Cotton drought-tolerance and low-temperature-tolerance related protein GhCOX11 and its application

By overexpressing or silencing the cotton COX11 protein GhCOX11 in tobacco, the technical gap in the regulation of tobacco drought tolerance and low temperature tolerance was solved, and the tobacco's resistance to drought and low temperature was significantly improved.

CN120442707BActive Publication Date: 2025-09-09SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510965020.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-14
Publication Date
2025-09-09
Estimated Expiration
2045-07-14

AI Technical Summary

Technical Problem

The existing technology lacks clear research and application of cotton COX11 protein in regulating tobacco drought tolerance and low temperature tolerance.

Method used

By providing cotton drought- and low-temperature-tolerance-related protein GhCOX11 and its encoding gene, transgenic technology is used to increase the content and activity of GhCOX11 protein in tobacco, and different tag proteins are combined for purification and detection, which is used to improve tobacco's drought- and low-temperature tolerance.

Benefits of technology

It significantly improved the drought tolerance and low temperature tolerance of tobacco, and enhanced the tobacco's resistance to drought and low temperature stress by regulating ROS levels and mitochondrial function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442707B_ABST
    Figure CN120442707B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of plant genetic engineering technology and specifically provides a cotton drought and low temperature tolerance-related protein GhCOX11 and its application. The protein meets the following conditions: B1) a protein with an amino acid sequence of SEQ ID NO. 1; B2) a fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of B1). GhCOX11 After the gene is cloned and an overexpression vector is constructed, it is transformed into tobacco to obtain overexpression plants, which have significantly improved drought resistance and low temperature resistance. GhCOX11 The identification of genes and the analysis of drought- and low-temperature-tolerant functions have enriched the genetic resources for tobacco drought- and low-temperature-tolerant breeding, and have important theoretical significance and application value for the breeding and screening of drought- and low-temperature-tolerant plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and relates to a cotton drought-resistance and low-temperature-resistance related protein GhCOX11 and an application thereof. Background Art

[0002] Drought and low-temperature stresses are currently daunting challenges facing global agricultural production, severely restricting the entire process of plant growth and development. Water deficit disrupts normal crop physiological metabolism through multiple pathways and multi-level mechanisms, triggering profound changes in plant morphology, structure, and physiological function. Research has shown that reactive oxygen species (ROS) signaling networks and mitochondrial regulatory mechanisms play a central role in plant responses to drought and low-temperature stress. Drought and low-temperature stress disrupt the dynamic balance between ROS production and clearance in plants, leading to oxidative stress and cellular damage. Notably, ROS also act as signaling molecules to activate stress-responsive gene expression networks. Mitochondria, as the core sites of energy metabolism and ROS production, play a dual role in drought response. Under drought conditions, mitochondria regulate cellular energy homeostasis by remodeling electron transport chain activity and ATP synthesis patterns. Changes in their redox state can also regulate nuclear gene expression through retrograde signaling.

[0003] Cytochrome c oxidase (COX / CcO) is a terminal oxidase in the mitochondrial respiratory chain. Members of the COX family possess a characteristic cytochrome c binding domain and oxidase catalytic domain. In plants, the COX gene family significantly enhances stress tolerance by maintaining energy homeostasis. Among them, COX11, a copper chaperone responsible for transporting Cu(I) to the CuB site of COX1, is crucial for maintaining respiratory chain function. Studies in Saccharomyces cerevisiae have shown that COX11 deficiency leads to respiratory defects. In addition to participating in complex IV assembly, COX11 also regulates redox homeostasis through its conserved cysteine ​​residues. Studies have shown that COX11 expression is induced by oxidative stress in Arabidopsis and rice, affecting ROS levels. Rice OsSPL10 regulates ROS accumulation and programmed cell death through the OsNAC2-OsAP37 / OsCOX11 module, suggesting that COX11 plays an important role in linking mitochondrial function and oxidative stress responses. However, COX11 has yet to be clearly identified and its function verified in cotton. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to utilize the above-mentioned COX11 and its encoding gene to regulate the drought resistance and low temperature resistance of tobacco.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] A first aspect of the present invention provides an application for increasing protein content and / or activity, wherein the application is any one of the following:

