Preparation method of recombinant collagen

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a preparation method of recombinant collagen. The invention provides a vector, the vector comprises: a gene for coding collagen and a gene for coding hydroxylase, the skeleton of the vector comprises: a first expression cassette, the first expression cassette comprises: EF1a-intron A; cells containing the vector can improve the expression quantity of collagen, and meanwhile, stable formation of a three-helix structure of the collagen is ensured.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and in particular relates to a method for preparing recombinant collagen. Background Art

[0002] Collagen is the most abundant protein in the human body and is one of the main components of tissue structure. Collagen is found throughout the body's tissues and organs. It is not only the main component for maintaining the morphology and structure of the skin and other tissues and organs, but also an important substance for repairing damaged tissues. Collagen has high tensile strength, biodegradability, low immunogenicity, low cytotoxicity, and acts as an organ skeleton to promote cell adhesion, proliferation, and tissue repair. This makes collagen an ideal biomedical material with a wide range of applications. It is currently widely used in medical dressings, regenerative medicine, tissue engineering, medical aesthetics, and other fields.

[0003] Currently, collagen production relies primarily on extraction from animal tissue, which inevitably carries the risk of animal viral contamination and immune rejection, limiting its widespread application in fields such as medicine, bioengineering, and aesthetics. While human collagen extracted from human tissue does not pose the risk of immune rejection, the limited availability of human tissue and the significant ethical implications further limit its application.

[0004] In recent years, the use of genetic engineering technology for recombinant synthesis and expression has become a new development direction for human collagen production. However, human collagen has the characteristics of large molecular weight and complex folding modification, which makes its expression and purification in microbial expression systems difficult. At present, the existing technology uses microbial expression systems to achieve the expression of humanized collagen containing truncated sequences, but the expressed collagen lacks a triple helical structure, resulting in its stability, biological properties and activity being far inferior to collagen extracted from animal tissues, greatly limiting its effect and industrial application. At this stage, there are no full-length recombinant human collagen raw materials or products with a triple helical structure on the market worldwide. The relevant technology research and development and product market have high technical barriers and huge market potential. Summary of the Invention

[0005] The first aspect of the present invention aims to provide a carrier.

[0006] The second aspect of the present invention aims to provide a cell.

[0007] The third aspect of the present invention aims to provide a method for constructing the cell of the second aspect of the present invention.

[0008] The fourth aspect of the present invention aims to provide a method for preparing recombinant collagen.

[0009] The fifth aspect of the present invention is to provide a recombinant collagen.

[0010] The sixth aspect of the present invention aims to provide an application of the recombinant collagen of the fifth aspect of the present invention.

[0011] The seventh aspect of the present invention aims to provide a product.

[0012] In order to achieve the above object, the technical solution adopted by the present invention is:

[0013] In a first aspect, the present invention provides a vector comprising: a gene encoding collagen and a gene encoding hydroxylase, wherein the backbone of the vector comprises: a first expression cassette comprising: EF1a-intronA.

[0014] In some embodiments, the first expression cassette is used for the expression of the gene encoding collagen and / or the gene encoding hydroxylase.

[0015] In some embodiments, the first expression cassette further comprises: bGH poly (A).

[0016] In some embodiments, the first expression cassette further comprises: a CMV promoter.

[0017] In some embodiments, the first expression cassette comprises, from the 5' end to the 3' end, a CMV promoter, EF1a-intronA, and bGHpoly(A).

[0018] In some embodiments, the gene encoding collagen and the gene encoding hydroxylase are located between EF1a-intronA and bGHpoly(A).

[0019] In some embodiments, the nucleotide sequence of EF1a-intronA comprises: SEQ ID NO: 6, or a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto and has the same function.

[0020] In some embodiments, the nucleotide sequence of the bGH poly(A) comprises: SEQ ID NO: 7, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto and having the same function.

[0021] In some embodiments, the nucleotide sequence of the CMV promoter comprises: a nucleotide sequence shown in SEQ ID NO: 5, or a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto and has the same function.

[0022] In some embodiments, the backbone of the vector further comprises: a second expression cassette.

[0023] In some embodiments, the second expression cassette is used for the expression of a selection marker (preferably a GS selection marker).

[0024] In some embodiments, the second expression cassette is in reverse tandem with the first expression cassette.

[0025] In some embodiments, the second expression cassette comprises, from 5' to 3' end, AmpR, Ori replication origin, SV40 poly(A), a gene encoding a selection marker (preferably a GS selection gene), and an SV40 promoter.

[0026] In some embodiments, the backbone of the vector comprises, from the 5' end to the 3' end, a first expression cassette and a second expression cassette.

[0027] In some embodiments, the backbone of the vector is prepared by the following method: using HindIII and BamHI to double-digest the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker)) used in Example 4 of patent CN116445542A.

[0028] In some embodiments, the collagen is full-length collagen; further, it is full-length animal collagen.

[0029] In some embodiments, the animal is a mammal; further selected from humans, cats, cows, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and further selected from humans.

[0030] In some embodiments, the collagen comprises: at least one of type I collagen, type II collagen, type III collagen, type V collagen, type XI collagen, type XXIV collagen and type XXVII collagen; further comprises: at least one of type I collagen and type III collagen; further is type I collagen or type III collagen.

[0031] In some embodiments, the collagen is full-length human type I collagen or full-length human type III collagen.

[0032] In some embodiments, the accession number of the full-length human type III collagen is P02461.

[0033] In some embodiments, the nucleotide sequence of the gene encoding full-length human type III collagen is shown as SEQ ID NO: 1.

[0034] In some embodiments, the full-length human type I collagen comprises full-length human type I collagen COL1A1 and full-length human type I collagen COL1A2.

[0035] In some embodiments, the accession number of the full-length human collagen I COL1A1 is P02452.

[0036] In some embodiments, the accession number of the full-length human collagen I COL1A2 is P08123.

[0037] In some embodiments, the nucleotide sequence of the gene encoding full-length human collagen I COL1A1 is shown as SEQ ID NO: 3.

[0038] In some embodiments, the nucleotide sequence of the gene encoding full-length human collagen I COL1A2 is shown as SEQ ID NO: 4.

[0039] The natural human full-length collagen sequence contains a large number of Gly-XY repeats, in which the X or Y position is usually proline (Pro), and the codons corresponding to glycine (Gly) are GGT / GGA / GGC / GGG, and the codons corresponding to proline (Pro) are CCT / CCA / CCC / CCG. This makes it possible to significantly increase the GC content in the DNA sequence encoding the protein during the recombinant expression of the full-length collagen, and the high GC content often leads to a decrease in the transcription level of the target gene, which makes it difficult to achieve efficient recombinant expression of human full-length collagen to a certain extent. The present application performs codon optimization according to the codon preference of Chinese hamsters, selects highly preferred codons to convert the amino acid sequence into a DNA sequence encoding the protein, and controls the GC content below 70% to solve the problem of reduced transcription level of the target gene.

[0040] In some embodiments, the hydroxylase comprises: proline hydroxylase and / or lysine hydroxylase; and further comprises proline hydroxylase.

[0041] In some embodiments, the hydroxylase is derived from an animal; further a mammal; further selected from humans, cats, cows, sheep, pigs, dogs, chickens, ducks, geese, rabbits, mice (eg, Chinese hamsters); and still further humans.

[0042] In some embodiments, the accession number of the proline hydroxylase is P13674.

[0043] In some embodiments, the nucleotide sequence of the gene encoding proline hydroxylase is shown in SEQ ID NO: 2.

