Method for efficiently constructing pig blastocysts by using pig totipotent stem cells

By overexpressing the LEUTX gene in pig embryonic stem cells, the problem of low efficiency in construction of pig blastocyst model was solved, and a rapid and efficient pig embryonic development research model was achieved, which improved the efficiency of cell differentiation and lineage differentiation research.

CN120442714APending Publication Date: 2025-08-08HUAZHONG AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510587235.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

In the prior art, the differentiation efficiency and chimeric ability of pluripotent stem cells are insufficient, making it difficult to construct an efficient pig blastocyst model, which limits the progress of early embryo development research in mammals.

Method used

By overexpressing the LEUTX gene in pig extended potential stem cells, the LEUTX overexpression plasmid was constructed, and pig embryonic stem cells were transfected using electroporation technology to induce iTSC and blastoid blastoid experiments, the efficient construction of pig porporous stem cells was achieved.

Benefits of technology

The induction efficiency of pig blastocysts is improved, and a rapid and efficient pig embryo development research model is provided for studying cell fate decisions and cell lineage differentiation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442714A_ABST
    Figure CN120442714A_ABST
Patent Text Reader

Abstract

The invention discloses a method for efficiently constructing a pig blastocyst by using pig totipotent stem cells, and belongs to the technical field of in-vitro culture of cell tissues. The invention discloses a method for efficiently constructing pig blastocysts by using pig totipotent stem cells. The method comprises the following steps: constructing LEUTX overexpressed plasmids; the LEUTX overexpressed porcine embryonic stem cells are obtained; experiments of inducing trophoblast cells (iTSC) and blastocyst-like embryos prove that the embryonic stem cells have totipotency; the totipotent stem cells are cultured in a 4FXY culture medium and a blastocyst-like induction culture medium. The invention provides a method for rapidly and efficiently inducing the pig totipotent stem cells and preparing the blastocyst-like embryos on the basis of the pig totipotent stem cells, and a simple, convenient and effective biological model is provided for researching the development of early embryos of pigs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of in vitro culture of cell tissues, and more particularly to a method for efficiently constructing pig blastocyst-like embryos using pig totipotent stem cells. Background Art

[0002] In recent years, pigs, as an important biomedical model, have demonstrated unique scientific research value in areas such as organ transplantation and disease model construction. Among them, porcine embryonic stem cells, with their self-renewal ability and multidirectional differentiation potential, have significant advantages in application scenarios such as genetic breeding, artificial meat production, and xenotransplantation. By constructing embryonic models such as blastocysts or embryoid bodies (EBs) derived from pluripotent stem cells (PSCs), researchers can systematically study the cell fate determination mechanism, cell lineage differentiation rules, and their impact on the overall developmental process during embryonic development in vitro.

[0003] Although expanded potential stem cells (EPSCs) have been successfully established in pigs, these cells have the bidirectional potential to differentiate into embryonic and extraembryonic tissues, but their actual differentiation efficiency and chimerism are still limited. It is worth noting that these cells continue to highly express pluripotency marker genes such as POU5F1, NANOG and SOX2, while the expression levels of totipotency-related genes are significantly insufficient, which seriously restricts their application in the study of early mammalian embryonic development. Although functional blastocyst-like models have been successfully constructed using embryonic stem cells in mouse, human and primate studies, and the mouse field has made breakthrough progress by using in vitro induced totipotent stem cells to efficiently generate blastocyst-like models and complete the analysis of the mechanism of embryo implantation, pig model research is still lagging behind. Although the current research on porcine pluripotent stem cells has achieved the induction of blastocyst-like structures within 7 days through a dual culture medium system, there is still a significant gap with rodent models in key dimensions such as model construction efficiency, developmental integrity and embryo-maternal interaction research.

[0004] Given this, the current research field urgently needs to overcome two key technical bottlenecks: first, establishing a new method system for rapidly obtaining porcine totipotent stem cells with excellent differentiation potential; second, developing a standardized protocol for efficiently inducing the generation of porcine blastocysts from these cells. By establishing this high-quality in vitro model to replace natural porcine embryos, it will strongly promote in-depth research on the mechanisms of early mammalian embryonic development and provide important technical support for basic research and clinical applications in related fields.

