Application of resistance gene OsDES1 of rice bacterial streak

Abstract

The invention discloses application of a resistance gene OsDES1 of rice bacterial streak, and belongs to the field of plant genetic engineering. The invention discovers that the resistance of genetic transformation rice with OsDES1 gene mutation to the bacterial streak is obviously enhanced by utilizing gene editing, meanwhile, the plant height is increased without influencing the change of tiller number and grain length and grain width, and the OsDES1 gene can be used in rice breeding to improve the bacterial streak resistance of the rice.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology, and specifically relates to a resistance gene to rice bacterial leaf streak disease OsDES1 application. Background Art

[0002] Rice ( Oryza sativa L . Rice is a major staple food crop, and half of the world's population relies on it as their staple food. Its production impacts food security. Food security is a top national priority and has been a hot topic of public concern in recent years. According to a 2020 report by the Food and Agriculture Organization of the United Nations (FAO), nearly one-tenth of the world's population (approximately 750 million people) faced food insecurity in 2019. Ensuring food security is a crucial foundation for the sustainable development of the global economy and human society. As one of the most important staple crops, ensuring rice yield and quality is crucial to global food production patterns and security.

[0003] The pathogens of rice bacterial leaf streak (BLS) and bacterial leaf blight (BB) are both Gram-negative bacteria. Xanthomonas oryzae pv. Oryzae , Xoo ) pathogenicity is different, BLS is caused by Xanthomonas oryzae pv. oryzae ( Xanthomonas oryzae pv. oryzicola , Xoc BLS is a devastating rice disease that can spread rapidly and cause severe losses under favorable conditions. According to statistics, BLS can cause rice yield losses of 8% to 32%. Because the disease is primarily transmitted by seeds, my country and many other countries manage and control BLS as a plant quarantine disease. In the early stages of BLS infection, small, water-soaked lesions appear between leaf veins, causing the leaves to appear translucent and streaked with yellow. These lesions later expand into fine, dark green to yellowish-brown streaks. In later stages, the lesions die, and discontinuous red lesions develop from the leaf tips. This disease is commonly known as "red leaf disease" in rice production. Accurately characterizing resistance to BLS is a key step in identifying resistance genes and developing disease-resistant rice varieties. Although no rice varieties have been found to possess natural immunity, the identification and research of BLS-resistance genes has the potential to promote the development of new, highly resistant rice varieties, thereby mitigating the negative impact of BLS on rice yield and quality.

[0004] The trade-off between plant disease resistance and growth is an important strategy for evolutionary adaptation. For example, during germination or when seeking light under a shady tree canopy, plants grow rapidly due to crowding by neighboring plants. Under these conditions, rapid plant growth is often accompanied by increased susceptibility to pests, likely because growth takes precedence over defense. This inverse growth-defense relationship, often referred to as the "growth-defense trade-off," can be considered one of the most fundamental principles of "plant economics." Summary of the Invention

[0005] The present invention identifies a rice bacterial disease resistance-related gene OsDES1 , found that knockout rice OsDES1 The gene can enhance the resistance of rice to bacterial leaf streak disease, while causing an increase in plant height without affecting the obvious changes in rice tillering and grain length and width. The purpose of the present invention is to provide a gene for resistance to bacterial leaf streak disease in rice. OsDES1 application.

[0006] The purpose of the present invention is achieved through the following technical solutions: The present invention utilizes gene editing transgenic technology and strong promoter driven transgenic technology to OsDES1 The gene editing vector or overexpression vector was introduced into the rice variety Zhonghua 11 (ZH11) to knock out OsDES1 Gene function or overexpression OsDES1 ,get OsDES1 Gene editing or OsDES1 Rice with overexpressed gene. After inoculation with leaf streak fungus HGA4, OsDES1 The lesion length of gene-edited rice was significantly shorter than that of the control ZH11. OsDES1 The lesion length of the gene-overexpressing rice was significantly longer than that of the control ZH11. These results indicate that knocking out or reducing OsDES1 The expression of the gene can enhance the resistance of rice to leaf streak fungus, proving that OsDES1 Genes play an important role in rice resistance to bacterial diseases.

