Application of OsNRT2-P2 nitrogen-efficient gene in improvement of salt tolerance of crops or in breeding of salt-tolerant crops
By overexpressing the high-efficiency gene of OsNRT2-P2 nitrogen in crops, the problem of low efficiency of traditional breeding methods is solved, the salt tolerance and growth traits of the crop are improved, and growth improvement and variety optimization under salt stress are achieved.
Patent Information
- Application Number
- CN202510757216.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art is inefficient in improving crop salt tolerance, traditional breeding methods have long cycles, and lack gene expression methods that accurately regulate nitrogen metabolism pathways to cope with soil salinization.
By using OsNRT2-P2 nitrogen high-efficiency gene overexpression technology, the nitrogen absorption and utilization ability of the crop is improved and the salt tolerance of the crop is enhanced.
It improves the growth traits and survival rate of crops under salt stress, improves the growth of crops in saline-alkali land environment, and cultivates new varieties with excellent salt tolerance.
Smart Images

Figure CN120442710A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to the application of the OsNRT2-P2 nitrogen-efficient gene in improving crop salt tolerance or in salt-tolerant crop breeding. Background Art
[0002] Salt tolerance of crops is a key factor in determining their growth and yield in extreme environments such as saline-alkali soils. With the increasing salinization of soils caused by global climate change and inappropriate irrigation, improving crop salt tolerance has become a key research topic in agricultural science. Traditional salt tolerance breeding methods are time-consuming and inefficient. However, the rapid development of modern biotechnology, particularly the application of genetic engineering, has made it possible to rapidly cultivate salt-tolerant crops. Nitrogen is an essential nutrient for plant growth and has a significant impact on crop growth and yield. Genes are those that enhance a plant's ability to absorb, transport, and utilize nitrogen. However, relatively little research has examined the relationship between genes and crop salt tolerance.
[0003] Therefore, existing technologies urgently need a method to precisely regulate the expression levels of effective genes to optimize the nitrogen metabolism pathways of crops and thereby improve the salt tolerance of crops, providing strong support for solving soil salinization problems and improving agricultural production efficiency. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide an application of the OsNRT2-P2 nitrogen-efficient gene in improving crop salt tolerance or in salt-tolerant crop breeding, thereby improving crop growth under salt stress.
[0005] In order to achieve the above object, the present invention provides the following technical solutions:
[0006] The present invention provides an application of the OsNRT2-P2 nitrogen-efficient gene in improving crop salt tolerance or in salt-tolerant crop breeding. The nucleotide sequence of the OsNRT2-P2 nitrogen-efficient gene is shown in SEQ ID NO.1.
[0007] Preferably, the OsNRT2-P2 nitrogen-efficient gene of claim 1 is overexpressed in crops.
[0008] Preferably, said improving the salt tolerance of crops comprises improving the growth traits and survival rate of crops under salt stress.
[0009] Preferably, the crop plant is a monocotyledonous plant.
[0010] The present invention also provides the use of a biological material overexpressing the OsNRT2-P2 nitrogen-efficient gene for improving crop salt tolerance or in salt-tolerant crop breeding. The nucleotide sequence of the OsNRT2-P2 nitrogen-efficient gene is shown in SEQ ID NO. 1. The biological material comprises one of a recombinant expression vector containing the OsNRT2-P2 nitrogen-efficient gene and a recombinant microorganism containing the OsNRT2-P2 nitrogen-efficient gene.
[0011] Preferably, when constructing a recombinant expression vector containing the OsNRT2-P2 nitrogen-efficient gene, the amplification primer pair for the OsNRT2-P2 nitrogen-efficient gene includes a forward primer GSP1 and a reverse primer GSP2, the nucleotide sequence of the forward primer GSP1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer GPS2 is shown in SEQ ID NO.3.
[0012] Preferably, the initial vector of the recombinant expression vector includes pCAMBIA1300-35S, and the OsNRT2-P2 nitrogen-efficient gene is inserted between BamHI and HindIII of pCAMBIA1300-35S.