[0007] A1) Application in improving drought tolerance and / or low temperature tolerance of tobacco;

[0008] A2) Use in the preparation of products that improve tobacco drought tolerance and / or low temperature tolerance;

[0009] A3) Application in breeding drought-tolerant and / or low-temperature-tolerant tobacco;

[0010] A4) Use in the preparation of products for cultivating drought-tolerant and / or low-temperature-tolerant tobacco;

[0011] A5) Application in tobacco drought tolerance and / or low temperature tolerance breeding;

[0012] The protein is named GhCOX11 and meets the following conditions:

[0013] B1) a protein having an amino acid sequence of SEQ ID NO. 1;

[0014] B2) A fusion protein with the same function as B1) is obtained by connecting a tag to the N-terminus and / or C-terminus.

[0015] In the above application, the protein GhCOX11 can be derived from cotton.

[0016] Furthermore, the protein GhCOX11 may be cotton drought tolerance and / or low temperature tolerance-related protein GhCOX11.

[0017] In order to facilitate the purification or detection of the protein in B1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO. 1 in the sequence listing.

[0018] The tag protein includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0019] The second aspect of the present invention provides an application of a biomaterial related to the protein GhCOX11, wherein the application is any of the following:

[0020] D1) Application in improving drought tolerance and / or low temperature tolerance of tobacco;

[0021] D2) Use in the preparation of products that improve tobacco drought tolerance and / or low temperature tolerance;

[0022] D3) Application in breeding drought-tolerant and / or low-temperature-tolerant tobacco;

[0023] D4) Use in the preparation of products for cultivating drought-tolerant and / or low-temperature-tolerant tobacco;

[0024] D5) Application in tobacco drought tolerance and / or low temperature tolerance breeding;

[0025] The biological material is any one of the following E1) to E7):

[0026] E1) a nucleic acid molecule that promotes or increases the expression of the gene encoding the protein GhCOX11;

[0027] E2) an expression cassette containing the nucleic acid molecule described in E1);

[0028] E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2);

[0029] E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3);

[0030] E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3);

[0031] E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2);

[0032] E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

[0033] In the above application, the nucleotide sequence of the protein GhCOX11 encoding gene (CDS) is the nucleotide sequence shown in SEQ ID NO. 2.

[0034] The third aspect of the present invention provides a method for cultivating drought-resistant and / or low-temperature-resistant plants, which comprises increasing the content and / or activity of the protein GhCOX11 in the target plant to obtain a drought-resistant and / or low-temperature-resistant plant having higher drought-resistant and / or low-temperature resistance than the target plant, wherein the plant is tobacco.

[0035] In the above method, increasing the content and / or activity of the protein GhCOX11 in the target plant is achieved by increasing the expression level of the gene encoding the protein GhCOX11 in the target plant.

[0036] In the above method, increasing the expression level of the gene encoding the protein GhCOX11 in the target plant is to increase the expression level of the gene encoding the protein GhCOX11 in the genome of the target plant using transgenic technology.

[0037] In the above method, the use of transgenic technology to increase the expression level of the gene encoding the protein GhCOX11 in the genome of the target plant is achieved by introducing a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

[0038] Beneficial effects of the present invention:

[0039] The GhCOX11 protein and its encoding gene of the present invention can regulate drought and cold tolerance in tobacco. By increasing the content and / or activity of the GhCOX11 protein in the target plant, the drought and / or cold tolerance of the target plant can be significantly improved. Therefore, the cotton drought and cold tolerance-related protein GhCOX11 and its encoding gene have important theoretical and practical significance in regulating drought and cold tolerance in tobacco. The present invention is of great significance for the cultivation of transgenic tobacco with drought and cold tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 for GhCOX11 Expression pattern and VIGS-mediated GhCOX11 Silencing and drought stress treatment.

[0041] Figure 2 For tobacco GhCOX11 Drought resistance research.