[0044] In some embodiments, the gene encoding collagen and the gene encoding hydroxylase are located on the same vector, or are located on different vectors.

[0045] In some embodiments, when the collagen is full-length human type I collagen, the gene encoding full-length human type I collagen COL1A1 and the gene encoding full-length human type I collagen COL1A2 are located on the same vector or on different vectors.

[0046] In some embodiments, the vector comprises:

[0047] carrier a1 and carrier a2; or

[0048] carrier a11, carrier a12, and carrier a2;

[0049] The vector a1 contains a gene encoding full-length human type III collagen, the vector a11 contains a gene encoding full-length human type I collagen COL1A1, the vector a12 contains a gene encoding full-length human type I collagen COL1A2, and the vector a2 contains a gene encoding hydroxylase. The skeletons of the vectors a1, a11, a12 and a2 are all the skeletons of the above-mentioned vectors.

[0050] In some embodiments, the mass ratio of the carrier a1 to the carrier a2 is (0.5-5):1; further (1-4.5):1; further (3.8-4.2):1.

[0051] In some embodiments, the mass ratio of the mixture of the carrier a11 and the carrier a12 to the carrier a2 is (0.5-5):1; further (1-4.5):1; further (3.8-4.2):1.

[0052] In some embodiments, the mass ratio of the carrier a11 to the carrier a12 is (1-3):1; further (1.5-2.5):1.

[0053] In some embodiments, the 5' end of the gene encoding full-length human type III collagen further comprises a Kozak sequence.

[0054] In some embodiments, the 3' end of the gene encoding full-length human type III collagen further comprises a stop codon (TGA).

[0055] In some embodiments, the 5' end of the gene encoding full-length human collagen I COL1A1 further comprises a Kozak sequence.

[0056] In some embodiments, the 3' end of the gene encoding the full-length human collagen I COL1A1 further comprises a stop codon (TGA).

[0057] In some embodiments, the 5' end of the gene encoding full-length human collagen I COL1A2 further comprises a Kozak sequence.

[0058] In some embodiments, the 3' end of the gene encoding the full-length human collagen I COL1A2 further comprises a stop codon (TGA).

[0059] In some embodiments, the 5' end of the gene encoding the hydroxylase further comprises a Kozak sequence.

[0060] In some embodiments, the 3' end of the gene encoding the hydroxylase further comprises a stop codon (TGA).

[0061] In some embodiments, the gene encoding full-length human type III collagen and the backbone of the vector form vector a1 through restriction enzyme cutting sites HindIII and BamHI.

[0062] In some embodiments, the vector a1 is constructed as follows: a HindIII restriction enzyme site (AAGCTT) and a BamHI restriction enzyme site (GGATCC) are added to the 5' and 3' ends of the gene encoding full-length human type III collagen, respectively; the resulting gene encoding full-length human type III collagen with added restriction enzyme sites is inserted between the HindIII restriction enzyme site and the BamHI restriction enzyme site of the pUC57 plasmid to obtain pUC57-COL3A1; pUC57-COL3A1 and a pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively; the resulting COL3A1 gene digestion fragment is ligated with the pMGT vector digestion fragment (i.e., the vector backbone) to obtain vector a1.

[0063] In some embodiments, the gene encoding full-length human collagen I COL1A1 and the backbone of the vector form vector a11 through restriction enzyme cutting sites HindIII and BamHI.

[0064] In some embodiments, the vector a11 is constructed as follows: a HindIII restriction enzyme site (AAGCTT) and a BamHI restriction enzyme site (GGATCC) are added to the 5' and 3' ends of the gene encoding the full-length human I collagen COL1A1, respectively; the obtained gene encoding the full-length human I collagen COL1A1 with the added restriction enzyme sites is inserted between the HindIII restriction enzyme site and the BamHI restriction enzyme site of the pUC57 plasmid to obtain pUC57-COL1A1; pUC57-COL1A1 and a pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively; the obtained COL1A1 gene digested fragment is ligated with the pMGT vector digested fragment (i.e., the backbone of the vector) to obtain vector a11.

[0065] In some embodiments, the gene encoding full-length human collagen I COL1A2 and the backbone of the vector form vector a12 through restriction enzyme cutting sites HindIII and BamHI.

[0066] In some embodiments, the vector a12 is constructed as follows: a HindIII restriction enzyme site (AAGCTT) and a BamHI restriction enzyme site (GGATCC) are added to the 5' and 3' ends of the gene encoding the full-length human I collagen COL1A2, respectively; the resulting gene encoding the full-length human I collagen COL1A2 with the added restriction enzyme sites is inserted between the HindIII restriction enzyme site and the BamHI restriction enzyme site of the pUC57 plasmid to obtain pUC57-COL1A2; pUC57-COL1A2 and a pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively; the resulting COL1A2 gene digestion fragment is ligated with the pMGT vector digestion fragment (i.e., the backbone of the vector) to obtain vector a12.

[0067] In some embodiments, the gene encoding hydroxylase and the backbone of the vector form vector a2 through restriction enzyme cutting sites HindIII and BamHI.

[0068] In some embodiments, the vector a2 is constructed as follows: a HindIII restriction enzyme site (AAGCTT) and a BamHI restriction enzyme site (GGATCC) are added to the 5' and 3' ends of the gene encoding the hydroxylase, respectively; the resulting gene encoding the hydroxylase with the added restriction enzyme sites is inserted between the HindIII restriction enzyme site and the BamHI restriction enzyme site of the pUC57 plasmid to obtain pUC57-P4H; the pUC57-P4H and the pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively; the resulting P4H gene digestion fragment is ligated with the pMGT vector digestion fragment (i.e., the backbone of the vector) to obtain vector a2.

[0069] The second aspect of the present invention provides a cell comprising the vector of the first aspect of the present invention.

[0070] In some embodiments, the cells are not involved in propagation material.

[0071] In some embodiments, the cells are mammalian cells; further comprising at least one of hamster ovary cells (CHO cells), human embryonic kidney epithelial cells HEK293, mouse myeloma cells (NS0 cells), baby hamster kidney cells (BHK cells), and African green monkey kidney cells (Vero cells); further CHO cells; and still further CHO-K1 cells.

[0072] The third aspect of the present invention provides a method for constructing the cell of the second aspect of the present invention, wherein the vector of the first aspect of the present invention is introduced into the cell.

[0073] In some embodiments, the introduction method is transfection; further is chemical transfection.

[0074] In some embodiments, the transfection comprises transient transfection or stable transfection.

[0075] In some embodiments, the construction method comprises the following steps: mixing the carrier with PEI, mixing the obtained mixture with the cells, and culturing.

[0076] This application utilizes the highly positively charged nature of PEI (polyethyleneimine) to form a positively charged PEI complex with the expression plasmid. This complex then binds to the negatively charged cell membrane, allowing it to be internalized by the cell and transfected. Because the full-length human collagen gene sequence is longer than typical recombinant proteins, the PEI method is better suited to induce transfection of these long plasmids.

[0077] In some embodiments, the mass ratio of the carrier to PEI is 1:(1-3); further 1:(1.5-2.5).

[0078] In some embodiments, the ratio of the mixture to the cells is (1-5) μg:10 6 cells; further (2-4) μg: 10 6 cells; further (2.5-3.5) μg: 10 6 cells.

[0079] In some embodiments, the culture time is 26-74 hours; further 38-62 hours; further 48-52 hours.

[0080] In some embodiments, the culture medium (preferably CD CHO Fusion medium).

