Application of OsCPS2 gene in regulating plant resistance to salt stress

By constructing OsCPS2 gene knockout and overexpression vectors using CRISPR/Cas9 technology and regulating the expression level of the OsCPS2 gene, the problem of insufficient research on the salt stress mechanism of rice was solved, the salt tolerance and stress resistance of rice were improved, and new gene resources and strategies were provided for crop breeding.

CN120442668BActive Publication Date: 2025-11-21INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510587423.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2025-11-21
Estimated Expiration
2045-05-08

AI Technical Summary

Technical Problem

Current research on the salt stress mechanism in rice is limited, and there is a lack of effective genetic resources and molecular targets to improve crop resistance.

Method used

OsCPS2 gene knockout and overexpression vectors were constructed using CRISPR/Cas9 technology to regulate the expression level of the OsCPS2 gene in order to improve or reduce the salt stress resistance of rice. The nucleotide sequence of the OsCPS2 gene was used for gene editing and expression regulation.

Benefits of technology

It significantly enhances the salt tolerance of rice, improves the survival rate and recovery growth capacity under salt stress, regulates the accumulation of Na+ and K+ in plants, reduces the damage of salt stress to plants, and provides new molecular targets and genetic resources for crop stress resistance breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442668B_ABST
    Figure CN120442668B_ABST
Patent Text Reader

Abstract

The application discloses application of an OsCPS2 gene in regulating salt stress resistance of plants and belongs to the technical field of biotechnology. Expression of the OsCPS2 gene is increased, and salt stress resistance of the plant is improved; expression of the gene is reduced, and salt stress resistance of the plant is reduced. The application discloses a key role of the OsCPS2 gene in regulating salt stress resistance of plants, provides an important theoretical basis and technical means for improvement of crop stress resistance, deepens understanding of a mechanism of the OsCPS2 gene in response to salt stress of plants, provides a new molecular target and genetic resource for crop stress resistance breeding, and has important scientific value and practical significance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of OsCPS2 gene in regulating the ability of plants to resist salt stress. BACKGROUND

[0002] Salt stress is a major abiotic stress factor that restricts crop production, and affects plant growth and development through multiple pathways. At the physiological level, salt stress can disrupt the normal operation of photosynthesis and transpiration, and interfere with water and mineral nutrient transport. In terms of morphological development, it can lead to phenotypic defects such as reduced germination rate, reduced plant height, and reduced tillering. As a salt-sensitive crop, the analysis of rice salt tolerance mechanisms is of great significance in tapping the potential of crop resistance.

[0003] CPSs are the first key enzymes in the synthesis of diterpenoid active metabolites. In rice, three functional OsCPSs have been identified: OsCPS1, OsCPS2, and OsCPS4. Among them, OsCPS2 catalyzes the synthesis of ent-CPP from GGPP, and is involved in the synthesis of phytoalexins such as Phytocassanes, which have been verified to respond to various biotic and abiotic stresses such as rice blast, bacterial leaf blight, and drought. However, the current research on OsCPS2 in rice salt stress is relatively limited. Therefore, further study on the response mechanism of OsCPS2 gene in rice to salt stress can provide new gene resources and molecular targets for crop resistance genetic improvement. SUMMARY

[0004] The purpose of the present application is to provide the application of OsCPS2 gene in regulating the ability of plants to resist salt stress, in order to solve the problems existing in the prior art. The present application discloses the key role of OsCPS2 gene in regulating the ability of plants to resist salt stress, which provides an important theoretical basis and technical means for crop resistance improvement. It not only deepens the understanding of the mechanism of OsCPS2 gene response to plant salt stress, but also provides new molecular targets and genetic resources for crop resistance breeding, which has important scientific value and practical significance.

[0005] To achieve the above purpose, the present application provides the following scheme:

[0006] The present application provides the application of OsCPS2 gene and related biological materials in regulating the ability of plants to resist salt stress, increases the expression amount of the OsCPS2 gene, and improves the ability of the plants to resist salt stress; reduces the expression amount of the gene, and reduces the ability of the plants to resist salt stress; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO. 1.