[0042] Figure 3 For tobacco GhCOX11 Drought resistance research.

[0043] Figure 4 This study is about the cold resistance of GhCOX11 in tobacco. DETAILED DESCRIPTION

[0044] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0045] Example 1 GhCOX11 Functional identification of genes

[0046] 1. Materials and Methods

[0047] 1.1 Plant materials

[0048] The tobacco receptor variety NC89.

[0049] 1.2 Strains and plasmids

[0050] The vectors used in this experiment were pCBSG015 and pCAMBIA2301 (stored in our laboratory), the competent E. coli DH5α was purchased from Quanshijin (Beijing) Biological Company, and the Agrobacterium tumefaciens LBA4404 was stored in our laboratory.

[0051] 1.3 Main Reagents

[0052] The high-fidelity 2× Phanta Max Master Mix used in the experiment was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; KpnⅠ enzyme, SalⅠ enzyme, EcoRⅠ enzyme and T4 ligase were purchased from New England Biolabs, and pEASY-T1 simple cloning vector was purchased from Quanshijin (Beijing) Biotechnology Co., Ltd.

[0053] 1.4 Agrobacterium-mediated genetic transformation of tobacco

[0054] (1) Pick a single colony and inoculate it into YEB liquid medium containing the corresponding antibiotics. Culture it at 28°C and 200 rpm with shaking until OD600 is 0.6-0.8. Collect the bacteria by centrifugation at 4,000 rpm for 10 min, and resuspend them in MS liquid medium containing AS (without antibiotics) to OD600 ≈ 0.5 for later use.

[0055] (2) Take young leaves from sterile tobacco seedlings and cut leaf discs with a diameter of approximately 0.5–1 cm using a sterile punch (or blade). Immerse the leaf discs in the Agrobacterium suspension (prepared in step 1) for 10–15 minutes, gently shaking. Remove the leaf discs and absorb any excess bacterial suspension with sterile filter paper.

[0056] (3) Place the infected leaf disc on MS solid culture medium (containing AS, without antibiotics) covered with filter paper and culture in the dark at 25°C for 2 to 3 days.

[0057] (4) Transfer the co-cultivated leaf discs to MS differentiation medium containing a selective antibiotic (e.g., kanamycin) and a bacteriostatic antibiotic (e.g., cephalosporin, 500 mg / L). Incubate at 25°C with a 16 h / 8 h photoperiod, changing the medium every 2 weeks until resistant buds emerge (approximately 4–6 weeks).

[0058] (5) Cut resistant buds (≥2 cm) and transfer them to MS rooting medium containing selected antibiotics. Cultivate for 2-3 weeks until the root system is fully developed.

[0059] (6) Open the culture bottle cap and gradually adapt to the external environment (3-5 days). Wash the root agar, transplant to sterilized nutrient soil, maintain high humidity (cover with film) for 1 week, and then manage normally.

[0060] 1.5 Identification of overexpression and silenced strains

[0061] DNA was extracted from overexpression and silenced tobacco strains. Primers were designed for the overexpression vector (CaMV 35S promoter + target gene fragment) and for the silenced strain (to amplify the hairpin structure on the vector). PCR and electrophoresis were performed to confirm successful integration of the exogenous gene into the tobacco genome. Total RNA was extracted from the overexpression and silenced tobacco strains, and qRT-PCR primers were designed. Data were analyzed to detect target gene expression at the mRNA level.

[0062] 1.6 Plant stress treatment

[0063] Tobacco plants (wild-type, overexpressing, and silenced tobacco lines) were grown in nutrient soil in an artificial climate greenhouse. Culture conditions were set as follows: a 16-h light / 8-h dark photoperiod, a constant temperature of 28±2°C, and a relative humidity of 70%. Plants were used for experimental treatments after three weeks of growth. Drought stress was simulated using a 4% PEG6000 solution; low-temperature stress was simulated in a 4°C incubator with normal watering. The stress treatments included the wild-type, three COX11-overexpressing lines, and three COX11-silencing lines, with 12 seedlings per line. Phenotypic photographs and physiological parameters were taken after one month of treatment. The soil in the pots was removed, the roots were rinsed with clean water, and aboveground and belowground biomass were counted.