[0013] Preferably, the recombinant microorganism includes a recombinant microorganism obtained by transforming the recombinant expression vector into Agrobacterium, and the Agrobacterium includes EHA105.
[0014] The present invention also provides a method for improving the salt tolerance of crops, which comprises overexpressing the OsNRT2-P2 nitrogen-efficient gene of claim 1 in the crops.
[0015] The present invention also provides a method for cultivating OsNRT2-P2 transgenic crop plants, wherein the biological material overexpressing the OsNRT2-P2 nitrogen efficient gene according to claim 4 is transformed into a target crop to obtain an OsNRT2-P2 transgenic crop plant.
[0016] Preferably, the crop plant is a monocotyledonous plant.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] The present invention provides an application of the OsNRT2-P2 nitrogen-efficient gene for improving crop salt tolerance or in salt-tolerant crop breeding. Biomaterials overexpressing the OsNRT2-P2 nitrogen-efficient gene are transformed into target crops to obtain transgenic crop plants with increased expression of the OsNRT2-P2 nitrogen-efficient gene. This improves the salt tolerance of the target crops and the growth of crops under salt stress, providing strong support for solving soil salinization problems and improving agricultural production efficiency. The gene can be used to cultivate new crop varieties with excellent salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 Schematic diagram of the structure of the rice gene expression skeleton vector in Example 1 of the present invention.
[0020] Figure 2 The relative expression levels of OsNRT2-P2 in different plant materials in Example 3 of the present invention are shown; among them, ZH11 is the wild-type Zhonghua 11 rice, OsNRT2-P2-OE#4 is the homozygous rice plant numbered 4 overexpressing the OsNRT2-P2 gene, and OsNRT2-P2-OE#10 is the homozygous rice plant numbered 10 overexpressing the OsNRT2-P2 gene; *** indicates p < 0.001.
[0021] Figure 3 This is a schematic diagram of the agronomic traits of the aboveground length of the wild rice and modified rice after planting in Example 4 of the present invention; wherein, ZH11 is the wild-type Zhonghua 11 rice, OsNRT2-P2-OE#4 is the homozygous rice plant numbered 4 overexpressing the OsNRT2-P2 gene, and OsNRT2-P2-OE#10 is the homozygous rice plant numbered 10 overexpressing the OsNRT2-P2 gene; osnar2.2#1 is a homozygous rice mutant of the OsNRT2-P2 gene numbered 1, and osnar2.2#2 is a homozygous rice mutant of the OsNRT2-P2 gene numbered 2; ** indicates p < 0.01.
[0022] Figure 4 This is a schematic diagram of the agronomic traits of the growth phenotypes of wild rice and modified rice after planting in Example 4 of the present invention; wherein, ZH11 is the wild-type Zhonghua 11 rice, OsNRT2-P2-OE#4 is a homozygous rice plant numbered 4 overexpressing the OsNRT2-P2 gene, and OsNRT2-P2-OE#10 is a homozygous rice plant numbered 10 overexpressing the OsNRT2-P2 gene; osnar2.2#1 is a homozygous rice mutant of the OsNRT2-P2 gene numbered 1, and osnar2.2#2 is a homozygous rice mutant of the OsNRT2-P2 gene numbered 2.
[0023] Figure 5 Schematic diagram of the agronomic traits of the survival rate of wild rice and modified rice after planting in Example 4 of the present invention; wherein, ZH11 is the wild-type Zhonghua 11 rice, OsNRT2-P2-OE#4 is the homozygous rice plant numbered 4 overexpressing the OsNRT2-P2 gene, OsNRT2-P2-OE#10 is the homozygous rice plant numbered 10 overexpressing the OsNRT2-P2 gene; osnar2.2#1 is a homozygous rice mutant of the OsNRT2-P2 gene numbered 1, and osnar2.2#2 is a homozygous rice mutant of the OsNRT2-P2 gene numbered 2; *** indicates p < 0.001. DETAILED DESCRIPTION
[0024] The present invention provides an application of the OsNRT2-P2 nitrogen-efficient gene for improving crop salt tolerance or in salt-tolerant crop breeding. The accession number of the OsNRT2-P2 nitrogen-efficient gene in the MSU database is (LOC_Os04g40410). The CDS sequence of the OsNRT2-P2 nitrogen-efficient gene is shown in SEQ ID NO. 1, specifically as follows: 5'--3' (SEQ ID NO. 1).