[0007] Optionally, the relevant biological material includes a protein encoded by the OsCPS2 gene, a recombinant vector containing the OsCPS2 gene, or a recombinant microorganism.

[0008] Optionally, the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0009] Optionally, the plant includes rice.

[0010] The present invention also provides a method for improving the ability of plants to resist salt stress, comprising the step of introducing the OsCPS2 gene into the plant to achieve stable overexpression of the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1.

[0011] Optionally, the plant includes rice.

[0012] This invention also provides the application of the OsCPS2 gene and related biological materials in cultivating plants with high resistance to salt stress, wherein the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1.

[0013] Optionally, the plant includes rice.

[0014] The present invention also provides a method for cultivating plants with high resistance to salt stress, comprising the step of introducing the OsCPS2 gene into the plant to obtain a plant capable of stably overexpressing the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1.

[0015] Optionally, the plant includes rice.

[0016] The present invention discloses the following technical effects:

[0017] This invention reveals the crucial role of the OsCPS2 gene in regulating plant resistance to salt stress, providing important theoretical basis and technical means for improving crop stress resistance. Biological experiments demonstrate that increasing the expression level of the OsCPS2 gene significantly enhances the salt tolerance of rice, specifically manifested in improved survival rate, increased water content, and enhanced phenotypic recovery ability under salt stress conditions. Overexpressing lines showed approximately 20% higher survival rate after salt stress treatment compared to wild-type lines and exhibited better recovery growth ability. Simultaneously, this gene regulates Na+ in the plant... + and K + Accumulation of Na effectively reduces Na + / K + The ratio of salt stress to plant salt tolerance can be adjusted to mitigate its harmful effects. These findings provide new molecular targets and genetic resources for breeding salt-tolerant crop varieties.

[0018] The application of the present application is not only limited to rice, but also can be extended to other salt-sensitive crops, and has wide agricultural application prospects. Through the CRISPR / Cas9 technology and the overexpression vector construction, efficient editing and expression regulation of the OsCPS2 gene are realized, which provides reliable technical support for subsequent research and practical application. In addition, the development of related biological materials (such as coding proteins, recombinant vectors or microorganisms) further broadens the application range of the gene. In summary, the present application not only deepens the understanding of the response mechanism of the OsCPS2 gene to plant salt stress, but also provides new strategies and tools for crop stress resistance breeding, and has important scientific value and practical significance. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0020] Figure 1 Sequencing results of the OsCPS2 gene knockout strain at the edited target point;

[0021] Figure 2 Gene expression analysis of OsCPS2 at different time points in wild type under salt stress;

[0022] Figure 3 Phenotype diagram of wild type Kitaake, Oscps2-27 and Oscps2-60 mutant and OE-CPS2-4-4 and OE-CPS2-14-1 overexpression strain under normal conditions, after 14 days of salt stress treatment and after 7 days of recovery;

[0023] Figure 4 Survival rate (A) and water content (B) analysis of wild type Kitaake, Oscps2-27 and Oscps2-60 mutant and OE-CPS2-4-4 and OE-CPS2-14-1 overexpression strain;

[0024] Figure 5 Na + and K + content analysis of OsCPS2 related genetic materials under salt stress; wherein A, B and C are the Na + , K + content and Na + / K +D, E, F are wild type Kitaake, Oscps2-27 and Oscps2-60 mutant and OE-CPS2-4-4 and OE-CPS2-14-1 overexpression materials, respectively + K + content and Na + / K + . DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present application will now be described in detail, with reference to the figures. Such description, however, is to be considered in all respects only as illustrative, and not restrictive.

[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. Each smaller range that falls within the broader ranges is also specifically included. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also encompassed within the application, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of the limits are also included.

[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the patents, patent applications, publications, and descriptions are cited.

[0028] Many modifications and variations of this application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. For example, the specification can be used to design equivalent processes and equivalent structures to those described herein. The specification and examples provide enablement of the application and it is intended to cover any and all adaptations of the application. Therefore, it is intended that the specification and examples be considered as exemplary only, with the true scope and spirit of the application being indicated by the following claims.