[0064] 1.7 Antioxidant enzyme activity assay

[0065] First, prepare the plant tissue to be tested into a tissue homogenate. Accurately weigh the plant tissue and add phosphate buffer (0.1 mol / L, pH = 7.0-7.4) at a ratio of weight (g) / volume (mL) = 1 / 9. Mechanically homogenize in an ice-water bath to prepare a 10% plant tissue homogenate. Centrifuge for 10 minutes (3500 rpm) and collect the supernatant for subsequent determination.

[0066] 1.8.1 SOD enzyme activity determination

[0067] The xanthine and xanthine oxidase reaction system produces superoxide anion free radicals (O 2-), which oxidizes hydroxylamine to form nitrite, which develops a purple-red color under the action of a color developer. Its absorbance is measured using a visible light spectrophotometer. When the sample being tested contains SOD, it specifically inhibits superoxide anion free radicals, reducing the formation of nitrite. During colorimetry, the absorbance of the test tube is lower than that of the control tube. The SOD activity in the sample being tested can be calculated using a formula.

[0068]

[0069] Vortex to mix thoroughly and incubate in a water bath for 40 min (37°C).

[0070] Add 2 mL of color developer to the test tube and control tube respectively, mix well, and place at room temperature for 10 minutes. At 550 nm, use distilled water to adjust the light path to zero in a 1 cm cuvette, and measure the OD value of each tube sample.

[0071] Calculate the sample protein concentration using the following formula.

[0072]

[0073] The total activity is the amount of SOD per milligram of tissue protein in 1 mL of reaction solution when the SOD inhibition rate reaches 50%, which is one SOD activity unit (U).

[0074] 1.8.2 CAT enzyme activity determination

[0075] The reaction of catalase decomposing H2O2 can be quickly terminated by adding ammonium molybdate. The remaining H2O2 reacts with ammonium molybdate to produce a light yellow complex. The change in the complex is measured at 405nm, and the activity of CAT can be calculated.

[0076] Preheat reagents 1 and 2 at 37°C

[0077]

[0078] Mix thoroughly, and measure the OD value of each tube of sample at 405 nm using a 0.5 cm optical path cuvette, adjusted to zero with distilled water.

[0079]

[0080] Note: * 271 is the reciprocal of the slope

[0081] 1.9 VIGS silencing experiment

[0082] 1.9.1 Construction and transformation of pTRV2-GhCOX11 plasmid and injection of cotton

[0083] right GhCOX11The CDS fragment was amplified, electrophoresed on agarose gel, and recovered. Amplification primers: VIGS-COX11-F: SEQ ID NO. 3: gtgagtaaggttaccgaattTCGAAGAATCTACGGATTTTGTCAC; VIGS-COX11-R: SEQ ID NO. 4: cgtgagctcggtaccggatGTTGGAACAAATTTCCAGGGC. A 50 µL PCR reaction system consisted of: 25 µL Superstar Mix; 1 µL template cDNA; 1 µL forward primer; 1 µL reverse primer; and 22 µL ddH2O, mixed thoroughly. PCR protocol: 94°C initial denaturation for 5 min; 94°C denaturation for 30 s; 54°C annealing for 30 s; 72°C extension for 40 s (35 cycles); 72°C extension for 10 min, then storage at 16°C.

[0084] The amplified fragment was ligated to a T-vector using the following reaction system: 4 µL of recovered fragment; 1 µL of T-vector. The reaction was performed at 25°C for 10 minutes. E. coli was then transformed and a single clone was selected for sequencing. For the VIGs experiment, the pTRV2 vector was used. The target fragment and pTRV2 vector were digested with EcoRI and BamHI, respectively. The digested fragment and vector were ligated using the following reaction system: 1 µL of 1XT4 DNA ligase reaction buffer; 1 µL of T4 DNA ligase; 2 µL of recovered fragment; and 1 µL of pTRV2 vector. The reaction was performed at 16°C for 10 minutes. The resulting recombinant plasmid, pTRV2:: GhCOX11 and empty plasmids (pTRV2, pTRV1) were transferred into Agrobacterium GV3101 using electroporation.