[0025] In the present invention, the application includes overexpressing the OsNRT2-P2 nitrogen-efficient gene in target crops to improve the salt tolerance of crops or to breed salt-tolerant crops.
[0026] The present invention also provides the use of a biological material that overexpresses the OsNRT2-P2 nitrogen-efficient gene in improving crop salt tolerance or in breeding salt-tolerant crops. The nucleotide sequence of the OsNRT2-P2 nitrogen-efficient gene is shown in SEQ ID NO. 1, and the biological material comprises any one of a primer pair for amplifying the OsNRT2-P2 nitrogen-efficient gene, a recombinant expression vector containing the OsNRT2-P2 nitrogen-efficient gene, and a recombinant microorganism containing the OsNRT2-P2 nitrogen-efficient gene.
[0027] In the present invention, when constructing a recombinant expression vector containing the OsNRT2-P2 nitrogen-efficient gene, the amplification primer pair for the OsNRT2-P2 nitrogen-efficient gene is preferably a forward primer GSP1 and a reverse primer GSP2, the nucleotide sequence of the forward primer GSP1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer GPS2 is shown in SEQ ID NO.3.
[0028] SEQ ID NO.2: 5′-gagctcggtacccggggatccATGGCTCGGTTTGGGGCG-3′ (the lowercase sequence is the vector homology arm region, and the uppercase sequence is the cDNA region of OsNRT2-P2);
[0029] SEQ ID NO. 3: 5′-acgacggccagtgccaagcttTCACTTGTTCTTCTTCTTGTTCTCG-3′ (the lowercase sequence is the vector homology arm region, and the uppercase sequence is the cDNA region of OsNRT2-P2).
[0030] In the present invention, the initial vector of the recombinant expression vector preferably comprises pCAMBIA1300-35S. The OsNRT2-P2 nitrogen-efficient gene is inserted between BamHI and HindIII of pCAMBIA1300-35S. Preferably, the CDS sequence amplified by the primer pair is inserted between BamHI and HindIII of pCAMBIA1300-35S to form pCAMBIA1300-35S-OsNRT2-P2.
[0031] In the present invention, the pCAMBIA1300-35S contains the 35S promoter of cauliflower mosaic virus (CaMV), and the sequence of the pCAMBIA1300-35S is preferably as shown in SEQ ID NO.4, specifically as follows:
[0032]
[0033] The present invention has no particular limitation on the method for constructing the recombinant expression vector, and conventional vector construction methods in the art, such as enzyme ligation, may be used.
[0034] In the present invention, the recombinant microorganism preferably includes a recombinant microorganism obtained by transforming the recombinant expression vector into Agrobacterium, and the Agrobacterium is preferably EHA105.
[0035] In the present invention, the crop is preferably a monocotyledonous plant, more preferably rice.
[0036] The present invention transforms rice into biomaterials that overexpress the OsNRT2-P2 nitrogen-efficient gene to obtain transgenic rice plants with increased expression of the OsNRT2-P2 nitrogen-efficient gene, thereby improving the salt tolerance of rice and the growth of rice under salt stress. Specifically, the growth of rice under salt stress, especially plant height and root length, is improved, and the survival rate of rice seedlings is increased. The transgenic rice plant can be applied to salt-tolerant rice breeding.