[0007] The present invention provides rice OsDES1 The application of genes in regulating rice resistance to bacterial leaf streak disease. The regulation includes: knocking out OsDES1 Gene or reduce OsDES1 Gene expression improves rice resistance to leaf streak disease; overexpression OsDES1 Genes reduce rice resistance to spot streak.

[0008] The present invention also provides rice OsDES1 The application of genes in regulating rice plant growth. The regulation includes: knocking out OsDES1 Gene or reduce OsDES1 Gene expression increases rice plant height; overexpressionOsDES1 Genes reduce rice plant height.

[0009] The present invention also provides a method for improving resistance to rice bacterial leaf streak disease or obtaining rice resistant to bacterial leaf streak disease, which comprises: knocking out the OsDES1 The function of the gene may reduce the OsDES1 The expression of the gene was knocked out to obtain rice resistant to leaf streak disease. OsDES1 The function of the gene may reduce the OsDES1 Methods for regulating gene expression include: mutating or knocking out the OsDES1 All or part of the gene sequence; or using interfering RNA interference OsDES1 gene expression; or use gene silencing systems to OsDES1 Gene silencing. The mutation methods include CRISPR / Cas9, TELLEN technology, T-DNA insertion, EMS mutagenesis, etc.

[0010] The present invention also provides a method for increasing rice plant height or obtaining high-plant-height rice, which comprises: knocking out the OsDES1 The function of the gene may reduce the OsDES1 Gene expression.

[0011] The present invention also provides rice OsDES1 The invention relates to an application of the gene in rice breeding, wherein the rice breeding includes: improving the resistance of rice to bacterial leaf streak disease and increasing the plant height of rice.

[0012] above OsDES1 The amino acid sequence of the OsDES1 protein encoded by the gene is shown in SEQ ID NO.3. OsDES1 The genomic sequence of the gene is shown in SEQ ID NO.1, OsDES1 The coding sequence (CDS) of the gene is shown in SEQ ID NO.2.

[0013] Beneficial effects of the present invention: The present invention discloses rice for the first time OsDES1 Application of genes in improving rice resistance to bacterial leaf streak disease, OsDES1 Negative regulation of rice resistance to bacterial leaf streak, knockout OsDES1 The invention can improve the disease resistance of rice to bacterial leaf streak disease and increase the plant height without affecting the number of tillers and the length and width of grains. The invention is helpful for improving rice varieties and can be used for breeding highly disease-resistant rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 yes OsDES1Analysis results of gene expression in various tissues of wild-type rice ZH11. OsDES1 The gene is expressed in the roots, stems, leaves, sheaths, and panicles of rice, with the highest expression level in the roots, followed by the leaf sheaths.

[0015] Figure 2 yes OsDES1 The expression analysis results of the gene after inoculation with leaf streak pathogen HGA4. The blue and red line segments in the figure represent the expression of ZH11 after inoculation with water and HGA4 respectively. OsDES1 The relative expression trend of genes. OsDES1 There was no significant change in gene expression; after inoculation with HGA4, OsDES1 The gene expression level increased significantly and reached a peak at 6 h, indicating that HGA4 can significantly induce the expression of this gene.

[0016] Figure 3 yes OsDES1 The phenotype and length statistics of lesions of gene-edited and overexpressed strains after inoculation with leaf streak pathogen HGA4. OsDES1 Gene-edited strains ( osdes1 ) gene editing situation; Figure BD is OsDES1 The positive identification results of different expression levels of gene overexpression lines (OsDES1-OE), among which ZH11 is the wild-type control Zhonghua 11. Figures EH are OsDES1 The phenotype and length statistics of lesions of gene-edited and overexpressed strains 14 days after inoculation with leaf streak pathogen HGA4. OsDES1 The lesion length of the gene-edited transformed material was significantly shorter than that of the wild-type Zhonghua 11 material, indicating that the gene editing knockout OsDES1 Gene improves rice resistance to leaf streak disease; overexpression OsDES1 The lesion length of the gene-transformed material after inoculation with leaf streak pathogen HGA4 was significantly longer than that of the wild-type material ZH11.

