active involvement of CYPs in multiple biosynthetic and detoxification pathways makes them promising candidates for the development of crop varieties resistant to biotic and abiotic stresses. Summary of the Invention

[0005] The first object of the present invention is to provide a cotton gene that improves aphid resistance.

[0006] One of the purposes of the present invention is achieved by the following technical solution:

[0007] A cotton gene for improving aphid resistance is disclosed. The aphid resistance cotton gene is CYP82A3.12, and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] The second object of the present invention is to provide a cotton gene for improving aphid resistance and use thereof in improving aphid resistance of cotton.

[0009] The second object of the present invention is achieved by adopting the following technical solution:

[0010] The application of the above-mentioned cotton gene for improving aphid resistance in improving cotton aphid resistance.

[0011] Specifically, the application of cotton aphid-resistant genes in enhancing cotton aphid resistance.

[0012] Furthermore, plants with aphid resistance were obtained by overexpressing the CYP82A3.12 gene.

[0013] Furthermore, the overexpression of the CYP82A3.12 gene refers to constructing the cotton gene CYP82A3.12 into an overexpression vector to achieve overexpression.

[0014] Furthermore, the steps for constructing the aphid-resistant plant are as follows:

[0015] (1) Connect the CYP82A3.12 gene to the overexpression vector to construct a recombinant plasmid;

[0016] (2) transforming the recombinant plasmid constructed in step (1) into Agrobacterium, inoculating and culturing, and obtaining an Agrobacterium suspension;

[0017] (3) Injecting the Agrobacterium suspension into the cotyledons of the plants to obtain plants with aphid resistance.

[0018] Furthermore, the overexpression vector is the overexpression vector pCAMBIA2300.

[0019] Furthermore, the Agrobacterium is Agrobacterium GV3101.

[0020] Furthermore, the plant is cotton.

[0021] The beneficial technical effects of the present invention are:

[0022] By constructing cotton plants that overexpress the CYP82A3.12 gene and cotton plants that silence the CYP82A3.12 gene, the present invention demonstrates that CYP82A3.12 is a key gene in cotton resistance against aphids, and that changes in its expression level can significantly affect cotton's aphid resistance. Overexpression of the CYP82A3.12 gene can improve cotton aphid resistance, while silencing the CYP82A3.12 gene reduces cotton aphid resistance. This provides data support for further research on the application of the CYP82A3.12 gene in cotton resistance and offers new ideas for the cultivation of aphid-resistant cotton, possessing significant theoretical value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a phenotypic observation diagram of cotton plants under selection and non-selection conditions for the detection of cotton aphid resistance;

[0024] Figure 2 Phenotypic observations of leaves and stems of Zhongmian 113 (Wt), control plants (TRV:00), and CYP82A3.12-silenced cotton plants (TRV:CYP82A3.12) under normal conditions and after inoculation with cotton aphids;

[0025] Figure 3 Statistical graph of the number of cotton aphids on leaves of Zhongmian 113 (Wt), control plants (TRV:00) and CYP82A3.12 silenced cotton plants (TRV:CYP82A3.12) after inoculation with cotton aphids;

[0026] Figure 4 Statistical graph of the number of cotton aphids on leaves of Zhongmian 113 (Wt), control plants (pCAMBIA2300), CYP82A3.12 overexpressing cotton plants (pCAMBIA2300-CYP82A3.12), and CYP82A3.12 silenced cotton plants (TRV:CYP82A3.12) after inoculation with cotton aphids;

[0027] Figure 5 Statistical graph of cotton aphid feeding characteristics on leaves of cotton plants Zhongmian 113 (Wt), CYP82A3.12 overexpression (pCAMBIA2300-CYP82A3.12) and CYP82A3.12 silenced (TRV:CYP82A3.12). DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be further described below in conjunction with specific embodiments. However, it should be understood by those skilled in the art that the following examples are only intended to illustrate the present invention and should not be construed as limiting the present invention. Specific conditions not specified in the examples are to be followed according to conventional conditions or the conditions recommended by the manufacturer. All reagents or instruments used, unless otherwise specified, are conventional products obtained from commercial channels.

[0029] The nucleotide sequence of the cotton CYP82A3.12 gene in the examples was obtained from NCBI. The full gene sequence used to construct the gene overexpression vector plasmid is shown in SEQ ID NO.1, and the specific fragment sequence used to construct the gene silencing vector plasmid is shown in SEQ ID NO.2.