[0081] In some embodiments, the culturing further comprises the steps of pressure screening and recovery culture.

[0082] In some embodiments, the pressure screening method is as follows: in a culture medium (preferably containing MSX (final concentration preferably 20-30 μM) The cells were cultured in CD CHO Fusion medium until the cell viability recovered to above 90%.

[0083] Endogenous glutamine synthetase (GS) activity in CHO cells is low, preventing them from synthesizing sufficient glutamine to maintain normal cell growth. Therefore, additional glutamine must be added to the culture medium. Using exogenous GS screening genes in expression vectors can screen for cells that efficiently express collagen.

[0084] In some embodiments, passage is performed every 2-4 days (preferably 3 days) during the pressure selection process.

[0085] In some embodiments, the recovery culture method is as follows: in a medium not containing MSX (preferably CD CHO Fusion medium) for 2-4 days (preferably 3 days).

[0086] In some embodiments, the cells are mammalian cells; further comprising at least one of hamster ovary cells (CHO cells), human embryonic kidney epithelial cells HEK293, mouse myeloma cells (NS0 cells), baby hamster kidney cells (BHK cells), and African green monkey kidney cells (Vero cells); further CHO cells; and still further CHO-K1 cells.

[0087] The fourth aspect of the present invention provides a method for preparing recombinant collagen, which is obtained by culturing the cells of the second aspect of the present invention.

[0088] In some embodiments, the preparation method comprises the following steps: inoculating cells into a culture medium, culturing, and obtaining a culture fluid.

[0089] In some embodiments, the culture is a fed-batch culture.

[0090] Fed-Batch Culture is a cell culture process that prolongs the high-density growth and production phases of cells by supplementing nutrients in stages. Its core process is: basal culture medium is used to support cell growth in the initial stage, and then concentrated feed medium is gradually added during the culture process to replenish consumed nutrients (such as amino acids, glucose, vitamins, etc.), thereby maintaining the production cell density and extending the production time. Fed-Batch Culture is currently widely used in the large-scale production of CHO cells, with advantages such as robust process, good scalability, and controllable costs.

[0091] In some embodiments, the culture medium is a fed-batch culture medium (preferably Advanced CHO fed-batch medium).

[0092] In some embodiments, the culture time is 10-18 days; further 12-16 days; further 13-15 days.

[0093] In some embodiments, starting from the third day of culture, feeding is performed every day at a ratio of 2-4% (preferably 3%) v / v cellboost 7a + 0.2-0.4% (preferably 0.3%) v / v cellboost 7b of the culture volume until the end of the culture.

[0094] In some embodiments, when the glucose concentration is lower than 4 g / L during the culture process, the glucose is increased to 8 g / L.

[0095] In some embodiments, the method further comprises the step of removing cells and cell debris after the culturing is completed.

[0096] In some embodiments, the step of removing cells and cell debris is solid-liquid separation.

[0097] In some embodiments, the solid-liquid separation comprises centrifugation and filtration (ie, the supernatant obtained by centrifugation is filtered).

[0098] In some embodiments, the centrifugation conditions are (1200-1600)×g for (8-12) min; further (1300-1500)×g for (9-11) min.

[0099] In some embodiments, the filtration uses a 0.22 μm filter membrane.

[0100] In some embodiments, the preparation method further comprises the following step: purifying the culture fluid.

[0101] In some embodiments, the purification method is: salting-out-chromatography technology (ie, salting-out technology and chromatography technology are sequentially used to separate and purify the culture fluid).

[0102] Because full-length collagen has the characteristics such as large molecular weight, easy assembly to form collagen fibers, when the chromatography process commonly used by recombinant protein is used for purification, there is low loading capacity, high column pressure, easy precipitation in column and difficult to elute problems, resulting in its recovery efficiency is low. Meanwhile, in order to obtain highly purified collagen, it is generally necessary to carry out 2-3 step chromatography, which results in a large amount of collagen loss, and is difficult to achieve large-scale production and cost control. Traditional salting-out process can make the collagen in the solution be rapidly precipitated, but the separation accuracy is low, and further impurity removal and purification cannot be achieved. Therefore, the application combines the advantages and disadvantages of two methods, adopts a method for combining salting-out-chromatography, first by rapid enrichment of target protein and removal of most of impurities by salting-out, then in conjunction with chromatography technology for high-precision purification, so as to minimize chromatography step and loss, realize easy operation, the purification of high-purity full-length recombinant human collagen at low cost.

[0103] In some embodiments, the purification method comprises: enriching the collagen protein by salting-out technology, and purifying the enriched collagen protein by chromatography technology.

[0104] In some embodiments, the collagen is enriched using saturated salt.

[0105] In some embodiments, the salt comprises at least one of ammonium sulfate, sodium chloride, sodium sulfate, and magnesium sulfate; further comprises ammonium sulfate.

[0106] In some embodiments, the method for enriching the collagen protein using salting-out technology comprises mixing the culture medium with saturated salt, reacting, separating the solid and the liquid, and redissolving the obtained salting-out precipitate.

[0107] In some embodiments, the method for enriching the collagen using salting-out technology further comprises the following steps: mixing the obtained salting-out precipitate reconstituted solution with saturated salt, reacting, solid-liquid separation, and re-dissolving the obtained salting-out precipitate.

[0108] In some embodiments, the reconstitution is performed using water; further using water with an equal volume to the culture solution.

[0109] In some embodiments, the reaction time is 25-35 minutes.

[0110] In some embodiments, the reaction is carried out at room temperature.

[0111] In some embodiments, the solid-liquid separation method is centrifugation.

[0112] In some embodiments, the centrifugation conditions are (2000-4000)×g, centrifugation for (20-40) min; further (2500-3500)×g, centrifugation for (25-35) min.

[0113] In some embodiments, the volume of the saturated salt is 10%-40% of the culture solution or the salting-out precipitation solution; further 25-30%.

[0114] In some embodiments, the chromatography step includes the following steps: adjusting the pH of the salting-out precipitation resolution (i.e., the enriched collagen) to 7-12; further to 7-9; and further to 8.

[0115] In some embodiments, the method for adjusting the pH of the salting-out precipitation resolution solution is to perform ultrafiltration and liquid exchange using a buffer solution of the pH, preferably specifically as follows: ultrafiltration and liquid exchange are performed using a hollow fiber tube (preferably a hollow fiber tube with a pore size of 100kD) to replace the liquid to an equal volume of buffer solution of the pH (preferably 20mM PB (pH: 8.0)).

[0116] In some embodiments, the chromatography is selected from at least one of ion exchange chromatography, hydrophobic chromatography, hydrophilic chromatography, affinity chromatography, and composite chromatography; further ion exchange chromatography; and further anion exchange chromatography.

[0117] In some embodiments, the filler material of the anion exchange chromatography is Cpto Q.

[0118] In some embodiments, the steps of purifying the enriched collagen using chromatography technology are as follows: adding the pH-adjusted salting-out precipitation resolution (i.e., the enriched collagen) to a chromatography containing a filler, and then washing and eluting to obtain an eluate.

[0119] In some embodiments, before adding the pH-adjusted salting-out precipitation resolution (i.e., the enriched collagen), 10-30 mM PB (pH: 7-12) (preferably 20 mM PB (pH: 8.0)) is used to equilibrate for 4-6 (preferably 5) column volumes.

[0120] In some embodiments, the washing step is performed with a buffer, further with 10-30 mM PB (pH: 7-12) (preferably 20 mM PB (pH: 8.0)), and further with 4-6 (preferably 5) column volumes of 20 mM PB (pH: 8.0).