[0005] Therefore, providing a method for efficiently constructing porcine blastocysts using porcine totipotent stem cells is an urgent problem that needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a method for efficiently constructing porcine blastocyst-like cells using porcine totipotent stem cells.

[0007] The present invention provides a method for obtaining porcine totipotent stem cells. By overexpressing the LEUTX gene in porcine expanded potential stem cells, the porcine expanded potential stem cells are made totipotent. The totipotency of the stem cells is demonstrated by inducing iTSCs and blastocyst-like experiments, thereby facilitating better advancement of research on early embryonic development in mammals.

[0008] Another object of the present invention is to provide a method for rapidly and efficiently constructing porcine blastocysts in vitro based on porcine totipotent stem cells, which can be used as a high-quality model to replace porcine embryos to study cell fate determination and cell lineage differentiation during early mammalian embryonic development.

[0009] In order to achieve the above object, the present invention adopts the following technical solutions:

[0010] A method for obtaining porcine totipotent stem cells comprises the following steps:

[0011] (1) Constructing a plasmid for overexpressing the LEUTX gene; the LEUTX gene sequence is shown in SEQ ID NO. 1;

[0012] (2) Plasmids overexpressing the LEUTX gene were transfected into pEPSCs using electroporation technology to obtain a porcine expanded potential stem cell line overexpressing the LEUTX gene;

[0013] (3) Using induced iTSC and blastocyst-like experiments, it was determined that pig expanded potential stem cells overexpressing the LEUTX gene are pluripotent.

[0014] Furthermore, a method for efficiently constructing porcine blastocyst-like cells using porcine totipotent stem cells comprises the following steps:

[0015] 1) Preparing a porcine expanded potential stem cell line overexpressing the LEUTX gene according to the above method;

[0016] 2) The porcine extended potential stem cell line overexpressing the LEUTX gene was digested into single cells using TrypLE digestive enzyme, resuspended in 4FXY medium, and seeded into ultra-low attachment 6-well plates. Cell aggregates were pre-induced for 1-2 days.

[0017] 3) On day 3 of induction, when the aggregates reach a diameter of 50-100 μm, switch to blastocyst-like induction medium and continue culturing for 3-5 days to simulate the embryonic coelomic process;

[0018] 4) At the end of differentiation, blastocysts with a diameter of 200-300 μm and symmetrical morphology were screened under a stereomicroscope and manually isolated and collected using a mouth pipette.

[0019] It can be seen from the above technical solutions that, compared with the prior art, the present invention provides a method for efficiently constructing porcine blastocysts using porcine totipotent stem cells, which has the following beneficial effects:

[0020] (1) A method for obtaining porcine totipotent stem cells by overexpressing the LEUTX gene, which has the characteristics of porcine totipotent cells and the ability to differentiate into the three lineages of blastocysts, and based on this, a method for constructing blastocyst-like cells is provided.

[0021] (2) A new method for constructing porcine blastocyst-like cells is provided, which uses the above-mentioned rapidly induced porcine totipotent stem cells as the starting cells, greatly improving the induction efficiency of blastocyst-like cells.

[0022] (3) The blastocyst-like cells derived from rapidly induced totipotent stem cells are used as a high-quality model to replace pig embryos, providing assistance for studying cell fate determination, cell lineage differentiation and its impact on the developmental process during embryonic development. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0024] Figure 1 This is the map of the piggybac-TRE6H-LEUTX-HygroB vector of the present invention;

[0025] Figure 2 The expression levels of LEUTX in LEUTX OE pEPSCs and wild-type pEPSCs were quantitatively detected by qRT-PCR.

[0026] Figure 3 This is the morphology of long-term cultured cells overexpressing LEUTX in the present invention. The scale bar is 100 μm.

[0027] Figure 4 The morphological changes of LEUTX-overexpressing cells after Dox withdrawal in the present invention are shown. The scale bar is 100 μm.