[0037] The present invention also provides a method for cultivating OsNRT2-P2 transgenic crop plants, comprising transforming the biomaterial overexpressing the OsNRT2-P2 nitrogen-efficient gene into a target crop to obtain an OsNRT2-P2 transgenic crop plant. In the method, the crop is preferably a monocotyledonous plant, more preferably rice.
[0038] The present invention has no particular limitation on the method for introducing the OsNRT2-P2 nitrogen-efficient gene into rice, and conventional methods in the art may be used.
[0039] The japonica rice variety 'Zhonghua 11' (also known as ZH11) described in the following examples was cultivated by the Crop Research Institute of the Chinese Academy of Agricultural Sciences in 1979 using Jingfeng No. 5, Tetepu, and Fujin varieties. It was bred in 1984 and approved in Tianjin in 1989, receiving the rice number Jinshendao 1989016. Its specific source is not particularly limited and can be purchased as needed.
[0040] In the following examples, the formula of the solid NBD-As medium is as follows: NB basal medium + 2,4-D 2mg / L + acetosyringone (As) 100μmol / L, pH 5.5. The formula of the LB medium is as follows: yeast extract 5g / L + trypsin extract 10g / L + sodium chloride 10g / L, pH 7.0. The formula of the NBD-T medium is as follows: NB basal medium + 2,4-D 2mg / L + Timentin 2.8g / L, pH 5.8. The formula of the rooting medium RE2 is as follows: 1 / 2N6 macroelements + 1 / 2B5 trace elements + inositol 1g / L + sucrose 30g / L + gelrite 4g / L, pH 5.8.
[0041] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.
[0042] Example 1
[0043] Construction of expression vector for overexpressing OsNRT2-P2 gene
[0044] 1) RNA extraction
[0045] Rice plant samples weighing between 20 and 50 mg were collected from the japonica rice variety "Zhonghua 11" (variety origin: cultivated in 1979 by the Crop Research Institute of the Chinese Academy of Agricultural Sciences using Jingfeng No. 5 / Tetepu / Fujin, bred in 1984, and approved in Tianjin in 1989, with the number: Jinshendao 1989016). The samples were then rapidly frozen using liquid nitrogen. After freezing, they were finely ground into a powder using specialized grinding equipment. Next, 1 ml of Invitrogen Trizol reagent (manufactured by Thermo Fisher Scientific) was added to the resulting powder and mixed thoroughly. Subsequently, 0.2 ml of chloroform was added to the mixture, and the mixture was shaken vigorously for 15 seconds to ensure thorough contact between the chloroform and the mixture. After shaking, the mixture was allowed to stand at room temperature for 3 minutes to allow the chloroform to fully extract impurities. After standing, the mixture was centrifuged at 8000 rpm for 15 minutes. After centrifugation is completed, the mixture is divided into three layers, of which the upper layer is an aqueous phase containing RNA. Use a pipette to carefully transfer the upper aqueous phase to a new sterile centrifuge tube. Subsequently, add an appropriate amount of isopropanol to the new centrifuge tube and let it stand at room temperature for 10 minutes. The role of isopropanol is to bind to RNA to form an RNA precipitate. After standing, the mixture is centrifuged again using a centrifuge at a speed of 8000 rpm for 15 minutes. After centrifugation is completed, RNA is precipitated at the bottom of the centrifuge tube. Finally, 30 microliters of ddH2O (double distilled water) is added to the dried RNA precipitate and the centrifuge tube is gently shaken to promote the dissolution of the RNA. After dissolution is completed, the resulting RNA solution can be used for subsequent molecular biology experiments or analysis.