[0121] In some embodiments, the elution is performed using a buffer containing NaCl; further elution is performed using PB (10-30 mM, pH: 7-12) containing 0.4-0.6 M NaCl (preferably PB (20 mM, pH: 8.0) containing 0.5 M NaCl); and further elution is performed using PB (10-30 mM, pH: 7-12) containing 0.4-0.6 M NaCl (preferably PB (20 mM, pH: 8.0) containing 0.5 M NaCl) for 14-16 (preferably 15) column volumes.

[0122] In some embodiments, after elution, the eluate is selected based on SDS-PAGE purity.

[0123] In some embodiments, the preparation method further comprises the following step: performing ultrafiltration on the eluate.

[0124] In some embodiments, the method for ultrafiltration of the eluate is: ultrafiltration of the eluate using a hollow fiber tube (preferably a hollow fiber tube with a pore size of 100 kD) to replace the eluate with NaCl (preferably 0.8-1% NaCl).

[0125] The fifth aspect of the present invention provides a recombinant collagen obtained by the preparation method of the fourth aspect of the present invention.

[0126] In some embodiments, the recombinant collagen comprises triple-helical collagen.

[0127] In some embodiments, the purity of the recombinant collagen is greater than 90% (eg, 91%, 92%, 93%, 94%, 95%, or any range therebetween, such as 91%-95%).

[0128] In some embodiments, the mass fraction of the triple helical collagen in the recombinant collagen is greater than 90% (for example, it can be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any range therebetween, such as 91%-99%).

[0129] In some embodiments, the biological activity of the collagen (for example, promoting cell proliferation and / or promoting cell adhesion, i.e., the biological activity of collagen detected by the cell adhesion method and / or cell proliferation method provided by the National Pharmaceutical Industry Standard for Recombinant Collagen (YY / T 1849-2022)) is better than that of the national standard substance bovine type I collagen.

[0130] The sixth aspect of the present invention provides use of the recombinant collagen according to the fifth aspect of the present invention in preparing a product.

[0131] In some embodiments, the product is a food, a medicine, or a cosmetic.

[0132] In some embodiments, the product is a pharmaceutical carrier, a medical product, or a cosmetic product.

[0133] In some embodiments, the product has the effect of promoting cell proliferation and / or promoting cell adhesion.

[0134] In some embodiments, the cells are fibroblasts; further, dermal fibroblasts.

[0135] The seventh aspect of the present invention provides a product comprising: the recombinant collagen according to the fifth aspect of the present invention.

[0136] In some embodiments, the product is a food, a medicine, or a cosmetic.

[0137] In some embodiments, the product is a pharmaceutical carrier, a medical product, or a cosmetic product.

[0138] In some embodiments, the product has the effect of promoting cell proliferation and / or promoting cell adhesion.

[0139] In some embodiments, the cells are fibroblasts; further, dermal fibroblasts.

[0140] The beneficial effects of the present invention are:

[0141] The present invention provides a vector comprising: a gene encoding collagen and a gene encoding hydroxylase, wherein the skeleton of the vector comprises: a first expression cassette, wherein the first expression cassette comprises: EF1a-intronA; cells comprising the vector can increase the expression level of collagen while ensuring the stable formation of the collagen triple helix structure.

[0142] Furthermore, the recombinant collagen prepared by cells containing the above-mentioned vector is purified by salting-out-chromatography technology, which improves the purification efficiency and recovery rate of the collagen, solves the key technical bottlenecks in the current research and development and production of full-length recombinant human collagen, and is conducive to promoting the commercialization process of the product and realizing its wide application in the fields of medicine, cosmetics, etc.

[0143] Furthermore, the recombinant collagen prepared using cells containing the above-mentioned vector contains triple-helical collagen, and compared with full-length collagen extracted from animals (such as the national standard material bovine type I collagen), it has a higher triple-helical collagen content and biological activity (such as: promoting cell proliferation activity and / or promoting cell adhesion activity). BRIEF DESCRIPTION OF THE DRAWINGS

[0144] Figure 1 Electrophoresis of culture supernatants expressing full-length recombinant human type III collagen using different vectors is shown: Lane 1 shows empty expression using the pcDNA3.4 vector; Lane 2 shows empty expression using the pMGT vector; Lane 3 shows full-length recombinant human type III collagen expressed using the pcDNA3.4 vector; Lane 4 shows full-length recombinant human type III collagen expressed using the pMGT vector; Lane M is a protein marker. Solid arrows indicate triple-helical collagen bands (~400 kD); dashed arrows indicate monomeric collagen bands (~135 kD).

[0145] Figure 2The electrophoresis diagram of the culture supernatant of full-length recombinant human type III collagen under different P4H co-expression strategies is shown; Lane M is a protein marker; Lane 1 is the expression of full-length recombinant human type III collagen only; Lane 2 is the co-expression of pcDNA3.4-COL3A1 expression vector and pcDNA3.4-P4H expression vector at a mass ratio of 4:1; Lane 3 is the co-expression of pcDNA3.4-COL3A1 expression vector and pcDNA3.4-P4H expression vector at a mass ratio of 2:1; Lane 4 is the co-expression of pcDNA3.4-COL3A1 expression vector and pcDNA3.4-P4H expression vector at a mass ratio of 4:1. Lane 5 expresses only full-length recombinant human type III collagen; Lane 6 co-expresses pMGT-COL3A1 expression vector and pMGT-P4H expression vector at a mass ratio of 4:1; Lane 7 co-expresses pMGT-COL3A1 expression vector and pMGT-P4H expression vector at a mass ratio of 2:1; Lane 8 co-expresses pMGT-COL3A1 expression vector and pMGT-P4H expression vector at a mass ratio of 1:1; solid arrows indicate triple helical collagen bands (~400kD); dotted arrows indicate monomeric collagen bands (~135kD).

[0146] Figure 3 The electrophoresis images of the culture supernatant of full-length recombinant human type I collagen under different P4H co-expression strategies are shown: Lane M is the protein marker; Lane 1 is the expression of only full-length recombinant human type I collagen; Lane 2 is the co-expression of a mixture of pMGT-COL1A1 and pMGT-COL1A2 and the pMGT-P4H expression vector at a mass ratio of 4:1; Lane 3 is the co-expression of a mixture of pMGT-COL1A1 and pMGT-COL1A2 and the pMGT-P4H expression vector at a mass ratio of 2:1; Lane 4 is the co-expression of a mixture of pMGT-COL1A1 and pMGT-COL1A2 and the pMGT-P4H expression vector at a mass ratio of 1:1; the solid arrow indicates the triple helical structure collagen band (~400kD); the dotted arrow indicates the monomeric type I collagen band (A1 chain ~135kD, A2 chain ~127kD).

[0147] Figure 4 The electrophoresis diagram of the anionic purification of collagen is shown: lane 1 is elution peak 1; lane 2 is elution peak 2; lane 3 is elution peak 3; lane 4 is elution peak 4; lane 5 is elution peak 5; lane M is protein marker.

[0148] Figure 5 The SEC-HPLC purity test of the eluted peak 3 protein is shown: the main peak ratio is 95.42%.

[0149] Figure 6 The results of the comparison of collagen purity by SDS-PAGE of bovine type I collagen, a national standard substance, and recombinant human type III collagen prepared by this method are shown.

[0150] Figure 7 The results of circular dichroism (CD) spectroscopy identification of the triple helical structure of collagen are shown: a positive peak appears at 212.7 nm.