[0030] SEQ ID NO.1:

[0031] 。

[0032] SEQ ID NO.2:

[0033] ATGGCTCGGGTAAGGTTGTTGGTTGAGATGAAAAAACACTTTTCGGACTTGACTTTGAACGTTATTATGAGGACCGGTGGCTGGTAAGAGGTACAGTGTTGTTGCAGAGGAAGACCAGAAAGAGGTGTTGAGGTATCGAAAGGCTTTACGGGATTTC TTTCACTTGACAGGGATGTTTGTGTTGGGAGATGCAGTCCCTTTCCTTCGATGGTTGGATATTGGTGGTTATGAGAAGCGGATGAAGATAACTGCTAAAGAGTTGGATGAAATTCCGGGGGATGGCTAGATGACCATAGGAAGGGTGGACGCTG.

[0034] The cotton aphids used in the examples of the present invention were obtained from the insect breeding farm of Henan University.

[0035] The planting conditions of the genetically modified materials in the embodiment of the present invention are as follows:

[0036] Transgenic materials (gene overexpression and gene silenced cotton) were planted in an artificial climate chamber at the Sanya Research Institute of Henan University with a temperature of 20 ± 5 °C, a relative humidity of 70 ± 5%, a light / dark cycle of 16 / 8 h, and a light intensity of 60 μmol·m -2 ·s -1 .

[0037] Example 1

[0038] Obtaining genetically modified cotton:

[0039] (1) Using DNA recombination technology, the full-length fragment of CYP82A3.12 (SEQ ID NO.1) was inserted into the expression vector pCAMBIA2300 to form the recombinant plasmid pCAMBIA2300-CYP82A3.12, and the specific fragment of CYP82A3.12 (SEQ ID NO.2) was inserted into the virus-induced gene silencing vector pTRV2 to form the recombinant plasmid pTRV2-CYP82A3.12. The constructed recombinant plasmids pCAMBIA2300-CYP82A3.12, pTRV2-CYP82A3.12, TRV:00, and pCAMBIA2300 were respectively introduced into Agrobacterium GV3101 by electroporation, and the correct Agrobacterium transformed strain was identified. Among them, TRV is a commonly used virus-induced gene silencing (VIGS) vector system. TRV:00 usually refers to an empty vector in the TRV vector that does not carry any target gene fragments; pCAMBIA2300 is a commonly used plant expression vector. Both are used as control vectors in gene transformation experiments to ensure the reliability and repeatability of the gene transformation process.

[0040] (2) Using a sterile syringe, the Agrobacterium tumefaciens GV3101 strain containing the recombinant plasmids pCAMBIA2300-CYP82A3.12, pTRV2-CYP82A3.12, TRV:00, and pCAMBIA2300 in step (1) was inoculated into LB medium (10 g / L Triptone, 30 g / L sucrose, 5 g / L Yest Extract, 10 g / L NaCl), cultured overnight in a shaking incubator at 28°C until OD600 reached 1.0, and the suspensions were collected by centrifugation. Gossypium hirsutum L. was used as the experimental material. Cotton seeds were soaked in sterile water for 24 hours to allow the seeds to germinate and then directly planted in 8 cm diameter plastic pots containing nutrient soil and vermiculite in a ratio of 1:1. The temperature was 25°C, the relative humidity was 70%, the light-dark cycle was 16 / 8 h, and the light intensity was 60 μmol·m -27 days after sowing, cotton seedlings were cultured under 40°C conditions. A pCAMBIA2300-CYP82A3.12 suspension was injected into the cotyledons of cotton plants 113 seven days after sowing via a sterile syringe, resulting in cotton seedlings overexpressing the CYP82A3.12 gene. pTRV1, a helper viral vector, co-initiated silencing with pTRV2. A mixture of pTRV2-CYP82A3.12 and pTRV1 was injected into the cotyledons of cotton plants 113 seven days after sowing via a sterile syringe, resulting in CYP82A3.12-silenced cotton seedlings. Control plants were obtained by injecting a suspension of TRV:00 and pCAMBIA2300 into the cotyledons of cotton plants 113 seven days after sowing via a sterile syringe. Total RNA was extracted from the cotyledons of the injected sites 24, 48, and 72 hours after injection with the Agrobacterium suspension. Use the reverse transcription kit to reverse transcribe RNA into cDNA as a template for qPCR to ensure that the conversion is complete before proceeding to the next step of the experiment. @ One-Step gDNA Removal and cDNA Synthesis SuperMix was purchased from Beijing Quanshijin Biotechnology Co., Ltd. The configuration of the reverse transcription reaction system is shown in Table 1, and the reverse transcription reaction conditions are shown in Table 2.