[0046] 2) RNA reverse transcription
[0047] Using the Novozymes brand II First Strand cDNA Synthesis Kit ( II 1stStrand cDNA Synthesis Kit) to perform the reverse transcription process. The operation process is as follows: First, in a 200-μl centrifuge tube, accurately mix the following components: 1 μl of Oligo(dT)23VN (at a concentration of 50 μmol / L), 3 μl of RNase-free deionized water (RNase-free ddH2O), and 5 μl of RNA solution from the previous step. Subsequently, the mixture is heated at 65°C for 5 minutes, and then quickly transferred to ice for rapid cooling, and kept for 2 minutes to ensure a sudden drop in temperature. Next, 8 μl of the cooled mixture is aspirated and added to a new tube containing 10 μl of a 2-fold concentration reverse transcription mixture (2×RT Mix) and 2 μl of HiScript II enzyme mixture (HiScript II Enzyme Mix). Use a pipette to gently pipette to ensure that all components are evenly mixed. Finally, the mixture was placed in a PCR instrument and the first-strand cDNA synthesis was performed according to the preset program: first, the mixture was kept at 50°C for 45 minutes to promote the reverse transcription reaction, and then the temperature was raised to 85°C and held for 2 minutes to terminate the reaction. This resulted in a cDNA solution.
[0048] 3) Obtaining target genes
[0049] In a 200 μl centrifuge tube, a PCR reaction mixture was prepared. The components included: 5 μl of the cDNA solution obtained in the previous step; 2 μl of gene-specific primer 1 (GSP1, sequence shown in SEQ ID NO. 2, specifically: 5'-gagctcggtacccggggatccATGGCTCGGTTTGGGGCG-3'); 2 μl of gene-specific primer 2 (GSP2, sequence shown in SEQ ID NO. 3, specifically: 5'-acgacggccagtgccaagcttTCACTTGTTCTTCTTCTTGTTCTCG-3'); 25 μl of 2x concentration Phanta Max Master Mix; and 16 μl of double-distilled water (ddH2O). PCR amplification was then performed according to the PCR protocol detailed in Table 1. This yielded a solution of the OsNRT2-P2 gene coding sequence (CDS) containing homology sequence arms.
[0050] Table 1 PCR reaction procedure
[0051]
[0052] 4) Obtaining recombinant vector
[0053] The pCAMBIA1300-35S vector (sequence shown in SEQ ID NO.4) was digested with high-fidelity restriction endonucleases Hind III and BamH I, and the treated linear vector was then recovered. Next, the linear vector was mixed with the OsNRT2-P2 gene coding sequence (CDS) solution containing homologous sequence arms prepared in the previous step. This mixing process was carried out in an environment containing 5×CE II Buffer and Exnase II enzyme (ClonExpress II one-step cloning kit from Vazyme), and the reaction lasted for 1 hour. Finally, through the above homologous recombination reaction, the pCAMBIA1300-35S-Os NRT2-P2 recombinant vector was successfully constructed, which serves as the basic vector structure for rice gene expression. See the figure for details. Figure 1 .
[0054] Example 2
[0055] Taking japonica rice Zhonghua 11 (ZH11) as an example, the OsNRT2-P2 gene was transformed into rice seeds to obtain japonica rice Zhonghua 11 transgenic rice.
[0056] 0.5 μg of the pCAMBIA1300-35S-OsNRT2-P2 gene expression plasmid prepared in Example 1 was transformed into competent cells of the Agrobacterium tumefaciens strain EHA105. The cells were then sequentially treated with a 5-minute ice bath, a 5-minute quick freeze in liquid nitrogen, a 5-minute water bath at 37°C, and a 5-minute ice bath. After these treatments, LB medium without antibiotics was added to the system and activated in a shaker at 28°C for 1 hour to obtain an Agrobacterium strain carrying the pCAMBIA1300-35S-OsNRT2-P2 plasmid.