[0085] Positive single clones were identified by PCR using the following primers: COX11-F: SEQ ID NO. 5: TCGAAGAATCTACGGATTTTGTCAC; COX11-R: SEQ ID NO. 6: GTTGGAACAAATTTCCAGGGC. A 50 µL PCR reaction consisted of 25 µL Superstar Mix, 1 µL template cDNA, 1 µL forward primer, 1 µL reverse primer, and 22 µL ddH2O, mixing thoroughly. The PCR protocol was as follows: 94°C initial denaturation for 5 min; 94°C denaturation for 30 s; 54°C annealing for 30 s; 72°C extension for 40 s (35 cycles); 72°C extension for 10 min, and storage at 16°C. Positive isolates were identified by electrophoresis and stored.

[0086] (1) Activation of strains: Add the Agrobacterium culture containing pTRV2 (empty), pTRV2-GhCOX11, pTRV2-CLA1, and 192 stored at -80 °C to LB liquid culture medium containing 50 μg / mL Kan and 50 μg / mL Rif, and activate the strains in a shaker (28 °C, 200 rpm).

[0087] (2) The activated bacterial solution was taken and added to LB liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif (this medium contains 10 mM MES pH = 6.5 and 20 μM AS) and cultured at 28 °C and 200 rpm until the OD 600 = 1.2.

[0088] (3) Centrifuge at 5500 rpm for 10 min at 4°C.

[0089] (4) Discard the supernatant and retain the precipitated bacteria, resuspend them in sterile water, and centrifuge and wash them twice.

[0090] (5) Suspend Agrobacterium cells in infiltration solution (containing 10 mM MgCl2, 10 mM MES pH = 5.6, 20 μM AS) to an OD of 600 = 1.2.

[0091] (6) Let stand at room temperature for 3 h.

[0092] (7) Before infection, the pTRV2 (empty), pTRV2-GhCOX11, and pTRV2-CLA1 strain suspensions resuspended in buffer were mixed evenly with the pTRV1 (192) strain suspension in equal volumes.

[0093] (8) Inoculation of Agrobacterium: Use the leaf syringe infiltration method to select cotton seedlings that are in good growth condition and have only two cotyledons. First, use the syringe needle to gently puncture the back of the cotyledon to create a micro-wound, but do not pierce the leaf. Then use a syringe without the needle to inject the bacterial solution from the wound on the back, so that both cotyledons are completely soaked. Plants without treatment serve as controls. The types of plants to be injected are as follows:

[0094] pTRV1+pTRV2 (empty): negative control for the experiment.

[0095] pTRV1+CLA1: The appearance of an albino phenotype indicates that the VIGS results are reliable: a positive control for the experiment.

[0096] pTRV1+ pTRV2-GhCOX11: experimental group materials.

[0097] (9) Cultivation of plants after gene silencing: After gene silencing inoculation, the plants were first cultured in the dark at 23 °C for 24 h, and then cultured at 23 °C with a 16 h / 8 h light / dark cycle for 3-4 weeks to observe the phenotype and detect the gene silencing efficiency.

[0098] 1.10 qRT-PCR analysis

[0099] VIGS silence GhCOX11 After gene expression was confirmed, qRT-PCR was used to analyze gene silencing efficiency. The qRT-PCR primer sequences were: qRT-COX11-F: SEQ ID NO. 7: TGCATTAGTGTTTGCAATGGTGG; qRT-COX11-R: SEQ ID NO. 8: CCTCAAAGCAAAAGCACTGG. The RT-qPCR reaction system consisted of 10 µL 2x ChamQ Universal SYBR qPCR Master Mix; 0.4 µL forward primer; 0.4 µL reverse primer; 1 µL template cDNA; and 8.2 µL ddH2O, mixed thoroughly. The RT-qPCR protocol was as follows: Step 1: pre-denaturation at 95°C for 30 s; Step 2: denaturation at 95°C for 5 s; annealing at 60°C for 20 s; Step 3: melting curve creation (95°C for 15 s; 60°C for 60 s; and 95°C for 15 s). Real-time quantitative PCR was performed using an ABI 7500 real-time fluorescence quantitative PCR system. Three plants were selected and mixed at each time, and the results were repeated three times.