[0028] Figure 5 The expression differences of genes related to pluripotency and differentiation between wild-type and LEUTX-overexpressing pEPSCs of the present invention are shown;

[0029] Figure 6The figure shows the dynamic changes in cell morphology of iTSCs induced before and after LEUTX overexpression. The iTSCs in this figure refer to cells on the 12th day of induction. The scale bar is 100 μm.

[0030] Figure 7 This is the effect of LEUTX overexpression on the temporal activation of TSC marker genes in iTSCs of the present invention;

[0031] Figure 8 This is a schematic diagram of the blastocyst-like induction system of the present invention;

[0032] Figure 9 The figure shows the temporal morphological changes of blastocysts before and after LEUTX overexpression in the present invention. The scale bar is 100 μm.

[0033] Figure 10 The in vitro induction efficiency of blastocysts before and after overexpression of LEUTX in the present invention;

[0034] Figure 11 The developmental morphology of the D5 / D6 blastocyst-like embryos induced by LEUTX in the present invention matches that of the E6.5 / E7.5 IVF blastocysts. The scale bar is 100 μm.

[0035] Figure 12 Comparison of morphological parameters between D5 blastocysts and E6.5 IVF blastocysts of the present invention (x / y axis ratio, area, and cell number; n=24);

[0036] Figure 13 The figure shows the three germ layers of blastocysts formed by LEUTX in the iBlastoid system of the present invention. The scale bar is 100 μm. DETAILED DESCRIPTION

[0037] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0038] piggybac-TRE6H-EOMES-HygroB plasmid, pBase plasmid see Tian Xu, Peng Su, Linhui Wu, OCT4 regulates WNT / β-catenin signaling and prevents mesoendodermdifferentiation by repressing EOMES in porcine pluripotent stem cells; Cellular Physiology.

[0039] Example 1 Construction of a porcine expanded potential stem cell line overexpressing LEUTX

[0040] 1) Preparation of STO feeder cells

[0041] The STO cell line is a mouse fibroblast cell line that can proliferate indefinitely and is often used to prepare feeder cells treated with mitomycin C to maintain stem cells in an undifferentiated state. To culture and freeze the STO cell line, first add 3 ml of 0.1% gelatin to a 100 mm cell culture dish to evenly cover the culture surface (using the extracellular matrix components contained in gelatin to promote cell adhesion), and then treat it in a 37 ° C incubator for more than 1 hour. Then, discard the excess gelatin. The retained gelatin layer will provide an ideal adhesion base for subsequent cell inoculation. Then, resuscitate the STO cells and inoculate 2×10 cells per large dish (100 mm). 5 cells, and add 9 ml of D10 culture medium to each dish. These cells were cultured under the conditions of 5% CO2, 37°C and saturated humidity. After 3 days, when the cell confluence reached more than 90%, the cells were treated with mitomycin C at a final concentration of 1 μg / mL for 12 hours to stop cell proliferation. After treatment, the culture medium was removed, and each large dish (100 mm) was washed once with 3 ml of DPBS, followed by adding 3 ml of 0.05% trypsin and digesting in a 37°C incubator for 3 minutes. The digestion was terminated with an equal volume of D10 culture medium. The cells were then collected into a 50 ml centrifuge tube, centrifuged at 1000 rpm for 3-5 minutes, the supernatant was discarded, and the cells were resuspended with an appropriate amount of D10 culture medium. This step was repeated twice. Next, resuspend the cells in 10 ml of D10 culture medium and count the cells. After centrifugation, resuspend the cell pellet in somatic cell freezing medium (50% FBS + 40% D10 culture medium + 10% DMSO) and aliquot into cryovials according to the appropriate cell number. Finally, cryopreserve the cells using a gradient cooling method. The specific steps are to first cool the cryovials at -20°C for 30 min-2 h, then place the cryovials in a cryopreservation box at a controlled cooling rate of -1 to -2°C / min, store at -80°C overnight, and transfer them to a liquid nitrogen tank for long-term storage the next day.

[0042] The specific configuration system of D10 culture medium is: basic culture medium high glucose DMEM (Thermo Fisher Scientific, C11965500BT), supplemented with 10% fetal bovine serum (FBS), 1% GlutaMAX, and 1% Pen-Strep.