[0041] Table 1 Reverse transcription reaction system

[0042]

[0043]

[0044] Table 2 Reverse transcription reaction conditions

[0045]

[0046] Example 2

[0047] Cultivation of cotton aphids:

[0048] To investigate the effects of wild-type cotton 113 (Wt), control (TRV:00 and pCAMBIA2300) cotton plants, CYP82A3.12 gene overexpressing cotton plants (pCAMBIA2300-CYP82A3.12), and CYP82A3.12 gene silenced cotton plants (pTRV2-CYP82A3.12) on cotton's ability to resist cotton aphids. Leaves from wild-type cotton 113 control (TRV:00 and pCAMBIA2300), CYP82A3.12 gene overexpressing cotton plants, and CYP82A3.12 gene silenced cotton plants, obtained 15 days after injection of the Agrobacterium suspension described in Example 1, were subjected to triple and double selection experiments and non-selection experiments. The cotton aphids in the selection experiments were simultaneously provided with the above cotton plant leaves and were free to choose the part to feed on or inhabit. The number of aphids distributed across treatments and their first-choice preferences were recorded over a period of time to assess whether the CYP82A3.12 gene affects the aphid's tropism. In a non-selective experiment, aphids are confined individually or in groups to plants in one treatment group, preventing them from moving to other plants. This can be achieved through physical isolation or time restrictions.

[0049] (1) When conducting triple and double choice tests, separate cotton leaves were arranged symmetrically on the inner edge of the culture dish and the petioles were wrapped with moist cotton to prevent the leaves from curling. Figure 1 As shown. 30 adult aphids of similar size were released in the center of the culture dish. The experimental design was completely randomized with 3 replicates, one replicate per culture dish. In the non-selective test, 10 adult aphids of similar size were placed on the cotton cotyledons in the cage to prevent them from escaping. Figure 1 shown.

[0050] (2) In the non-selection experiment, the phenotypic observations of leaves and stems of wild-type cotton 113 (Wild type), control plants (TRV:00) and CYP82A3.12-silenced cotton plants (TRV:CYP82A3.12, i.e., the above-mentioned pTRV2-CYP82A3.12) under normal conditions and after inoculation with cotton aphids were observed to preliminarily evaluate the level of aphid resistance of the plants. Among them, plants transformed with TRV:CLA1 were used as positive controls. CLA1 is GhCLA1, a key enzyme in chloroplast synthesis. The results are shown in Figure 2. Figure 2 shown.

[0051] (3) The number of cotton aphids on the cotyledons of wild-type cotton 113 (Wt), control plants (TRV:00), and CYP82A3.12-silenced cotton plants (TRV-CYP82A3.12, i.e., the above-mentioned pTRV2-CYP82A3.12) was recorded in the selection experiment (12 h, 24 h, 48 h, and 72 h) and the non-selection experiment (24 h, 48 h, 72 h, and 7 d). The results are shown in Figure 2. Figure 3 As shown. Among them, Figure 3 A represents the average number of aphids per plant in the Wt, TRV:00, and pTRV2-CYP82A3.12 plants in the no-selection test. Figure 3 B shows the average number of aphids per leaf in Wt, TRV:00, and pTRV2-CYP82A3.12 plants in the triple selection experiment. Figure 3 C represents the average number of aphids per leaf in the double-choice test of Wt and pTRV2-CYP82A3.12 plants.

[0052] (4) The number of cotton aphids on the cotyledons of wild-type cotton 113 (Wt), control plants (pCAMBIA2300), CYP82A3.12-overexpressing cotton plants (pCAMBIA2300-CYP82A3.12), and CYP82A3.12-silenced cotton plants (TRV-CYP82A3.12, i.e., the above-mentioned pTRV2-CYP82A3.12) were counted in the selection experiment (12 h, 24 h, 48 h, and 72 h) and the non-selection experiment (24 h, 48 h, 72 h, and 7 d). The results are shown in Figure 4. Figure 4 As shown. Among them, Figure 4 A represents the average number of aphids per plant in the Wt, pCAMBIA2300, and pCAMBIA2300-CYP82A3.12 plants in the no-selection test; Figure 4 B shows the average number of aphids per leaf in the Wt, pCAMBIA2300, and pCAMBIA2300-CYP82A3.12 plants in the triple selection experiment; Figure 4 C represents the average number of aphids per leaf in the double-selection test for Wt and pCAMBIA2300-CYP82A3.12 plants; Figure 4 D represents the average number of aphids per plant in the Wt, pCAMBIA2300-CYP82A3.12, and pTRV2-CYP82A3.12 plants in the no-selection test.