[0100] 2. Results Analysis

[0101] 2.1 GhCOX11 Expression pattern analysis

[0102] To characterize GhCOX11 The expression pattern of GhCOX11 The expression levels in different cotton tissues (roots, stems, leaves, petals, stigmas, pistils, anthers and young buds) showed that GhCOX11 It is expressed in all tissues of cotton, with the highest relative expression levels in anther and bud ( Figure 1 In order to determine GhCOX11 To investigate whether cotton seedlings responded to environmental stress, drought, salt and low temperature treatments were applied. GhCOX11 The expression level of α was significantly higher under drought, salt and low temperature treatments than that under control, and the expression level under drought and low temperature treatments was higher than that under salt treatment, indicating that it may be involved in the stress response of cotton ( Figure 1 b). To this end, the present technicians cloned GhCOX11The promoter was used to construct the GhCOX11-GUS vector driven by it ( Figure 1 c), infected Arabidopsis thaliana through Agrobacterium-mediated genetic transformation. GUS staining results showed that blue precipitates appeared in the roots, stems and leaves of the transgenic lines at the seedling stage of Arabidopsis thaliana ( Figure 1 d in), which is consistent with GhCOX11 The results of qRT-PCR in cotton tissue were consistent. A subcellular localization vector was further constructed in which GhCOX11 was fused with enhanced green fluorescent protein (eGFP). Subcellular localization results showed that GhCOX11 protein was localized in mitochondria ( Figure 1 e in the above example).

[0103] 2.2 VIGS-mediated GhCOX11 silencing and drought stress treatment

[0104] To further determine the biological function of the GhCOX11 gene, VIGS experiments were performed to silence GhCOX11. Three weeks after inoculation with Agrobacterium tumefaciens, the transcript levels of GhCOX11 were significantly reduced in TRV::COX11-1, TRV::COX11-2, and TRV::COX11-3 plants compared with TRV::00 cotton plants ( Figure 1 The results show that GhCOX11 The gene was effectively silenced in cotton plants. Based on this, the three lines were treated with 4% PEG6000. Drought tolerance was assessed by leaf wilting one week later. The results showed that the leaves of the drought-treated TRV::COX11 plants showed significant wilting compared to TRV::00 cotton, accompanied by a reduced plant height and more leaf drop ( Figure 1 g in the figure). The relative water content and H2O2 content of leaves of TRV::00 and TRV::COX11 cotton plants treated with drought were further measured. The water content of leaves of TRV::COX11 was significantly lower than that of TRV::00 ( Figure 1 h), while the H2O2 content was significantly higher than that of the control ( Figure 1 The i) in the GhCOX11 Silencing of α leads to water loss and more free ROS in leaves under drought stress. These results indicate that GhCOX11 The gene plays a role in drought tolerance in cotton by possibly participating in oxidative metabolism.