[0043] 2) Passaging and cryopreservation of porcine expanded potential stem cell lines (pEPSCs)

[0044] After pEPSCs cultured in a 35 mm dish reached a certain degree of confluence, the original culture medium was discarded and the residual culture medium was washed away with 1 mL of DPBS. 750 μL of 0.05% trypsin was added and digested in a 37°C incubator for 3 minutes. The digestion was terminated with an equal volume of D10 culture medium. Centrifugation was performed at 1000 rpm for 3 minutes at room temperature. The supernatant was discarded and the cell pellet was resuspended in 1.5 mL of pEPSC culture medium and inoculated onto a mitomycin C-treated STO feeder layer of cells (cell number approximately 5 × 10 5 -8×10 5 ) and added with 5% FBS and 5 μM Y27632. The final number of pEPSCs in each dish (35 mm) was about 1×10 5 After 24 hours, replace the culture medium with normal pEPSC culture medium. Remember to change the medium daily. After 3 days, the cells can be passaged or frozen. Cryopreservation methods are the same as for feeder cells, using pEPSC freezing medium (90% FBS + 10% DMSO).

[0045] The specific configuration system of pEPSCs culture medium is: basic culture medium KnockOut TM DMEM (Thermo Fisher Scientific, 10829018) was supplemented with 1% NEAA, 1% GlutaMAX, 1% Pen-Strep, 0.5% N2 (Therom Fisher Scientific, 17502048), 1% B27, 65 μg / ml Vc, and 0.1% mycoplasma antibiotic Primocin. TM , 20 ng / ml Activin A, 0.2 μM CHIR99021, 10 ng / ml hLIF, 0.3% fetal bovine serum (FBS), 0.1 mM β-mercaptoethanol, 0.15 μM WH-4-023 and 2.5 μM XAV939.

[0046] 3) Construction of LEUTX overexpression vector plasmid

[0047] Construction of LEUTX inducible expression plasmid piggybac-TRE6H-LEUTX-HygroB (vector map see Figure 1 ): piggybac is the plasmid backbone; TRE6H is an inducible promoter; and HygroB is the hygromycin B resistance gene. This plasmid can induce the expression of the LEUTX gene in the presence of doxycycline (dox).

[0048] (1) Amplification of the LEUTXCDS fragment (shown in SEQ ID NO. 1):

[0049] ATGCAAGAAAAACCAACTTC ATCTCGCCGATCCCGTACTTACTTCAGTCGGGAACAGCTTCGGGTGCTAACTGATACCTTTGAAAAGACCAGGTACCCCAACTGGTTCATCGTAAACACGCTTTCTTCAAATATTCATCTTGATGAGTCAGTTAT AAAGACTTGGTTTAAAAACCAGCGTGTCAAAAGGAGGAAGAAGGAGCGTGAAACTCAGCAAAACCCACCACTGGAGGACACACCACAGGTGTCTCCAGTGAAGGAGGAGGAGACCCTCTCCCCTAGTGCTTCTGGA AACACCCGTTCCATGTCTCTCAGCATCTCAGATGCTTCTGACCCTGACTCTCCCCAGCCTTCGTGTGCCGAGACATGTGAAGGGGCTGCACCATGTGAAGGGGCTGCGGCCACCCCATGCGATTCATCCTGTGACT TTCTGCCTGAGGATCTCCGACAGATAAGTTTCAGAGACCCTGATCCCCCTTGGGCCTCCAGTCCGTACGACATGGATCAGCTTATACAATTATACAACTTACCTGGCGAGGATGATCCCAGCAGTCTAGACCAGTA CCTCCTCCCGCTGTGCTCCACC ; SEQ ID NO.1.