[0151] Figure 8 The results of detecting the biological activity of collagen by cell adhesion method are shown: A is the cell imaging under a microscope, with a scale of 200 μm; B is the statistical graph of CCK8 staining.

[0152] Figure 9 The biological activity of collagen was detected by cell proliferation assay: the PBS control group at each concentration was set as 100% and normalized.

[0153] Figure 10 A schematic diagram of the pcDNA3.4 vector is shown.

[0154] Figure 11 A schematic diagram of the pMGT vector is shown. DETAILED DESCRIPTION

[0155] definition

[0156] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0157] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0158] The present invention is further described in detail below through specific examples.

[0159] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0160] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions or those recommended by the manufacturer. Materials and reagents used in these examples were commercially available unless otherwise specified. Where the manufacturer of the reagent is indicated, similar products from other manufacturers are considered substitutes.

[0161] The quantitative tests in the following examples were performed in triplicate unless otherwise specified.

[0162] Example 1: Construction of full-length recombinant human type III collagen vector and cell pool screening

[0163]

[0164] 2) The optimized human COL3A1 and human P4H gene sequences were cloned by adding a Kozak sequence (GCCACC) and a HindIII restriction enzyme site (AAGCTT) to the 5' end, respectively (i.e., 5'→3': HindIII--Kozak--human COL3A1 / human P4H gene sequence). The termination codon TGA and a BamHI restriction enzyme site (GGATCC) were added to the 3' end, respectively (i.e., 5'→3': human COL3A1 / human P4H gene sequence--TGA--BamHI). The gene sequences were sent to GenScript for sequence synthesis and constructed into the pUC57 plasmid (GenScript, SD1176) (i.e., the synthesized genes were inserted between the HindIII and BamHI restriction enzyme sites of the pUC57 plasmid), generating the vectors pUC57-COL3A1 and pUC57-P4H.

[0165] 3) The resulting pUC57 plasmid containing the human COL3A1 and human P4H gene sequences was double-digested with HindIII and BamHI at 37°C for 1 hour. The digested products were subjected to agarose gel electrophoresis, and bands of the correct molecular weight were excised and recovered to obtain the human COL3A1 and human P4H gene fragments.

[0166] 4) The pMGT expression vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS screening marker) used in Example 4 of patent CN116445542A)) and pcDNA3.4 were double-digested with HindIII and BamHI, respectively, at 37°C for 1 hour. After the digestion products were subjected to agarose gel electrophoresis, the bands of the correct molecular weight were cut out and recovered from the gel to obtain pMGT and pcDNA3.4 vector digestion fragments: wherein, the schematic diagrams of the pcDNA3.4 vector and the pMGT vector are shown as follows: Figure 10 、 11As shown: the pcDNA3.4 vector comprises, from the 5' end to the 3' end, a first expression cassette and a second expression cassette; wherein the first expression cassette comprises, from the 5' end to the 3' end, a CMV promoter, a target gene, a WPRE element, and an HSV TK poly(A); and the second expression cassette comprises, from the 5' end to the 3' end, an SV40 promoter, a selection marker, an SV40 poly(A), an Ori replication origin, and AmpR; the pMGT vector comprises, from the 5' end to the 3' end, a first expression cassette and a second expression cassette; wherein the first expression cassette comprises, from the 5' end to the 3' end, a CMV promoter, an EF1a-intron A, a target gene, and a bGH poly(A); and the second expression cassette comprises, from the 5' end to the 3' end, an AmpR, an Ori replication origin, an SV40 poly(A), a gene encoding a selection marker, and an SV40 promoter; that is, the difference between the pMGT vector and the pcDNA3.4 vector is that: 1) in the CMV promoter (g,SEQ ID NO: 5), EF1a-intronA (ctgaaatggaagaaaa aaactttgaaccactgtctgaggcttgagaatgaaccaagatccaaactcaaaaagggcaaattccaaggagaattacatcaagtgccaagctggcctaacttcagtctccacccactcagtgtggggaaactccatcgcataaaacccctccccccaacctaaagacgacgtactccaaaagctcgagaactaatcgaggtgcctggacggcgcccggtactccgtggagtcacatgaagcgacggctgaggacggaaaggcccttttcctttgtgtgggtgactcacccgcccgctctcccgagcgccgcgtcctccattttgagctccctgcagcagggccgggaagcggccatctttccgctcacgcaactggtgccgaccgggccagccttgccgcccagggcggggcgatacacggcggcgcgaggccaggcaccagagcaggccggccagcttgagactacccccgtccgattctcggtggccgcgctcgcaggccccgcctcgccgaacatgtgcgctgggacgcacgggccccgtcgccgcccgcggccccaaaaaccgaaataccagtgtgcagatcttggcccgcatttacaagactatcttgccagaaaaaaagcgtcgcagcaggtcatcaaaaattttaaatggctagagacttatcgaaagcagcgagacaggcgcgaaggtgccaccagattcgcacgcggcggccccagcgcccaggccaggcctcaactcaagcacgaggcgaaggggctccttaagcgcaaggcctcgaactctcccacccacttccaacccgaagctcgggatcaagaatcacgtactgcagccaggggcgtggaagtaattcaaggcacgcaagggccataacccgtaaagaggccaggcccgcgggaaccacacacggcacttac, SEQ ID NO: 6),This further induced mRNA transcription and ribosome recognition and transport; 2) bGH poly(A) (ccatagagcccaccg catccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcc tcattttattaggaaaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaactagaaggcacag, SEQ ID NO: 7) was used to replace HSV TK poly(A), further enhancing mRNA stability; 3) the pMGT vector uses a dual-promoter reverse tandem design to further strengthen the expression of the target gene and selection marker, thereby enhancing genomic integration and screening efficiency.

[0167] 5) The human COL3A1 and human P4H gene fragments obtained in step 3) were mixed with the pMGT vector fragment obtained in step 4) at a mass ratio of 1:1, and the mixtures were incubated overnight at 16°C using T4 ligase to obtain vectors pMGT-COL3A1 and pMGT-P4H. Simultaneously, the human COL3A1 and human P4H gene fragments obtained in step 3) were mixed with the pcDNA3.4 vector fragment obtained in step 4) at a mass ratio of 1:1, and the mixtures were incubated overnight at 16°C using T4 ligase to obtain vectors pcDNA3.4-COL3A1 and pcDNA3.4-P4H.

[0168] 6) The three ligated expression vectors were transformed into DH5α competent cells and plated onto screening LB plates containing kanamycin. After culturing for a period of time, positive single clones were selected and identified by colony PCR using collagen-specific primers and P4H gene-specific primers.

[0169] 7) Select colonies that are positive for PCR and inoculate them into liquid LB medium containing kanamycin for amplification. Extract the expression plasmids. Disrupt the cells, extract the plasmids, and send them to a sequencing company for gene sequencing. Select expression plasmids that match the theoretical sequence (pMGT-COL3A1, pcDNA3.4-COL3A1, pMGT-P4H, pcDNA3.4-P4H).

[0170] 8) Resuscitate ECACC CHO-K1 host cells into shake tubes using CD CHO Fusion medium was used for recovery subculture, and the seeding density was 0.5×10 6 cells / mL, 10 mL per tube, culture at 37°C, 5% CO2, 180 rpm shaking, subculture every 3 days, and resume culture after 3 generations.