[0029] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0030] The following examples are used to illustrate the present application but not to limit the scope of the present application. If not specifically indicated, the examples are all according to the conventional experimental conditions, such as Sambrook et al. Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 21), or the conditions suggested by the manufacturer's instructions. The main reagents used in the following examples are: various restriction enzymes, Taq DNA polymerase, T4 ligase, Pyrobest Taq enzyme, KOD, purchased from biological companies such as NEB, Toyobo; dNTPs purchased from Genestar Company; plasmid extraction kit and agarose gel recovery kit purchased from Shanghai Jeery Bioengineering Company; agar powder, agarose, ampicillin (Amp), kanamycin (Kan), gentamicin sulfate (Gen), rifampicin (Rif) and other antibiotics, and glucose, BSA, LB Medium, etc. purchased from Sigma, Bio-Rad and other companies; reagents for real-time quantitative PCR purchased from TaKaRa, and various other chemical reagents used in the examples are imported or domestic analytical pure reagents. The primers used in the examples were synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd. and related sequencing was performed.

[0031] The vectors used in the following examples are:

[0032] pENTR-gRNA and pBY02-Cas9 are disclosed in the non-patent literature "Large chromosomal deletions and heritable small genetic changes induced by CRISPR / Cas9 in rice", Huanbin Zhou et., Nucleic acids research, 2014, Vol. 42, No. 17 10903-10914.

[0033] pBY02 is disclosed in the non-patent literature "Gene targeting by the TAL effector PthXo2 reveals cryptic resistance gene for bacterial blight of rice", Junhui Zhou et., The Plant journal: for cell and molecular biology, The Plant Journal (2015) 82, 632-643.

[0034] Construction and genetic transformation of rice OsCPS2 gene knockout and overexpression vectors

[0035] 1. Construction of rice OsCPS2 gene knockout vector

[0036] The OsCPS2 gene knockout vector was constructed by CRISPR / Cas9 technology. Sequence analysis of the rice OsCPS2 gene showed that the gene contains 12 exons, and two target points were designed at the third exon, respectively, to obtain two types of OsCPS2 gene mutant rice, and the target point sequences are as follows:

[0037] Target point 1: GGGAATGGAAAACTTGGACTG, SEQ ID NO. 3;

[0038] Target point 2: GCTTACGCTCTCAGCGAAACA, SEQ ID NO. 4.

[0039] The nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO. 1:

[0040] SEQ ID NO. 1:

[0041]

[0042] The amino acid sequence of the protein encoded by the gene sequence is shown as SEQ ID NO. 2:

[0043] SEQ ID NO. 2:

[0044] MQMQVLTAASSLPRATLLRPAAAEPWRQSFLQLQARPIQRPGIMLHCKAQLQGQETRERRQLDDDEHARPPQGGDDDVAASTSELPYMIESIKSKLRAARNSLGETTVSAYDTAWIALVNRLDGGGERSPQFPEAIDWIARNQLPDGSWGDAGMFIVQDRLINTLGCVVALATWGVHEEQRARGLAYIQDNLWRLGEDDEEWMMVGFEITFPVLLEKAKNLGLDINYDDPALQDIYAKRQLKLAKIPREALHARPTTLLHSLEGMENLDWERLLQFKCPAGSLHSSPAASAYALSETGDKELLEYLETAINNFDGGAPCTYPVDNFDRLWSVDRLRRLGISRYFTSEIEEYLEYAYRHLSPDGMSYGGLCPVKDIDDTAMAFRLLRLHGYNVSSSVFNHFEKDGEYFCFAGQSSQSLTAMYNSYRASQIVFPGDDDGLEQLRAYCRAFLEERRATGNLMDKWVIANGLPSEVEYALDFPWKASLPRVETRVYLEQYGASEDAWIGKGLYRMTLVNNDLYLEAAKADFTNFQRLSRLEWLSLKRWYIRNNLQAHGVTEQSVLRAYFLAAANIFEPNRAAERLGWARTAILAEAIASHLRQYSANGAADGMTERLISGLASHDWDWRESKDSAARSLLYALDELIDLHAFGNASDSLREAWKQWLMSWTNESQGSTGGDTALLLVRTIEICSGRHGSAEQSLKNSADYARLEQIASSMCSKLATKILAQNGGSMDNVEGIDQEVDVEMKELIQRVYGSSSNDVSSVTRQTFLDVVKSFCYVAHCSPETIDGHISKVLFEDVN.