[0050] Nested PCR amplification was performed using porcine expanded potential stem cell (pEPSC) cDNA as a template using PrimeSTAR GXL DNA Polymerase High-Fidelity PCR Enzyme (TaKaRa, R050A). The PCR reaction system consisted of 10 μL of 5× PrimeSTAR GXL Buffer, 4 μL of 2.5 mM dNTP Mixture, 1.5 μL of 10 μM upstream primer F, 1.5 μL of 10 μM downstream primer R, 0.5 μg of pEPSC cDNA template, 1 μL of PrimeSTAR GXL DNA Polymerase, and ddH2O to a total of 50 μL. The PCR protocol was as follows: Phase 1, 94°C for 5 min, for one cycle; Phase 2, 98°C for 10 s, 60°C for 20 s, and 68°C for 90 s, for 30 cycles; Phase 3, 68°C for 120 s, for one cycle. The first round of amplification used primers F1 and R1. PCR products were purified and recovered according to the FastPure Gel DNA Purification and Recovery Kit (Vazyme, DC301-01) instructions. The following steps were performed: After PCR product identification by 1% agarose gel electrophoresis, the gel fragment corresponding to the target band was excised under UV light and transferred to a 1.5 mL centrifuge tube. 0.5 mL of GDP lysis buffer was added, and the gel was shaken in a 55°C water bath until the gel was completely dissolved. The lysate was transferred to a DNA purification column and centrifuged at 13,800 × g for 30 seconds. The filtrate was discarded and the column was reloaded into a collection tube. 0.5 mL of GDP buffer was added (incubated at room temperature for 1 minute, then centrifuged and discarded), followed by 0.7 mL of GW wash buffer (gently inverted to mix, then centrifuged and discarded). After repeated washing, the column was centrifuged at 13,800 × g for 2 minutes to remove residual ethanol. The column was transferred to a fresh centrifuge tube, 20–30 μL of elution buffer or sterile water was added, and the column was allowed to stand for 2 minutes before centrifugation to collect the purified DNA. The purified product was concentrated using Nanodrop and stored at -20°C until ready for use. The second round of amplification used the product recovered from the first round of PCR as a template using primers F2 and R2. Homology arms were designed into the primers to allow seamless cloning of the piggybac-TRE6H-HygroB backbone and the LEUTX DNA fragment. The PCR product was recovered using the same method to obtain the LEUTX DNA fragment with homology arms.

[0051] The vector piggybac-TRE6H-HygroB backbone was obtained by double enzyme digestion of the plasmid piggybac-TRE6H-EOMES-HygroB.

[0052] The primer information used in this process is as follows:

[0053] F1: CTATGCAAGAAAAACCAACTTC; SEQ ID NO.2;

[0054] R1: GGTGGAGCACAGCGGGAGGAGG; SEQ ID NO.3;

[0055] F2: cttcctaccctcgtaaaggaagcttCTATGCAAGAAAAACCAACTTC; SEQ ID NO.4;

[0056] R2: ctttgtagtcGTCGACACCGGATCCGGTGGAGCACAGCGGGAGGAG; SEQ ID NO.5.

[0057] (2) Enzyme digestion of the vector backbone: The piggybac-TRE6H-EOMES-HygroB plasmid was double-digested with the restriction endonucleases HindIII and BamHI to obtain the piggybac-TRE6H-HygroB vector backbone. The digestion system was as follows: 4 μg of piggybac-TRE6H-EOMES-HygroB plasmid, 2.5 μL of HindIII (TaKaRa, 1060), 2.5 μL of BamHI (TaKaRa, 1605), 5 μL of 10× Cut Buffer (TaKaRa), and ddH2O to 50 μL. The digestion procedure was: 30°C for 1 h, then 37°C for 1 h. The digestion product was purified and recovered.

[0058] (3) Ligation of the LEUTX DNA fragment and the vector backbone: Use Biomed (CL116-01) 2×SeamlessCloning Mix to ligate the LEUTX DNA fragment and the piggybac-TRE6H-HygroB vector backbone recovered by enzyme digestion. Ligation system: 1 μL of LEUTX DNA fragment, 3 μL of piggybac-TRE6H-HygroB vector backbone recovered by enzyme digestion, 5 μL of 2×SeamlessCloning Mix, and 1 μL of ddH2O. Ligation procedure: 50°C for 30 min.