[0053] (5) The feeding behavior of cotton aphids on wild-type cotton 113 (Wt) and CYP82A3.12-overexpressing cotton plants (pCAMBIA2300-CYP82A3.12) and CYP82A3.12-silenced cotton plants (TRV-CYP82A3.12, i.e., the above-mentioned pTRV2-CYP82A3.12) in the selection and non-selection experiments was further statistically analyzed to analyze the differences in feeding behavior of cotton aphids under different cotton materials or treatment conditions and to evaluate the effects of plant resistance mechanisms on the feeding behavior of cotton aphids. The results are as follows: Figure 5 As shown. Among them, Figure 5 A represents the duration of the non-probing period; Figure 5 B represents the duration of C wave; Figure 5 C represents the duration of phloem salivation / feeding; Figure 5 D represents the duration of the probe; Figure 5 E represents the duration of the G wave; Figure 5 F represents the total time of probing non-phloem tissues; Figure 5 G represents the preparation time of cotton aphids before feeding on the phloem; Figure 5 H represents the actual feeding time of cotton aphids in the phloem; Figure 5 I represents the stability of continuous feeding of cotton aphids on the phloem. In the figure, n represents the number; s represents the sum; and a represents the average.

[0054] Depend on Figure 2 The results indicate that the expression level of the CYP82A3.12 gene in cotton significantly affects its resistance to the cotton aphid. Compared to the wild-type cotton variety Zhongmian 113 (Wt) and the control plant (TRV:00), silencing the CYP82A3.12 gene resulted in more severe leaf damage. This demonstrates that CYP82A3.12 is a key gene in cotton aphid resistance, and that changes in its expression level can significantly influence cotton's aphid resistance.

[0055] Depend on Figure 3 The results indicate that the expression level of the CYP82A3.12 gene in cotton significantly affects its resistance to cotton aphids. When the gene was silenced, cotton resistance to cotton aphids decreased, as evidenced by higher aphid numbers at multiple time points compared to the wild-type Zhongmian 113 (Wt) and control plants (TRV:00).

[0056] Depend on Figure 4 The results indicate that the expression level of the CYP82A3.12 gene in cotton significantly affects its resistance to cotton aphids. Overexpression of the CYP82A3.12 gene enhanced cotton aphid resistance, with aphid numbers lower than those in wild-type Zhongmian 113 (Wt) and control plants (pCAMBIA2300) at multiple time points.

[0057] Depend on Figure 5 It can be seen that the expression of the CYP82A3.12 gene in cotton can affect the feeding behavior of aphids. There are significant differences in the feeding behavior of cotton aphids on cotton plants with silencing and overexpressing this gene, suggesting that CYP82A3.12 may inhibit the feeding behavior of cotton aphids through some mechanism.

[0058] Taken together, these results demonstrate that CYP82A3.12 is a key gene in cotton resistance to the cotton aphid, and that changes in its expression level can significantly affect cotton aphid resistance. Overexpression of the CYP82A3.12 gene can enhance cotton aphid resistance, while silencing the CYP82A3.12 gene reduces it. This provides data support for further research on the application of the CYP82A3.12 gene in cotton aphid resistance and offers new insights into the development of aphid-resistant cotton. This approach holds significant theoretical value and promises for future applications.

[0059] The following is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it is not intended that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art of the present invention, without departing from the inventive concept, several simple deductions or replacements can also be made, all of which should be considered to belong to the scope of protection of the present invention. The specific conditions not indicated in the examples are carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, unless otherwise specified, are conventional products obtained through commercial channels.

Claims

1. A cotton gene for improving aphid resistance, characterized in that: The aphid-resistant cotton gene is CYP82A3.12, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of the cotton gene for improving aphid resistance according to claim 1 in improving aphid resistance in cotton.

3. The use according to claim 2, characterized in that Plants with aphid resistance were obtained by overexpressing the CYP82A3.12 gene.

4. The use according to claim 3, characterized in that The overexpression of the CYP82A3.12 gene refers to constructing the cotton gene CYP82A3.12 into an overexpression vector to achieve overexpression.

5. The use according to claim 3, characterized in that The steps for constructing the aphid-resistant plant are as follows: (1) Connect the CYP82A3.12 gene to the overexpression vector to construct a recombinant plasmid; (2) transforming the recombinant plasmid constructed in step (1) into Agrobacterium, inoculating and culturing, and obtaining an Agrobacterium suspension; (3) Injecting the Agrobacterium suspension into the cotyledons of the plants to obtain plants with aphid resistance.

6. The use according to claim 5, characterized in that The overexpression vector is the overexpression vector pCAMBIA2300.

7. The use according to claim 5, characterized in that The Agrobacterium is Agrobacterium GV3101.

8. The use according to claim 5, characterized in that The plant is cotton.

Images