[0045] According to the above-mentioned target point, the corresponding sgRNA is designed and synthesized, and the application uses the intermediate vector pENTR-gRNA of two gRNAs, which contains two cloning sites (BtgZI and BsaI) after the rice U6 promoter. For the BtgZI cloning site, the sense strand contains a 5' 4-nt TGTT, and the antisense strand contains a 5' 4-nt AAAC. For the BsaI cloning site, the sense strand contains a 5' 4-nt GTGT, and the antisense strand contains a 5' 4-nt AAAC.

[0046] The primers for synthesizing sgRNA1 are as follows:

[0047] gOsCPS2-1-F: 5'-tgttGGGAATGGAAAACTTGGACT-3', SEQ ID NO. 5;

[0048] gOsCPS2-1-R: 5'-aaacAGTCCAAGTTTTCCATTCCC-3', SEQ ID NO. 6.

[0049] The primers for synthesizing sgRNA2 are as follows:

[0050] gOsCPS2-2-F: 5'-gtgtGCTTACGCTCTCAGCGAAAC-3', SEQ ID NO. 7;

[0051] gOsCPS2-2-R: 5'-aaacGTTTCGCTGAGAGCGTAAGC-3', SEQ ID NO. 8.

[0052] The two sgRNA sequences are synthesized by annealing at 95°C for 10 min and 55°C for 10 min, the first one is cloned into the BtgZI enzyme cutting site, and then the second one is inserted into the BsaI enzyme cutting site, and the structure is verified by sequencing. Then use LR cloning enzyme to subclone the two sgRNA fragments into the CRISPR vector pBY02-Cas9. Obtain the OsCPS2 gene knockout vector.

[0053] 2, Construction of rice OsCPS2 gene overexpression vector

[0054] The open reading frame of OsCPS2 is amplified from the cDNA of japonica rice Kitaake by PCR, and the amplification primer sequences are as follows:

[0055] Forward primer: ATCGATCTTGCATCTTGCGAGCACACG, SEQ ID NO. 9;

[0056] Reverse primer: TGTACCATCAAGTGAAACAAATATCGA, SEQ ID NO. 10.

[0057] The PCR fragment was cloned into the Kpnl and Xbal enzyme digestion sites of vector pBY02, so that its expression was controlled by the maize ubiquitin 1 gene promoter, to obtain an OsCPS2 gene overexpression vector.

[0058] The cloning primer sequences are as follows:

[0059] OsCPS2-F: CGGGGTACCATGCAGATGCAGGTGCTCACC, SEQ ID NO. 11;

[0060] OsCPS2-R: GCTCTAGACTAATTGACATCCTCGAACA, SEQ ID NO. 12.

[0061] 3. Genetic transformation of OsCPS2 gene knockout and overexpression vectors in rice

[0062] Agrobacterium-mediated genetic transformation method was used to transform immature embryo-derived callus cells of rice to create OsCPS2 gene knockout mutants and overexpression materials, and the specific steps are as follows:

[0063] (1) Using japonica Kitaake seeds as the material, after removing the external glume and disinfecting, placing in induction medium, 28°C light incubator culture, induction culture for 3-4 weeks, then picking up naturally divided embryonic callus, placing in subculture medium, continuing to culture for 7d, after subculturing three times, selecting naturally dispersed, bright yellow, about 2-3mm in diameter granular callus for Agrobacterium transformation.