[0171] 9) Centrifuge the recovered CHO-K1 cells, remove the supernatant, resuspend in preheated HyCell Transfx-C medium, and adjust to 1×10 7 cells / ml, and dispense 1.5 mL into each tube.

[0172] 10) Take 15 μg of pMGT-COL3A1 and pcDNA3.4-COL3A1 expression vectors, mix them with 30 μg of PEI (2 times the mass), and then add one portion of the premixed PEI-plasmid to each tube of CHO-K1 host cell suspension obtained in step 9) and mix quickly. After incubating on a shaker for 2 hours, add 3.5 mL of CD CHO Fusion medium was added, and the cells were placed on a shaker and cultured for 2 days. After 2 days of transfection, the cells were centrifuged, the supernatant was removed, and 10 mL of 25 μM MSX (Methionine sulfoximine) was added. Perform pressure screening in CD CHO Fusion medium. Subculture every 3 days, maintaining a 25 μM MSX concentration in the medium, until cell viability recovers to above 90%. Subculture cells into CD CHO fusion medium without MSX for one passage and then freeze.

[0173] 11) Take the pMGT-COL3A1 expression vector and the pMGT-P4H expression vector, and mix them in a ratio of 4:1 (12μg pMGT-COL3A1 + 3μg pMGT-P4H), 2:1 (10μg + 5μg), and 1:1 (7.5μg + 7.5μg), respectively. Then mix them with 30μg PEI (2 times the mass) respectively. Then, add one portion of the premixed PEI-plasmid to each tube of CHO-K1 host cell suspension obtained in step 9), mix quickly, and incubate on a shaker for 2 hours. Then add 3.5mL CD CHO Fusion medium was added, and the cells were placed on a shaker and cultured for 2 days. After 2 days of transfection, the cells were centrifuged, the supernatant was removed, and 10 mL of 25 μM MSX (Methionine sulfoximine) was added. Perform pressure screening in CD CHO Fusion medium. Subculture every 3 days, maintaining a 25 μM MSX concentration in the medium, until cell viability recovers to above 90%. Subculture cells into CD CHO fusion medium without MSX for one passage and then freeze.

[0174] 12) Take the pcDNA3.4-COL3A1 expression vector and the pcDNA3.4-P4H expression vector, and mix them in a ratio of 4:1 (12 μg pcDNA3.4-COL3A1 + 3 μg pcDNA3.4-P4H), 2:1 (10 μg + 5 μg), and 1:1 (7.5 μg + 7.5 μg), respectively. Then mix them with 30 μg PEI (2 times the mass) and add one portion of the premixed PEI-plasmid to each tube of CHO-K1 host cell suspension obtained in step 9), mix them quickly, and add 3.5 mL of PEI after incubation on a shaker for 2 hours. CDCHO Fusion medium was added, and the cells were placed on a shaker and cultured for 2 days. After 2 days of transfection, the cells were centrifuged, the supernatant was removed, and 10 mL of 25 μM MSX (Methionine sulfoximine) was added. Perform pressure screening in CD CHO Fusion medium. Subculture every 3 days, maintaining a 25 μM MSX concentration in the medium, until cell viability recovers to above 90%. Subculture cells into CD CHO fusion medium without MSX for one passage and then freeze.

[0175] Example 2: Construction of full-length recombinant human type I collagen vector and cell pool screening

[0176]

[0177] 2) The optimized human COL1A1 and COL1A2 gene sequences were cloned by adding a Kozak sequence (GCCACC) and a HindIII restriction enzyme site (AAGCTT) to the 5' end (i.e., 5'→3', HindIII--Kozak--human COL1A1 / COL1A2 gene sequence). The termination codon TGA and a BamHI restriction enzyme site (GGATCC) were added to the 3' end (i.e., 5'→3', human COL1A1 / COL1A2 gene sequence--TGA--BamHI). The gene sequences were sent to GenScript for sequence synthesis and constructed into the pUC57 plasmid (GenScript, SD1176) (i.e., the synthesized genes were inserted between the HindIII and BamHI restriction enzyme sites of the pUC57 plasmid), generating the vectors pUC57-COL1A1 and pUC57-COL1A2.

[0178] 3) The resulting pUC57 plasmid carrying the human COL1A1 and COL1A2 gene sequences was double-digested with HindIII and BamHI at 37°C for 1 hour. The digested products were subjected to agarose gel electrophoresis, and bands of the correct molecular weight were excised and recovered to obtain the human COL1A1 and COL1A2 gene fragments.

[0179] 4) The pMGT expression vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A)) was double-digested with HindIII and BamHI at 37°C for 1 hour. The digested product was subjected to agarose gel electrophoresis, and the band of the correct molecular weight was excised and recovered from the gel to obtain the pMGT vector digested fragment.

[0180] 5) The human COL1A1 and COL1A2 gene fragments obtained in step 3) were mixed with the pMGT vector fragment obtained in step 4) at a mass ratio of 1:1, and ligated using T4 ligase and incubated overnight at 16°C to obtain vectors pMGT-COL1A1 and pMGT-COL1A2.

[0181] 6) The two ligated expression vectors were transformed into DH5α competent cells and plated onto screening LB plates containing kanamycin. After culturing for a period of time, positive single clones were selected and identified by colony PCR using collagen-specific primers and P4H gene-specific primers.

[0182] 7) Select colonies that are positive for PCR and inoculate them into liquid LB medium containing kanamycin for amplification. Extract the expression plasmid. Disrupt the cells, extract the plasmid, and send it to a sequencing company for gene sequencing. Select expression plasmids (pMGT-COL1A1 and pMGT-COL1A2) that match the theoretical sequence.

[0183] 8) Resuscitate ECACC CHO-K1 host cells into shake tubes using CD CHO Fusion medium was used for recovery subculture, and the seeding density was 0.5×10 6 cells / mL, 10 mL per tube, culture at 37°C, 5% CO2, 180 rpm shaking, subculture every 3 days, and resume culture after 3 generations.

[0184] 9) Centrifuge the recovered CHO-K1 cells, remove the supernatant, resuspend in preheated HyCell Transfx-C medium, and adjust to 1×10 7 9) Prepare a mixture of pMGT-COL1A1 and pMGT-COL1A2 at a mass ratio of 2:1, and then mix them with pMGT-P4H in Example 1 at a ratio of 4:1 (12 μg mixture + 3 μg pMGT-P4H), 2:1 (10 μg + 5 μg), and 1:1 (7.5 μg + 7.5 μg), respectively. Then mix them with 30 μg PEI of twice the mass, and add a portion of premixed PEI-plasmid to each tube of CHO-K1 host cell suspension, mix quickly, and add 3.5 mL of the mixture after culturing on a shaker for 2 hours. CD CHO Fusion medium was added, and the cells were cultured on a shaker for 2 days.

[0185] 10) Take the cells after 2 days of transfection, centrifuge, remove the supernatant, and add 10 mL of 25 μM MSX (methioninesulfoximine) CD CHO Fusion medium for pressure screening.

[0186] 11) Subculture every 3 days, maintaining a 25 μM MSX concentration in the culture medium, until cell viability recovers to above 90%. Subculture cells into CD CHO fusion medium without MSX for one passage and then freeze.

[0187] Example 3: Fermentation culture of CHO cell pools expressing full-length recombinant human type III and type I collagen

[0188] 1) The frozen CHO cell pools expressing full-length recombinant human type III and type I collagen obtained in steps 10) and 11) of Example 1 and step 11) of Example 2 were taken and revived in a 37°C water bath. The revived cells were inoculated into The cells were recovered for three passages in CD CHO fusion medium.