[0105] 2.3 GhCOX11 improves drought tolerance in tobacco

[0106] In order to further determine the drought tolerance of GhCOX11, the present technicians cloned GhCOX11 genes and constructed GhCOX11 Overexpression vectors and RNAi vectors ( Figure 2A total of 3 positive strains were obtained through Agrobacterium-mediated genetic transformation and PCR identification. GhCOX11 Transgenic tobacco (OE-COX11-1, OE-COX11-2, and OE-COX11-3) ( Figure 2 b). Three RNAi-COX11 materials (RNAi-COX11-4, RNAi-COX11-9 and RNAi-COX11-11) were obtained. qRT-PCR analysis showed that the overexpression of tobacco GhCOX11 The expression level of COX11 in RNAi-COX11 tobacco was significantly higher than that in WT. GhCOX11 The expression level of Figure 2 c in the figure) indicates that GhCOX11 To further determine whether GhCOX11 can enhance the drought resistance of tobacco, 4% PEG6000 solution was used to treat WT, OE-COX11 and RNAi-COX11 seedlings. The results showed that after drought treatment, the lower leaves of the three RNAi-COX11 tobacco lines dried up and turned yellow. The degree of yellowing of the WT leaves was lighter than that of the RNAi-COX11 material, while the overexpression material only showed wilting leaves. These results further illustrate that GhCOX11 Can improve the drought tolerance of plants.

[0107] The present inventors measured plant height, aboveground biomass and relative water content (RWC) under drought stress and found that plant height, aboveground biomass and relative water content of leaves of OE-COX11 tobacco were significantly higher than those of WT, while the three physiological indicators of RNAi-COX11 tobacco were significantly lower than those of WT ( Figure 2 e in Figure 2 f in Figure 2 g in the figure). Further observation of the root phenotype under drought treatment showed that the roots of the three OE-COX11 lines were longer and denser compared with RNAi-COX11 tobacco and WT ( Figure 3 By measuring the length, the roots of OE-COX11 tobacco were significantly longer than those of the wild type, while the roots of RNAi-COX11-9 and RNAi-COX11-11 tobacco were significantly shorter than those of the wild type ( Figure 3 Similarly, surface area measurements also showed that OE-COX11 roots had an advantage under stress, with the root surface area of ​​OE-COX11 being significantly larger than that of the control and RNAi-COX11 ( Figure 3 c) in the above example.

[0108] In addition, after drought treatment for one week, trypan blue staining was used to qualitatively observe the number of dead cells based on the staining intensity. After drought treatment, WT and RNAi-COX11 tobacco leaves showed more blue precipitate after trypan blue staining, while OE tobacco leaves showed less blue ( Figure 3 d in the figure), indicating that the OE-COX11 tobacco material suffered less damage under drought conditions. Under drought stress, the CAT content in the leaves of the OE-COX11 line increased significantly compared with the control and RNAi-COX11 lines. Among them, the CAT content in the OE-COX11 line was about 1.2 times higher than the control and 1.4 times higher than the control. Similarly, the SOD content in the leaves of the OE-COX11 line was about 1.4 times higher than the control in the drought control and 1.8 times higher than the RNAi-COX11 line. H2O2 content analysis showed that the H2O2 content of the three overexpression materials was significantly lower than that of the WT, while the H2O2 content of the three RNAi-COX11 tobacco materials was significantly higher than that of the WT. The results showed that GhCOX11 It may mediate the plant response to drought stress by regulating intracellular ROS levels by affecting ROS-related scavenging mechanisms.

[0109] 2.4 GhCOX11 improves low-temperature tolerance in tobacco

[0110] Based on the response of COX11 promoter to low temperature, WT, OE-COX11 and RNAi-COX11 seedlings were treated at 4°C. After two weeks of stress, they were transferred to room temperature for 3 days. RNAi-COX11 seedlings showed obvious dehydration, and most seedlings wilted or even died. Since tobacco itself has good tolerance to low temperatures. The control material did not show significant death, and some plants wilted due to water loss. The three overexpressed OE-COX11s performed better overall, and only some plants showed slight wilting of leaves ( Figure 4 The SOD content was measured. Under low temperature stress, the SOD content in the leaves of the RNAi-COX11 line was significantly lower than that of the control and OE-COX11 lines. The SOD content in the RNAi-COX11 line was about 2 times lower than that of the OE-COX11 line ( Figure 4 (b) The rupture of plant cell membranes or the loss of selective permeability is the cytological cause of freezing damage. The electrolyte leakage rate of plant cells is often used to characterize plant cold resistance. Measurements revealed that the electrolyte leakage rate of leaves in RNAi-COX11 strains was approximately 1.5 times higher than that of the control and nearly 2 times higher than that of the OE-COX11 strain ( Figure 4c). This indicates that the cells were severely damaged by freezing. H2O2 content analysis showed that the H2O2 content of the three OE-COX11 materials was significantly lower than that of the WT, while the H2O2 content of the three RNAi-COX11 tobacco materials was significantly higher than that of the WT ( Figure 4 The results indicate that COX11-mediated plant cold tolerance is also achieved by regulating intracellular ROS levels through ROS-related scavenging mechanisms.