[0017] Figure 4 yes OsDES1 Plant height phenotypes and height and tiller number statistics of gene-edited and overexpression lines. OsDES1 Figure B is a statistical diagram of plant height of representative plants from different strains; Figure D is a statistical diagram of tiller number.

[0018] Figure 5 yes OsDES1 Grain length and width phenotypes and statistical graphs of gene-edited and overexpression lines. OsDES1 Grain length and width phenotypes of 20 seeds from different strains; Figure B is a statistical graph of grain length; Figure C is a statistical graph of grain width. DETAILED DESCRIPTION

[0019] The following examples are provided to further illustrate the present invention. Based on the above description and these examples, those skilled in the art will be able to ascertain the essential features of the present invention and, without departing from the spirit and scope of the present invention, may make various changes and modifications to the present invention to adapt it to various uses and conditions. Unless otherwise noted, the present invention utilizes prior art in the art.

[0020] Example 1: Isolation and cloning from rice varieties OsDES1 Gene RNA from the susceptible rice variety Zhonghua 11 was extracted using the Total RNA Kit from OMEGA, and reverse transcribed using the HiFiScript cDNA Synthesis Kit from Kangwei Century to obtain cDNA. Using this cDNA as a template, PCR was used to amplify the cDNA using primers (5′-CGGATCCTTGCTTTTGCTTGC-3′, SEQ ID NO. 4) and (5′-TGAATCTTTTTTCGGCGCCTTTCT-3′, SEQ ID NO. 5). OsDES1 The PCR reaction procedure was as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 45 s, 35 cycles, and post-extension at 72°C for 5 min. OsDES1 The CDS sequence of the gene is shown in SEQ NO.2. The gene encodes a protein consisting of 328 amino acids, and its amino acid sequence is shown in SEQ NO.3.

[0021] Example 2: OsDES1 Analysis of gene expression patterns in rice varieties The quantitative RT-PCR technique was used to analyze the OsDES1 Gene expression model. OsDES1 The results of gene expression analysis in various tissues of wild-type rice ZH11 are shown in Figure 1 .

[0022] For research OsDES1 The genes involved in the regulation of disease resistance were analyzed by quantitative RT-PCR. OsDES1Gene expression pattern after inoculation with X. streak bacteria HGA4. First, activate X. streak bacteria and streak them onto PSA medium (10 g / L polypeptone, 1 g / L sucrose, 1 g / L L-glutamic acid, pH = 7-7.2) and expand them in a 28°C incubator. When used, rinse the cells with sterile water and collect them in a sterile 50 mL centrifuge tube. Adjust the OD value using a spectrophotometer. 600 To 0.5. Select one-month-old rice leaves with relatively uniform growth, inoculate them with a 1 mL syringe (without a needle), and culture them at 28 ℃ during the day and 22 ℃ at night. Pay attention to maintaining a high humidity environment. Take the inoculated part of the leaf at 0 h, 3 h, 6 h, 12 h and 24 h after inoculation for RNA extraction and reverse transcription. Use Bio-Rad quantitative PCR instrument and SYBR Green fluorescent embedding dye to perform quantitative RT-PCR analysis at different time points after inoculation. OsDES1 Quantitative RT-PCR analysis of the expression of genes OsDES1 Gene-specific PCR primers were primer (5′-CGAGCTACAATCGCTGGCTA-3′, SEQ ID NO. 6) and primer (5′-GAACAGCGGTCTAAGGGCAT-3′, SEQ ID NO. 7). A rice actin RT-PCR product was used as a control for sample quantity consistency. The actin PCR primer sequences were (5′-GCCCAAGAAGAAGATCAAGAAC-3′, SEQ ID NO. 8) and (5′-AGATAACAACGGAAGCATAAAAGTC-3′, SEQ ID NO. 9).

[0023] OsDES1 The results of gene expression analysis after inoculation with leaf streak pathogen HGA4 are shown in Figure 2 After inoculation with leaf streak pathogen HGA4, ZH11 OsDES1 Gene expression is induced, indicating OsDES1 The gene can be induced to express by leaf streak pathogen.