[0059] (4) Transformation: 2 μL of the ligation product was added to DH5α competent cells for in vitro transformation. The specific steps were as follows: incubate on ice for 30 min, heat-activate at 42°C for 45 s, and incubate on ice for 3 min.

[0060] (5) Plate coating: After transformation, add 500 μL of non-resistant LB liquid medium, shake the bacteria at 37°C for 1 hour, centrifuge at 5000 rpm for 5 minutes, discard the excess medium, resuspend the bacteria, and spread the bacteria liquid on solid LB medium containing AMP resistance using a glass rod. Incubate at 37°C overnight. On the next day, pick a single colony of appropriate size and clear boundaries for sequencing to verify whether the LEUTX DNA fragment is correct.

[0061] (6) Extraction of endotoxin-free plasmid piggybac-TRE6H-LEUTX-HygroB: After confirmation, take about 30 mL of liquid LB medium containing AMP, add 30 μl of bacterial solution and shake overnight. The next day, use the endotoxin-free plasmid extraction kit (OmegaBiotek, D6950-02) to extract the plasmid. The specific method is as follows:

[0062] a. Centrifuge at 5000g for 10 min at room temperature to collect the bacteria;

[0063] b. Discard the culture medium, add 250 μl of Solution I / RNase A mixture, and vortex to completely resuspend the cells.

[0064] c. Add 250 μl of Solution II to the resuspended mixture, gently invert to mix, and let the mixture stand at room temperature for 2-3 minutes;

[0065] d. Add 125 μl of pre-chilled N3 Buffer and gently invert the tube several times until a white flocculent precipitate forms.

[0066] e. Centrifuge at 13,000 x g for 10 min at room temperature and transfer the supernatant to a new 1.5 ml centrifuge tube;

[0067] f. Add 0.1 times the volume of ETR Solution to the supernatant, invert 10 times to mix, and place on ice for 10 minutes. Note: After adding ETR Solution, the solution becomes turbid and becomes clear after being placed on ice.

[0068] g. Incubate at 42°C for 5 min, and the solution becomes turbid again;

[0069] h. Centrifuge at 12,000 x g for 3 min at 25°C. Transfer the upper aqueous phase (containing DNA) to a new 1.5 mL centrifuge tube. Add 0.5 volumes of anhydrous ethanol, mix by inverting 6-7 times, and let stand at room temperature for 1-2 min.

[0070] i. Transfer the mixture (up to 700 μl at a time) to a 2 mL collection tube. The DNA binding column was centrifuged at 10,000 × g for 1 min at room temperature and the filtrate was discarded;

[0071] j. Reinstall the column into the collection tube, add 500 μl HBC Buffer, centrifuge at maximum speed for 1 minute, and discard the filtrate;

[0072] k. Return the column to the collection tube, add 700 μl DNA Wash Buffer, centrifuge at maximum speed for 1 minute, and discard the filtrate;

[0073] l. Repeat step k.;

[0074] m. Reinstall the column into the collection tube and centrifuge the empty column at 13,000 x g for 2 minutes to dry the column matrix;

[0075] n. Place the column in a clean 1.5 mL centrifuge tube, add 30-100 μl of Elution Buffer to the column matrix, let it stand for 1 minute, and centrifuge at maximum speed for 1 minute to elute the plasmid DNA.

[0076] o. Discard the column and measure the plasmid DNA concentration using Narodrop for subsequent cell transfection and store at -20°C.

[0077] 4) Obtaining a porcine embryonic stem cell line with overexpression of LEUTX

[0078] (1) Cell transfection:

[0079] The vector was efficiently transfected into pEPSCs using electroporation. The specific procedure was as follows: before passaging cells, the culture medium was discarded. After washing once with DPBS, 750 μL of 0.05% trypsin (pre-equilibrated at 37°C) was added and digested at 37°C for 3 minutes until the cell edges retracted. An equal volume of D10 culture medium was added to terminate the digestion. The cell pellet was collected by centrifugation at 200 x g for 3 minutes, the supernatant was discarded, and the cells were gently resuspended in 1 mL of Opti-MEM and centrifuged again. The supernatant was discarded and the cell pellet (cell weight approximately 1×10 6 ) were resuspended in 100 μL Opti-MEM (Thermo Fisher, 31985070), and the following transfection components were added: 4 μg piggybac-TRE6H-LEUTX-HygroB and 4 μg transposase (pBase plasmid) to obtain a cell suspension. The cell suspension was transferred to a 2 mm electroporation cuvette and transfected using a Nucleofector. TM 2b electroporator (program A-023) was used for electroporation. Immediately after electroporation, cells were seeded into fresh culture dishes (35 mm) pre-coated with STO feeder cells (cell number was approximately 5 × 10 5 -8×10 5 ) and resume culture at 37°C and 5% CO2.