[0064] (2) The constructed OsCPS2 gene knockout vector and overexpression vector were transformed into Agrobacterium competent EHA105 by electroporation method, to obtain Agrobacterium suspension.

[0065] (3) The callus obtained in step (1) was soaked in the Agrobacterium suspension of step (2), and after standing for 30-40min, it was dried on sterile filter paper and inoculated on co-culture medium, and cultured in the dark at 25°C for 3d.

[0066] (4) Collect the callus obtained in step (3) and wash it thoroughly with sterile water, and then wash it twice with sterile water containing 300 mg / L carbenicillin sodium. Finally, drain the callus on sterile filter paper; transfer the drained callus to a selection medium containing 300 mg / L carbenicillin sodium for the first round of selection, and cultivate it at 28°C under illumination for 14 days. Transfer the initial callus with resistant callus to a selection medium containing 300 mg / L carbenicillin sodium for the second round of selection until granular resistant callus grows.

[0067] (5) Transfer 3-7 calli obtained in step (4) to a differentiation tank containing a differentiation medium, and place it in a constant-temperature culture room at 25°C. When the shoots grow to the top of the differentiation tank cover, place it in a rooting medium to root and grow strong seedlings. After 7 days, open the sealing film, add an appropriate amount of sterile water to prevent bacterial growth, and harden the seedlings for about 3 days until the shoots stand upright. Then, wash away the agar, and cultivate the solution for 7-14 days before transplanting.

[0068] 4. Detection of gene knockout and overexpression strains

[0069] (1) Detection of OsCPS2 gene knockout strain

[0070] After the transformed rice plants are transplanted and bear fruit, use Invitrogen to extract genomic DNA (gDNA) from the leaves of T0 transgenic rice seedlings for genotyping. The amplification primer sequences are as follows:

[0071] Forward primer: ATATACTAACGAAATTGAAAAGGG, SEQ ID NO. 13;

[0072] Reverse primer: ACGGTTTTAAAGAGGAACAT, SEQ ID NO. 14.

[0073] The PCR amplification product is treated with ExoSAP IT (Affymetrix, Santa Clara, CA, USA) and then subjected to Sanger sequencing.

[0074] Harvest the seeds of the two homozygous gene knockout mutant rice obtained in the above steps to obtain the homozygous T1 generation mutants. In order to obtain Cas9-Free gene knockout homozygous plants, the same genotyping method is used for the homozygous T1 generation transgenic rice. Select the homozygous mutant line and perform PCR screening on the Cas9 gene using the following primers:

[0075] Forward primer: GGGTAATGAACTCGCTCTGC, SEQ ID NO. 15;

[0076] Reverse primer: TGGCGTCAAGAACTTCCTTTG, SEQ ID NO. 16.

[0077] The amplification products no longer contain the exogenous Cas9 gene and sgRNA expression elements, and finally two homozygous plants OsCPS2-27 and OsCPS2-60 retaining only the target gene knockout mutation are obtained. The sequencing results of the edited target points of the two OsCPS2 gene knockout lines are shown in Figure 1

[0078] (2) Detection of OsCPS2 gene overexpression lines

[0079] The rice plants to be transplanted after transformation bear fruit. The overexpression of the OsCPS2 gene is confirmed by semi-quantitative reverse transcription polymerase chain reaction. After three generations of screening, non-segregating homozygous CPS2-OE lines OE-CPS2-4-4 and OE-CPS2-14-1 are obtained. The semi-quantitative primer sequences for OsCPS2 gene overexpression detection are as follows:

[0080] Forward primer OsCPS2-RT-F: ACGAGGAGTGGATGATGGTC, SEQ ID NO. 17;

[0081] Reverse primer OsCPS2-RT-R: GCTATGGAGCAAGGTGGTC, SEQ ID NO. 18.