[0024] Example 3: OsDES1 Verification of the disease resistance function of genes 1. Build OsDES1 Gene-edited and overexpressing rice lines: OsDES1Gene-edited rice was obtained using the CRISPR-Cas9 system (Xie K, Minkenberg B, Yang Y. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci US A. 2015 Mar 17;112(11):3570-5.doi: 10.1073 / pnas.1420294112. Epub 2015 Mar 2. PMID: 25733849; PMCID:PMC4371917.). OsDES1 Target 1 for gene-edited rice is GGACCCGCTCGCCTTTCTCAAG (SEQ ID NO. 10), and target 2 is CATTACTCCGAGATGCTAGT (SEQ ID NO. 11). Using the pGTR plasmid as a template, a fragment containing the target and the PTG vector was amplified by PCR. The fragments were ligated using Golden Gate cloning and then inserted into the pRGEB32 vector digested with the Bsa I restriction endonuclease using T4 ligase. Competent Escherichia coli DH5α cells were then transformed. After culture, several single colonies were randomly selected and placed in 30 μL of sterile water to prepare a bacterial suspension. 1 μL of the suspension was used as template. Positive clones were screened by PCR and sent to Wuhan Aoke Biotechnology Co., Ltd. for sequencing. The correctly sequenced vectors were then sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice genetic transformation.

[0025] Build OsDES1The overexpression vector used for gene overexpression in rice is GZ P1300 Ubi-3FlAG-3HA (the construction of GZP1300 Ubi-3FlAG-3HA is described in the literature: Xuan H, Li Y, Liu Y, Zhao J, Chen J, Shi N,Zhou Y, Pi L, Li S, Xu G, Yang H. The H1 / H5 domain contributes to OsTRBF2phase separation and gene repression during rice development. Plant Cell. 2024 Sep 3;36(9):3787-3808. doi: 10.1093 / plcell / koae199. PMID: 38976557;PMCID: PMC11483615.). This vector is driven by the Ubi promoter and the sequences encoding HA and Flag tags are fused to the pCAMBIA1300 vector backbone. It can be used as an Agrobacterium-mediated genetic transformation vector for overexpression. Using rice Zhonghua 11 cDNA as template, amplification OsDES1 Gene fragments were obtained to obtain the fragment of SEQ ID NO.2. Kpn I enzyme digestion vector GZ P1300Ubi-3FlAG-3HA, enzyme digestion is completed, the enzyme digestion product is purified. OsDES1 The gene fragments and vectors were seamlessly cloned, and then transformed into Escherichia coli DH5α competent cells. Finally, the constructed vectors were sent to Wuhan Boyuan Biological Company for genetic transformation of rice.

[0026] OsDES1 How is gene editing performed in gene-edited rice? Figure 3 As shown in A, osdes1#1 The strain has a 1-base deletion in the target region; osdes1#2 The strain had a 4-base deletion in the target region. OsDES1 Expression level detection of gene overexpression strains Figure 3 As shown in BD, 16 positive strains were identified at the DNA, RNA and protein levels. OsDES1 Overexpressed transgenic T0 generation lines.

[0027] 2. OsDES1 Functional verification of genes: The bacterial leaf streak fungus HGA4 was inoculated in the T1 generation rice about 4 weeks after planting. The results showed that the lesion length of wild type ZH11 was 3.181 ± 0.35 cm. osdes1 #1 and osdes1The lesion lengths of #2 were 2.711 ± 0.30 cm and 2.505 ± 0.31 cm, respectively, which were significantly shorter than those of ZH11, indicating that it was more resistant to disease ( Figure 3 E and G). In addition, T1 generation over-expression strains (OE-6, OE-8, OE-10, and OE-29) were inoculated. The results showed that the lesion length of the control group ZH11 was 1.532 ± 0.22 cm, while the lesion lengths of OE-6, OE-8, OE-10, and OE-29 were 1.728 ± 0.20 cm, 1.681 ± 0.16 cm, 1.809 ± 0.28 cm, and 1.722 ± 0.28 cm, respectively, all higher than ZH11, indicating that the strains were more susceptible to the disease ( Figure 3 F and H). The incidence of rice bacterial leaf streak is unstable and greatly affected by environmental factors. The incidence of wild-type ZH11 also varies greatly under different conditions and batches.