[0057] The prepared EHA105 strain containing the gene expression plasmid was used to transform the callus tissue of japonica rice Zhonghua 11. The specific steps are as follows:
[0058] Callus induction and subculture of Japonica rice Zhonghua 11 can be performed using conventional procedures known to those skilled in the art. Agrobacterium carrying the plasmid was cultured in AAM liquid medium containing 50 mg / L kanamycin (Kan) and 50 mg / L rifampicin (Rif) at 28°C in the dark with shaking at 200 rpm until the OD 600 The absorbance reached 0.4 to 0.6 nm. Afterwards, the cells were collected by centrifugation and resuspended in NB-As liquid to an OD of 600nm = 0.1. Select appropriate callus pieces and place them in a 50 mL centrifuge tube containing the Agrobacterium suspension for 30 minutes. Excess bacterial suspension is then removed by blotting onto sterile filter paper. The callus is then air-dried on a clean bench, covered with sterile filter paper. After air-drying, the callus is transferred to solid NBD-As medium covered with sterile filter paper and cultured in the dark at 25°C.
[0059] After three days of dark incubation, the calli were soaked in sterile water containing 150 mg / L Timentin for 10 minutes. Excess water was then blotted off, air-dried again, and transferred to NBD-As medium for a resumption of incubation, this time at 32°C under light conditions for four days. The calli were then transferred to NBD-T medium containing the selection antibiotic hygromycin for continued selection, with subcultures performed every two weeks. When adventitious buds grew to 3 to 5 cm, the seedlings were excised and transferred to rooting medium RE2 for rooting induction, ultimately yielding transgenic rice seedlings.
[0060] Example 3
[0061] Whole-genome DNA was extracted from the leaves of the seedlings selected in Example 2. Using standard PCR technology, the hygromycin resistance gene was identified, and two transgenic seedlings showing positive results were successfully identified. Next, total RNA was extracted from these confirmed hygromycin-resistant seedlings and converted into cDNA through a reverse transcription step. In order to quantify the expression level of the OsNRT2-P2 gene, SYBR qPCR Master Mix reagent produced by Novozymes Biotech Co., Ltd. was used, and real-time fluorescence quantitative PCR (qPCR) analysis was performed. In this process, the OsActin gene was selected as an internal reference standard to standardize the data. The specific information of the primer sequences used for qPCR is as follows:
[0062] OsNRT2-P2 qPCR forward primer 5′-3′: TGTTGCTGCTCCTTGTAGTTCTC (SEQ ID NO. 5);
[0063] OsNRT2-P2 qPCR reverse primer 5′-3′: CTTCTTCTTGTTCTCGAGGACGA (SEQ ID NO. 6);
[0064] OsActin qPCR forward primer 5′-3′: GGGTTCACAAGTCTGCCTATTGT (SEQ ID NO. 7);
[0065] OsActin qPCR reverse primer 5′-3′: ACGGGACACGACCAAGGA (SEQ ID NO. 8).
[0066] The relative expression levels of OsNRT2-P2 in wild-type Zhonghua 11 (ZH11) and the resulting homozygous OsNRT2-P2-OE4 and OsNRT2-P2-OE102 OsNRT2-P2 overexpressing transgenic rice are shown in Figure 2. Figure 2 The relative expression levels of OsNRT2-P2 in OsNRT2-P2-OE4 and OsNRT2-P2-OE10 were increased by 2.75-fold and 2.5-fold, respectively, compared with ZH11.
[0067] Example 4
[0068] Rice plant height, root length and survival rate detection
[0069] The wild-type Zhonghua 11 rice (ZH11), OsNRT2-P2-OE4 described in Example 3, OsNRT2-P2-OE10 described in Example 3, and the homozygous mutants of the OsNRT2-P2 gene, osnar2.2#1 (Hangzhou Baige Biotechnology Co., Ltd., seed number BG100234F05) and osnar2.2#2 (Hangzhou Baige Biotechnology Co., Ltd., seed number BGY007281017), were germinated in the dark and accelerated. After about three weeks of germination, they were transferred to rice nutrient solution supplemented with 75 mM NaCl (International Rice Nutrient Solution Standard, IRRI). After 7 days of treatment, the aboveground length was measured and the phenotype was photographed. The survival rate was calculated as follows: Figure 3 、 4 , as shown in 5.