[0082] Example 2: Analysis of the expression pattern of OsCPS2 gene under salt stress

[0083] Wild-type japonica rice Kitaake seedlings grown to the two-leaf-one-heart stage were treated with 100 mM NaCl, and 0.1 g of aboveground and root tissues were taken at 0 h, 3 h, 6 h, 9 h, 12 h, 24 h, 36 h, and 48 h, respectively, and were quickly frozen in liquid nitrogen for OsCPS2 gene expression analysis. The total RNA of the above rice leaf and root tissues treated at different times was extracted using Trizol reagent (Invitrogen, USA); then 5x All-in-One RT Master Mix (ABM, Canada) was used to synthesize cDNA; TBGreen TM PreMix Ex Taq TM (TaKaRa, Japan) was used to perform quantitative reverse transcription polymerase chain reaction detection on a QuantStudio5 QuantStudio 5 Real-Time PCR System (ABI, USA), and the amplification primer sequences for OsCPS2 quantitative detection are as follows:

[0084] ​qOsCPS2-F: 5'-CGAGGACGACGAGGAGTG-3', SEQ ID NO. 19;

[0085] qOsCPS2-R: 5'-GGACTCAGGTGCCTGTAGGC-3', SEQ ID NO. 20.

[0086] The amplification primer sequences of OsActin are as follows:

[0087] OsActin-F: 5'-CTCAGCACATTCCAGCAGAT-3', SEQ ID NO. 21;

[0088] OsActin-R: 5'-ACAGATAGGCCGGTTGAAAA-3', SEQ ID NO. 22.

[0089] Each time point sample includes three biological replicates, and each sample has three technical replicates; the data are analyzed by the method of 2 -ΔΔCt The data analysis is performed by the method of 2

[0090] The results are shown in Table 1. Figure 2 The expression of OsCPS2 in the aboveground part and the underground part is affected by NaCl treatment, the expression of OsCPS2 in the underground part is induced and up-regulated from 0h to 48h under 100mM NaCl treatment, and the expression reaches the highest at 24h; while the expression in the aboveground part is continuously up-regulated in a small range within 0-48h under 100mM NaCl treatment. The above results show that the expression level of OsCPS2 responds to NaCl treatment, indicating that OsCPS2 gene is likely to be involved in the salt stress signal pathway.

[0091] Example 3 Salt stress phenotype analysis of OsCPS2 gene knockout mutant and overexpression strain

[0092] In order to further explore whether OsCPS2 regulates salt tolerance and the degree of regulation, salt stress experiments of OsCPS2 knockout mutants Oscps2-27 and Oscps2-60 and overexpression strains OE-CPS2-4-4 and OE-CPS2-14-1 at seedling stage were carried out.

[0093] 1. Rice material culture

[0094] Seeds of japonica rice variety Kitaake wild type, OsCPS2 gene overexpression lines (OE-CPS2-4-4 and OE-CPS2-14-1) and OsCPS2 gene knockout lines (Oscps2-27 and Oscps2-60) were selected for germination and rice seedling culture. The seeds of the desired rice material were sterilized by first soaking in 70% alcohol for 1 min, then transferring to 1.5% NaClO for sterilization for 30 min, and then washing several times with sterile water to wash away the sodium hypochlorite solution, and sowing on 1 / 2MS medium at 28°C for 7 days, light / 10h, temperature 28°C, relative humidity 65%. After the seedlings of the rice material grew to a height of more than 4 cm, they were transplanted to a rice culture box with holes, and the seedlings with uniform growth were selected and transplanted to the rice culture box with holes, and the transplanted rice was cultured in the International Rice Research Institute nutrient solution (pH = 5.8), wherein the nutrient solution was replaced every three days.

[0095] 2. Phenotype analysis

[0096] After the Kitaake wild type, OsCPS2 gene overexpression lines (OE-CPS2-4-4 and OE-CPS2-14-1) and OsCPS2 gene knockout lines (Oscps2-27 and Oscps2-60) rice seedlings in Example 2 were cultured to the two-leaf-one-heart stage, they were treated with water culture nutrient solution containing 100 mM NaCl for 14 d, and then the seedlings were recovered for 7 d using normal water culture nutrient solution, and then the salt stress phenotype was observed, photographed, and the survival rate and water content were counted.