[0189] 2) Adjust the cell density to 0.5×10 6 / mL, inoculated into 5L shake flask, culture volume was 2L, use Advanced CHO Fed-batch medium, cells are cultured in a shaker in fed-batch format.

[0190] 3) Starting on day 3 after inoculation, feed the culture medium daily at a ratio of 3% v / v CellBoost 7a + 0.3% v / v CellBoost 7b until the end of the culture. Simultaneously monitor the glucose concentration in the culture medium and supplement with glucose. If the glucose concentration falls below 4 g / L, increase the glucose to 8 g / L.

[0191] 4) Changes in cell viability and cell number were monitored daily. When the fed-batch culture reached 14 days, the culture was terminated and the cell suspension was harvested by centrifugation at 1400 × g for 10 min. The supernatant was collected, filtered through a 0.22 μm filter, and stored in a −20°C freezer.

[0192] Example 4: Expression evaluation of recombinant full-length human type III collagen using different expression vectors

[0193] 1) Take the supernatant of the cell pool obtained in Example 3 (i.e., step 10) and the cell supernatant obtained in step 12) of Example 1) expressing full-length recombinant human type III collagen using different expression vectors pcDNA3.4 and pMGT, add non-reducing 4×LDS Loading Buffer, and heat at 65°C for 10 minutes.

[0194] 2) Load 2 μg of protein per well onto a 12% polyacrylamide gel and run electrophoresis at 140 V for 50 minutes.

[0195] 3) After electrophoresis, the gel was stained with Coomassie Brilliant Blue. The staining results were as follows: Figure 1 、 2 As shown in the figure: From the results of detecting the effects of different vectors on the expression of full-length recombinant human type III collagen, it can be seen that compared with the commonly used expression vector pcDNA3.4, the use of the pMGT high-efficiency expression vector can significantly improve the expression of full-length recombinant human type III collagen.

[0196] Example 5: Evaluation of the effects of different P4H co-expression strategies on the expression of recombinant full-length human type III and type I collagen

[0197] 1) Supernatant from each cell pool expressing full-length recombinant human type III and type I collagen using different P4H co-expression strategies (cells obtained in step 11 of Examples 1 and 2) obtained in Example 3 was added to non-reducing 4×LDS Loading Buffer and heated at 65° C. for 10 minutes.

[0198] 2) Load 2 μg of protein per well onto a 12% polyacrylamide gel and run electrophoresis at 140 V for 50 minutes.

[0199] 3) After electrophoresis, the gel was stained with Coomassie Brilliant Blue to determine the expression of full-length recombinant human collagen III. Figure 2 As shown in Figure 2, the expression of full-length recombinant human collagen I is as follows: Figure 3 As shown in the results of testing the effects of different P4H co-expression strategies on the expression of full-length recombinant human type III and type I collagen, the addition of PH4 to collagen for co-expression significantly increased the expression ratio of triple-helical collagen, and this ratio also increased with increasing PH4 ratio, but the overall expression level decreased. Considering the triple-helical ratio and expression level, a 4:1 mass ratio of full-length collagen expression vector to P4H expression vector was selected as the optimal ratio.

[0200] Example 6: Purification of recombinant full-length human type III collagen

[0201] 1) The frozen culture supernatant obtained in Example 3 (the culture supernatant of cells obtained when the mass ratio of the pMGT-COL3A1 expression vector to the pMGT-P4H expression vector in step 11 of Example 1 was 4:1) was thawed at room temperature. 30% saturated ammonium sulfate was added to the thawed supernatant by volume, and precipitation was carried out at room temperature for 30 minutes.

[0202] 2) Centrifuge at 3000×g for 30 min to harvest the salting-out precipitate, redissolve the precipitate with a volume of pure water equal to that of the supernatant, then add 25% saturated ammonium sulfate by volume and precipitate at room temperature for 30 minutes.

[0203] 3) Centrifuge at 3000 × g for 30 min to harvest the salting-out precipitate, reconstitute the precipitate with an equal volume of pure water to the supernatant, and filter through a 0.45 μm filter membrane.

[0204] 4) Use a 100 kD pore-size hollow fiber tube to replace the collagen solution with an equal volume of 20 mM Pyrrolidone (pH 8.0). The replacement is completed after 7 volumes of the target solution have passed through the tube.

[0205] 5) Take a Capto Q anion prepacked column with a column volume of 4.7 mL and equilibrate it with 20 mM PB for 5 column volumes.

[0206] 6) Load the replaced protein solution onto the chromatography column, and then load 5 column volumes of 20 mM PB (pH: 8.0) for washing.

[0207] 7) Perform linear elution for 15 column volumes using a buffer containing 0.5 M NaCl and 20 mM PB (pH 8.0). Collect the fractions during the elution process and identify them by SDS-PAGE. Figure 4 The results of collagen purification were detected by SDS-PAGE.

[0208] 8) Based on the SDS-PAGE purity, the eluted peak 3 was finally selected as the purified collagen, and the eluted collagen was once again exchanged with 0.9% NaCl using a 100 kD pore size hollow fiber tube. The sample was taken for SEC-HPLC purity identification. The HPLC purity of the full-length recombinant human type III collagen prepared by this method can reach more than 95%, wherein Figure 5 The purity identification results are obtained by SEC-HPLC.

[0209] Example 7: Purity Assay of Recombinant Full-Length Human Type III Collagen

[0210] 1) Take the national standard substance bovine type I collagen reference substance (China Food and Drug Inspection Institute, 380008) and the recombinant human type III collagen prepared by this method (i.e., the collagen obtained in step 8 of Example 6), add 4×LDS loading buffer, and denature at 65°C for 10 minutes.

[0211] 2) Load 2 μg of protein per well onto a 12% polyacrylamide gel and run electrophoresis at 140 V for 50 minutes.

[0212] 3) After electrophoresis, the gel was stained with Coomassie Brilliant Blue. The staining results were as follows: Figure 6 As shown in the figure, the full-length recombinant human type III collagen prepared by this method has a higher proportion of high-molecular-weight advanced structural collagen than the national standard substance bovine type I collagen reference substance, and the proportion is close to 100%.

[0213] Example 8: Identification of the triple helical structure of recombinant full-length human type III collagen by circular dichroism (CD)

[0214] 1) According to the method for identifying the triple helical structure of recombinant collagen provided in the National Pharmaceutical Industry Standard for Recombinant Collagen (YY / T 1849-2022), the triple helical structure of the full-length recombinant human type III collagen prepared by this method (i.e., the collagen obtained in step 8 of Example 6) can be identified by circular dichroism (CD).

[0215] 2) Dilute the collagen solution to 0.2mg / ml with 20mM PB. Use a 1mm cuvette. The blank control is 20mM PB. The test results are as follows: Figure 7 As shown: the full-length recombinant human type III collagen prepared by this method has a significant positive absorption peak at 221nm and a negative absorption peak at 198nm, confirming that it has a triple helical structure.

[0216] Example 9: Detection of collagen biological activity by cell adhesion assay

[0217] 1) According to the method provided in the National Pharmaceutical Industry Standard for Recombinant Collagen (YY / T 1849-2022), the biological activity of the full-length recombinant human type III collagen prepared by this method can be detected by cell adhesion assay.

[0218] 2) Recombinant human type III collagen prepared by this method (i.e., the collagen obtained in step 8 of Example 6) and the national standard substance bovine type I collagen were taken as reference substances. PBS was added to dilute the collagen solution to 0.25 mg / mL, and 100 μL was added to each well of a 96-well flat-bottom plate. PBS was used as a negative control and incubated at 37°C overnight.