[0070] Depend on Figure 3 It can be seen that the average aboveground height of the wild-type Zhonghua 11 rice (ZH11) is about 22 cm, while the plant heights of two different OsNRT2-P2 overexpression homozygous lines, OsNRT2-P2-OE4 and OsNRT2-P2-OE10, are between 25 cm and 28 cm, and the OsNRT2-P2 mutant strains show a significant decrease in aboveground length.
[0071] Depend on Figure 4 It can be seen that the growth phenotype of the wild-type Zhonghua 11 rice (ZH11) was significantly inferior to that of two different OsNRT2-P2 overexpression homozygous lines, OsNRT2-P2-OE4 and OsNRT2-P2-OE10, and the aboveground length was reduced compared with the overexpression lines. However, the OsNRT2-P2 mutants osnar2.2#1 and osnar2.2#2 showed a significant growth inhibition phenotype, and the overall plants were short.
[0072] Depend on Figure 5It can be seen that the survival rate of the wild-type Zhonghua 11 rice (ZH11) is about 85%, while the survival rate of two different OsNRT2-P2 overexpression homozygous strains is about 15% higher than that of the wild-type Zhonghua 11 (ZH11), with almost no mortality. However, the OsNRT2-P2 mutants osnar2.2#1 and osnar2.2#2 showed a salt stress-sensitive phenotype.
[0073] In summary, overexpression of the OsNRT2-P2 gene can significantly increase the overall growth of rice. The double comparison of mutants and overexpression lines further highlights the positive correlation between OsNRT2-P2 protein levels and rice's resistance to salt stress. In particular, the aboveground plant height is significantly better than that of the wild type, and the survival rate of rice under salt stress conditions is also significantly improved.
[0074] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Application of the OsNRT2-P2 nitrogen-efficient gene for improving crop salt tolerance or in salt-tolerant crop breeding, characterized in that: The nucleotide sequence of the OsNRT2-P2 nitrogen efficient gene is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that Overexpression of the OsNRT2-P2 nitrogen-efficient gene of claim 1 in crops.
3. The use according to claim 1 or 2, characterized in that The improving of crop salt tolerance includes improving the growth characteristics and survival rate of crops under salt stress.
4. The use according to claim 3, characterized in that The crop is a monocotyledonous plant.
5. Use of a biomaterial overexpressing the OsNRT2-P2 nitrogen-efficient gene for improving crop salt tolerance or in salt-tolerant crop breeding, characterized in that: The nucleotide sequence of the OsNRT2-P2 nitrogen efficient gene is shown in SEQ ID NO. 1, and the biological material includes one of a recombinant expression vector containing the OsNRT2-P2 nitrogen efficient gene and a recombinant microorganism containing the OsNRT2-P2 nitrogen efficient gene.
6. The use according to claim 5, characterized in that When constructing a recombinant expression vector containing the OsNRT2-P2 nitrogen-efficient gene, the amplification primer pair for the OsNRT2-P2 nitrogen-efficient gene includes a forward primer GSP1 and a reverse primer GSP2. The nucleotide sequence of the forward primer GSP1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer GPS2 is shown in SEQ ID NO.
3.
7. The use according to claim 5, characterized in that The initial vector of the recombinant expression vector includes pCAMBIA1300-35S, and the OsNRT2-P2 nitrogen high-efficiency gene is inserted between BamHI and HindIII of pCAMBIA1300-35S.
8. The use according to claim 5, characterized in that The recombinant microorganism includes a recombinant microorganism obtained by transforming the recombinant expression vector according to claim 7 into Agrobacterium, and the Agrobacterium includes EHA105.
9. A method for improving the salt tolerance of crops, characterized in that: Overexpression of the OsNRT2-P2 nitrogen-efficient gene of claim 1 in crops.
10. A method for cultivating OsNRT2-P2 transgenic crop plants, characterized in that: The biological material overexpressing the OsNRT2-P2 nitrogen-efficient gene according to claim 4 is transformed into a target crop to obtain an OsNRT2-P2 transgenic crop plant.