[0097] The wild type, OsCPS2 gene overexpression lines and OsCPS2 gene knockout lines were observed for phenotypes under salt stress, focusing on whether the leaves showed wilting, yellowing, curling, and other differences in salinization phenotypes, and the survival rate of the seedlings was used to evaluate their tolerance to salt stress. The seedlings with new green leaves were used as the survival rate of the seedlings, and the ratio of the number of surviving plants to the number of treated plants was used as the survival rate of the seedlings.

[0098] Fresh weight measurement: The aboveground and root parts of wild type Kitaake, Oscps2-27 and Oscps2-60 mutants, and OE-CPS2-4-4 and OE-CPS2-14-1 overexpression lines were separated with a blade, and the aboveground parts were weighed after separation, and the data was recorded, wherein every six plants were used as a biological replicate, and each line included three biological replicates.

[0099] Dry weight measurement: The fresh weight of wild type Kitaake, Oscps2-27 and Oscps2-60 mutant and OE-CPS2-4-4 and OE-CPS2-14-1 overexpression lines were measured, and the aerial part materials were placed in an oven at 65°C to dry to constant weight, and then weighed, and the data were recorded, wherein every six plants were taken as one biological repeat, and each line included three biological repeats.

[0100] Survival rate analysis: After the rice seedlings were grown in the recovery nutrient solution for 7 days, the survival rate of each variety was calculated by counting the number of surviving plants based on the emergence of new leaves.

[0101] Survival rate (%) = number of surviving plants / total number of surviving plants before treatment x 100%

[0102] Moisture content analysis: The moisture content of each line was calculated by the statistical dry weight and fresh weight, and the moisture content (%) = (fresh weight - dry weight) / fresh weight x 100%.

[0103] The results are shown in Figure 3 and Figure 4 Under normal nutrient solution culture conditions, there was no significant difference in growth vigor between Oscps2-27 and Oscps2-60 mutants and OE-CPS2-4-4 and OE-CPS2-14-1 overexpression lines. After two-week-old seedlings of wild type (Kitaake), OsCPS2 gene knockout lines and OsCPS2 gene overexpression lines were treated with 100 mM NaCl for 14 days, the wild type Kitaake and the gene knockout mutants and overexpression lines all showed different degrees of wilting, but the mutants Oscps2-2 and Oscps2-11 showed more severe wilting than the wild type, while the overexpression materials were on the contrary. After the lines treated with salt for 14 days were transferred to normal nutrient solution for 7 days, it was found that most of the OsCPS2 gene knockout mutant lines were difficult to recover, while some overexpression lines could recover Figure 3 . Further statistical analysis of the survival rate showed that the survival rate of the wild type was 44.5%, the survival rates of the gene knockout mutant lines Oscps2-27 and Oscps2-60 were 33.3% and 30.1% respectively, which were significantly lower than that of the wild type, and the survival rates of the overexpression lines OE-CPS2-4-4 and OE-CPS2-14-1 were 61.9% and 59.5% respectively, which were higher than that of the wild type Figure 4 . Further statistical analysis of the moisture content showed that there was no significant difference in the moisture content of each line under normal conditions, and under the condition of 100 mM NaCl treatment, the moisture contents of Oscps2-27 and Oscps2-60 were 75.1% and 74.1% respectively, which were lower than that of the wild type (78.1%), and the moisture contents of OE-CPS2-4-4 and OE-CPS2-14-1 lines were 80.6% and 80.2% respectively, which were higher than that of the wild type Figure 4B). In summary, two overexpression lines showed better salt tolerance than wild type, and OsCPS2 loss-of-function mutant lines showed salt-sensitive phenotype compared with wild type, indicating that OsCPS2 might be involved in the process of salt stress response and positively regulate salt stress.