[0111] In summary:

[0112] Key points of this invention GhCOX11 The expression pattern and biological function of the gene. VIGS experiments showed that silencing of the gene significantly reduced the drought tolerance of the plant. GhCOX11 Overexpression tobacco strains and RNAi interference strains were treated with 4% PEG and 4°C low temperature. It was found that the leaves of the overexpression strains wilted less than those of the wild type, and their roots were also thicker. Trypan blue staining was used to observe the overexpression GhCOX11 The leaves of the strain had fewer dead cells, lower damage, and higher expression levels of antioxidant enzymes (SOD and CAT), which were mutually verified with the staining results. In contrast, after drought and low temperature treatment, the leaves of the RNAi interference strain wilted more severely than those of the wild type, and its root system was also sparser. Trypan blue staining showed that the leaves of the RNAi interference strain had more dead cells, higher damage, and lower expression levels of antioxidant enzymes (SOD and CAT), which were mutually verified with the staining results. The results showed that GhCOX11 Has better tolerance to drought and low temperatures.

[0113] The present invention has been described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0114] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0115] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0116] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0117] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, can be equivalent parameters, concentration and conditions, implement the present invention in a wide range. Although the present invention provides special embodiments, it should be understood that the present invention can be further improved. In a word, by the principle of the present invention, the application is intended to include any variation, purposes or improvements to the present invention, including departing from the disclosed range in the application, and the changes performed with conventional techniques known in the art.

Claims

1. Application of a gene that overexpresses GhCOX11 protein in improving drought tolerance and low temperature tolerance in tobacco, characterized in that: The amino acid sequence of GhCOX11 protein is shown in SEQ ID NO.

1.

2. Use of the biomaterial related to the GhCOX11 protein according to claim 1, characterized in that: The application is any of the following: D1) Application in improving tobacco drought tolerance and low temperature tolerance; D2) Application in the preparation of tobacco with improved drought and low temperature resistance; The biological material is any one of the following E1) to E3): E1) an expression cassette containing a nucleic acid molecule encoding the GhCOX11 protein; E2) a recombinant vector containing a nucleic acid molecule encoding the GhCOX11 protein; E3) a recombinant microorganism containing a nucleic acid molecule encoding a GhCOX11 protein, or a recombinant microorganism containing the expression cassette described in E1), or a recombinant microorganism containing the recombinant vector described in E2), wherein the microorganism is Agrobacterium; The amino acid sequence of the GhCOX11 protein is shown in SEQ ID NO. 1, and the nucleotide sequence of the nucleic acid molecule encoding the GhCOX11 protein is shown in SEQ ID NO.

2.

3. A method for cultivating low-temperature tolerant plants, characterized in that: The method comprises overexpressing a GhCOX11 protein gene in a plant to obtain a plant with improved low temperature tolerance, wherein the plant is tobacco, and the amino acid sequence of the GhCOX11 protein is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that The gene for overexpressing the GhCOX11 protein in the plant is a gene that utilizes transgenic technology to increase the expression level of the gene encoding the GhCOX11 protein in claim 1 in tobacco.

5. The method according to claim 4, characterized in that The method of increasing the expression level of the gene encoding the GhCOX11 protein in tobacco according to claim 1 by using transgenic technology is to introduce a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

Citation Information

Patent Citations

  • Biomarkers of target modulation, efficacy, diagnosis and / or prognosis for raf inhibitors

    CN101541977A

  • Genetically engineered bacterium capable of increasing yield of lacto-N-fucopentaose and production method of genetically engineered bacterium

    CN113832092A