[0219] 3) Digest human skin fibroblast HSF cells, resuspend in serum-free DMEM medium, and adjust the cell density to 3×10 6 / mL, and 100 μL of each well was added to each well, so that each well finally contained 100,000 or 300,000 HSF cells, and incubated at 37°C for 2 hours.

[0220] 4) Aspirate and discard the supernatant from each well, add PBS to wash twice, and finally add 200 μL of serum-free DMEM medium to each well.

[0221] 5) Perform cell imaging under a microscope on each experimental well, then add 50 μL of CCK8 staining solution to each well, incubate at 37°C for 2 hours, and read the absorbance value at OD450 on a microplate reader. The activity results are as follows: Figure 8 As shown in the results, the recombinant human type III collagen prepared by this method has better biological activity than the national standard substance bovine type I collagen reference substance.

[0222] Example 10: Detection of collagen biological activity by cell proliferation assay

[0223] 1) According to the method provided in the National Pharmaceutical Industry Standard for Recombinant Collagen (YY / T 1849-2022), the biological activity of the full-length recombinant human type III collagen prepared by this method can be detected by cell proliferation assay.

[0224] 2) Recombinant human type III collagen prepared by this method (i.e., the collagen obtained in step 8 of Example 6) and the national standard substance bovine type I collagen were used as control substances. The drugs were diluted to 0.1 mg / mL with serum-free DMEM medium, and 100 μL / well was added to a 96-well plate. At the same time, a PBS blank control group was set up and incubated at 37°C overnight.

[0225] 3) Digest human skin fibroblast HSF cells, resuspend in serum-free DMEM medium, and adjust the cell density to 5×10 4 / mL, added into each well at a volume of 100 μL per well, and incubated at 37°C for 48 hours.

[0226] 4) After the incubation period, add 20 μL of CCK8 staining solution to each well and incubate at 37°C for 2 hours. Read the absorbance value at OD450 using a microplate reader. The activity results are as follows: Figure 9 As shown in the results, the recombinant human type III collagen prepared by this method has better biological activity than the national standard substance bovine type I collagen reference substance.

[0227] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A vector comprising: a gene encoding collagen and a gene encoding hydroxylase, wherein the backbone of the vector comprises: a first expression cassette, wherein the first expression cassette comprises: EF1a-intronA.

2. The carrier according to claim 1, characterized in that The first expression cassette is used for the expression of the gene encoding collagen and the gene encoding hydroxylase; Preferably, the first expression cassette further comprises: bGHpoly(A); Preferably, the first expression cassette further comprises: a CMV promoter; Preferably, the backbone of the vector further comprises: a second expression cassette; Preferably, the second expression cassette is used for expression of a selection marker; Preferably, the second expression cassette is connected in reverse tandem with the first expression cassette; Preferably, the collagen is full-length collagen; further, it is full-length animal collagen; Preferably, the collagen comprises: at least one of type I collagen, type II collagen, type III collagen, type V collagen, type XI collagen, type XXIV collagen and type XXVII collagen; further comprises: at least one of type I collagen and type III collagen; Preferably, the collagen is full-length human type I collagen or full-length human type III collagen; Preferably, the full-length human type I collagen comprises full-length human type I collagen COL1A1 and full-length human type I collagen COL1A2; Preferably, the hydroxylase comprises: proline hydroxylase and / or lysine hydroxylase; further comprises proline hydroxylase.

3. The carrier according to any one of claims 1 to 2, characterized in that The gene encoding collagen and the gene encoding hydroxylase are located on the same vector or on different vectors; Preferably, when the collagen is full-length human type I collagen, the gene encoding full-length human type I collagen COL1A1 and the gene encoding full-length human type I collagen COL1A2 are located on the same vector, or are located on different vectors; Preferably, the vector comprises: carrier a1 and carrier a2; or carrier a11, carrier a12, and carrier a2; The vector a1 comprises a gene encoding full-length human type III collagen, the vector a11 comprises a gene encoding full-length human type I collagen COL1A1, the vector a12 comprises a gene encoding full-length human type I collagen COL1A2, and the vector a2 comprises a gene encoding a hydroxylase. The backbones of the vectors a1, a11, a12, and a2 are all the backbones of the vectors according to any one of claims 1 to 2. Preferably, the mass ratio of the carrier a1 to the carrier a2 is (0.5-5):1; Preferably, the mass ratio of the mixture of the carrier a11 and the carrier a12 to the carrier a2 is (0.5-5):1; Preferably, the nucleotide sequence of the gene encoding full-length human type III collagen is shown in SEQ ID NO: 1; Preferably, the nucleotide sequence of the gene encoding full-length human collagen I COL1A1 is shown in SEQ ID NO: 3; Preferably, the nucleotide sequence of the gene encoding full-length human collagen I COL1A2 is shown in SEQ ID NO: 4; Preferably, the nucleotide sequence of the gene encoding hydroxylase is shown in SEQ ID NO:

2. A cell comprising the vector according to any one of claims 1 to 3.

5. The cell according to claim 4, characterized in that The cells are mammalian cells; further comprising at least one of hamster ovary cells (CHO cells), human embryonic kidney epithelial cells HEK293, mouse myeloma cells (NS0 cells), baby hamster kidney cells (BHK cells), and African green monkey kidney cells (Vero cells); and furthermore, CHO cells.

6. A method for constructing the cell according to any one of claims 4 to 5, comprising introducing the vector according to any one of claims 1 to 3 into the cell.

7. The construction method according to claim 6, characterized in that: The method of introduction is transfection; further chemical transfection; Preferably, the transfection comprises transient transfection or stable transfection.

8. A method for preparing recombinant collagen, which is obtained by culturing the cell according to any one of claims 4-5.

9. The preparation method according to claim 8, characterized in that The preparation method comprises the following steps: inoculating cells into a culture medium, culturing, and obtaining a culture solution; Preferably, the culture is a fed-batch culture.

10. The preparation method according to claim 9, characterized in that The preparation method further comprises the following steps: purifying the culture fluid; Preferably, the purification method is: sequentially using salting-out technology and chromatography technology to separate and purify the culture fluid; Preferably, the purification method is: using salting-out technology to enrich the collagen, and using chromatography technology to purify the enriched collagen; Preferably, the collagen is enriched using saturated salt; Preferably, the salt comprises at least one of ammonium sulfate, sodium chloride, sodium sulfate, and magnesium sulfate; Preferably, the chromatography is selected from at least one of ion exchange chromatography, hydrophobic chromatography, hydrophilic chromatography, affinity chromatography, and composite chromatography; further ion exchange chromatography; and further anion exchange chromatography; Preferably, the filler of the anion exchange chromatography is Cpto Q.

11. A recombinant collagen obtained by the preparation method according to any one of claims 8 to 10.

12. The recombinant collagen according to claim 11, characterized in that The recombinant collagen comprises triple helical structure collagen; Preferably, the mass fraction of the triple helical collagen in the recombinant collagen is greater than 90%.

13. Use of the recombinant collagen according to any one of claims 11 to 12 in preparing products.

14. A product comprising: the recombinant collagen according to any one of claims 11-12.

15. The use according to claim 13 or the product according to claim 14, characterized in that The product is a food, medicine, or cosmetic; or The product is a drug carrier, a medical product, or a cosmetic product; or The product has the effects of promoting cell proliferation and / or promoting cell adhesion.

Images