[0104] Example 4 Na + and K + Physiological index analysis

[0105] The Kitaake wild type, OsCPS2 gene overexpression lines (OE-CPS2-4-4 and OE-CPS2-14-1) and OsCPS2 gene knockout lines (Oscps2-27 and Oscps2-60) in Example 2 were cultured to the two-leaf-one-heart stage, and then treated with hydroponic nutrient solution containing 100 mM NaCl for 14 days, and then recovered for 7 days using normal hydroponic nutrient solution. The corresponding samples of the aboveground and underground parts were taken, dried to constant weight in a 65°C oven, ground into powder with a mortar, weighed 0.1 g into a 10 mL tube, added with 10 mL of 1% (V / V) HCl for dissolution, and soaked overnight in a 28°C shaking bed at 200 rpm. The sample was filtered with a 0.22 μm filter into a new 10 mL tube to prepare a mother liquor. The Na + and K + contents were determined by a microwave plasma atomic emission spectrometer 4100MP-AE. All data were the results of three independent repeated experiments, plotted by Graphpad Prism software, and analyzed by SPSS software for error analysis.

[0106] The Na and K ion contents of OsCPS2 related materials were determined under the condition of 100 mM NaCl treatment, and the results are shown in Figure 5 Under normal hydroponic culture conditions, the Na + contents of the aboveground and underground parts of the OsCPS2 loss-of-function mutant and overexpression plants had no obvious difference with the wild type lines, but under the condition of 100 mM NaCl treatment, the Na + contents of all lines were significantly increased, among which the Na + content of the mutant was significantly higher than that of the wild type, and the Na + content of the overexpression lines was significantly lower than that of the wild type Figure 5 (A-D);

[0107] Under the conditions of normal hydroponic culture and 100 mM NaCl treatment, the K + contents of the aboveground parts of the mutant and overexpression lines had no obvious difference with the wild type lines, while in the underground parts, the K + content of the mutant was significantly lower than that of the wild type after salt treatment, and the K+ The content was significantly higher than that of the wild type ( Figure 5 (BE);

[0108] Further analysis of Na + / K + The content of the ratio in each strain, under normal nutrient solution culture and 100mM NaCl treatment conditions, the Na content in the aboveground and underground parts of the mutant. + / K + The ratio was significantly higher than that of wild-type lines, with Na in the aboveground and underground parts of overexpressing lines increasing. + / K + The ratio was significantly lower compared to the wild-type strain. Figure 5 (CF). These results indicate that the function of OsCPS2 is related to Na+ in rice. + Increased content, K + This is related to a decrease in content.

[0109] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Use of OsCPS2 gene or biological material related to OsCPS2 gene in regulating the salt stress resistance of plants, characterized in that, The expression amount of the OsCPS2 gene is increased, and the ability of the plant to resist salt stress is improved; the expression amount of the OsCPS2 gene is reduced, and the ability of the plant to resist salt stress is reduced; the nucleotide sequence of the OsCPS2 gene is shown as SEQ ID NO. 1; The plant is rice. The related biological material is a protein encoded by the OsCPS2 gene, a recombinant vector or a recombinant microorganism containing the OsCPS2 gene, and the amino acid sequence of the protein is shown as SEQ ID NO.

2.

2. A method for improving the ability of a plant to resist salt stress, characterized in that, The method comprises the step of introducing the OsCPS2 gene into the plant to stably overexpress the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown as SEQ ID NO. 1; The plant is rice.

3. Use of the OsCPS2 gene or biological material related to the OsCPS2 gene in breeding plants with high resistance to salt stress, characterized in that, The nucleotide sequence of the OsCPS2 gene is shown as SEQ ID NO. 1; The plant is rice. The related biological material is a protein encoded by the OsCPS2 gene, a recombinant vector or a recombinant microorganism containing the OsCPS2 gene, and the amino acid sequence of the protein is shown as SEQ ID NO.

2.

4. A method for breeding a plant having high resistance to salt stress, characterized by, The method comprises the step of introducing the OsCPS2 gene into the plant to stably overexpress the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown as SEQ ID NO. 1; The plant is rice.

Citation Information

Patent Citations

  • OsJAB1 protein and application thereof in improving salt stress tolerance of rice

    CN117534743A

  • Application of dwarf mutation of rice plant height related gene XJHA in adjusting rice plant height

    CN118910152A