[0028] The above results show that OsDES1 Negative regulation of rice resistance to bacterial leaf streak.

[0029] Example 4: OsDES1 The role of genes in regulating rice plant height and tiller number Plant height and tillering statistics were collected for rice plants that had completed grain filling in the field. Plant height was measured from the root of the rice plant to the highest point of the main panicle. Each plant system was counted, excluding rice plants in the side rows, and at least six plants were measured in each plant system. Only the main tillers, i.e., tillers with relatively thick stems, were counted when counting tillers. Small tillers produced after maturity were not included in the total number. The results showed that OsDES1 Knockout strains osdes1#1 Higher than wild type; OsDES1 The overexpressing strains OE-6, OE-8, and OE-10 were shorter than the wild type ( Figure 4 AC). When counting the number of tillers, it was found that OsDES1 The knockout and overexpression lines were less than the wild-type ZH11, but there was no significant difference, indicating that OsDES1 There was no significant effect on tiller development ( Figure 4 D).

[0030] Example 5: OsDES1 The role of genes in regulating rice grain length and width After the seeds mature, they are dried naturally or in an oven. 100 full seeds of each material are selected and the length and width of the seeds are measured on a seed measuring machine. The results show that the wild type ZH11, osdes1#1 as well as OsDES1 There was no significant difference in grain length and width among the strains ( Figure 5 ),illustrate OsDES1It does not involve the regulation of rice grain length and width, i.e. OsDES1 It does not affect the number of tillers and grain length and width of rice.

[0031] The above results show that the OsDES1 After gene editing, rice can be given disease resistance to diseases caused by leaf streak pathogens, while at the same time causing an increase in plant height without affecting the changes in tiller number and grain length and width, which can improve rice's resistance to bacterial diseases.

Claims

1. Rice OsDES1 The invention relates to a method for regulating the resistance of rice to bacterial leaf streak disease and / or the growth of rice plants, wherein: The rice OsDES1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

2. The use according to claim 1, wherein: The rice OsDES1 The genomic sequence of the gene is shown in SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: Knockout or reduction OsDES1 Expression of the gene increases resistance to bacterial leaf streak disease in rice and / or increases rice plant height; Overexpression OsDES1 Genes that reduce resistance to bacterial leaf streak disease and / or plant height in rice.

4. A method for improving resistance to bacterial leaf streak disease in rice or obtaining rice resistant to bacterial leaf streak disease, characterized by: Knockout rice OsDES1 The function of the gene may reduce the OsDES1 Gene expression; the rice OsDES1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

5. A method for increasing rice plant height or obtaining tall rice, characterized by: Knockout rice OsDES1 The function of the gene may reduce the OsDES1 Gene expression; the rice OsDES1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

6. The method according to claim 4 or 5, characterized in that: The rice OsDES1 The genomic sequence of the gene is shown in SEQ ID NO.

1.

7. The method according to claim 4 or 5, characterized in that: Knockout rice OsDES1 The function of the gene may reduce the OsDES1 Methods for regulating gene expression include: mutating or knocking out the OsDES1 All or part of the gene sequence; or using interfering RNA interference OsDES1 gene expression; or use gene silencing systems to OsDES1 Gene silencing.

8. The method according to claim 7, wherein: The mutation methods include CRISPR / Cas9, TELLEN technology, T-DNA insertion, and EMS mutagenesis.

9. Rice OsDES1 The application of the gene in rice breeding is characterized by: The rice breeding includes: improving the resistance of rice to sheath blight and increasing the plant height of rice; OsDES1 The amino acid sequence of the OsDES1 protein encoded by the gene is shown in SEQ ID NO.

3.

10. The use according to claim 9, characterized in that: The rice OsDES1 The genomic sequence of the gene is shown in SEQ ID NO.1.

Images