[0080] (2) Screening of positive LEUTX overexpression porcine expanded potential stem cell lines:

[0081] Cells transfected by electroporation were designated as passage 0, and routine subculture procedures began after three days of culture. Starting from passage 2 (P2), HygroB (5 μL HygroB per mL of culture medium) and doxycycline (Dox) (final concentration 1 μg / mL) were synchronously and continuously added to the culture system. After at least three passages of culture under continuous doxycycline induction conditions, a porcine extended potential stem cell line stably overexpressing the LEUTX gene (LEUTX OEpEPSCs) was successfully established.

[0082] (3) Cell identification:

[0083] Quantitative detection of LEUTX expression levels in LEUTX OE pEPSCs was performed using qRT-PCR. The specific steps are as follows:

[0084] a. RNA extraction and reverse transcription

[0085] After collecting the cells, add 1mL TRIzol to lyse them, pipet evenly and transfer to a 1.5mL centrifuge tube. Add 200μL chloroform and shake to stand for stratification, centrifuge at 4℃ for 15 minutes (13000xg). Take the supernatant and add 500μL isopropanol and gently invert to mix, let stand at room temperature for 10 minutes, centrifuge at 4℃ for 10 minutes to collect RNA precipitate. Discard the supernatant, add 1mL pre-cooled 75% ethanol to wash the precipitate, and centrifuge at 4℃ for 5 minutes. After discarding the ethanol, air-dry the precipitate for 5 minutes, dissolve it with 20-30μL RNAse-free water, determine the concentration by Nanodrop, evaluate the integrity by 1% agarose gel electrophoresis, and store at -80℃. According to IIQ RT SuperMix for qPCR (+gDNAwiper) (Vazyme, R223) instructions for reverse transcription. The resulting cDNA can be stored at -20°C for a long time.

[0086] b. Real-time fluorescence quantitative PCR

[0087] RT-qPCR was performed on a CFX-Connect quantitative PCR instrument using Vazyme's ChamQ Universal SYBR qPCR Master Mix reagent. The reaction system included 0.3 μL of upstream primer F (10 μM), 0.3 μL of downstream primer R (10 μM), 5 μL of 2×SYBR qPCR Master Mix, 1 μL of cDNA, and 3.4 μL of RNase-Free H2O.

[0088] Reaction program: 95°C for 5 min; 95°C for 15 s, 60°C for 30 s, 72°C for 15 s, 40 cycles; 72°C for 15 min; 4°C hold.

[0089] The primer sequences are as follows:

[0090] GADPH-F: 5'-CAAGGGCATCCTGGGCTACAC-3'; SEQ ID NO.6;

[0091] GADPH-R: 5'-GGATCGAGTTGGGGCTGTGAC-3'; SEQ ID NO.7;

[0092] LEUTX-F: 5'-CGCCGATCCCGTACTTACTT-3'; SEQ ID NO.8;

[0093] LEUTX-R: 5'-AGTTTCACGCTCCTTCTTCCTC-3'; SEQ ID NO. 9.

[0094] GAPDH was used as the internal reference gene, and all gene species were porcine.

[0095] Results and Discussion

[0096] Figure 2 The results showed that after obtaining a stable porcine embryonic stem cell line overexpressing LEUTX, LEUTX expression was significantly upregulated in LEUTXOE pEPSCs (OE LEUTX) compared with controls (Control, pEPSCs) after doxycycline (Dox) induction.

[0097] Figure 3 The results showed that LEUTXOE pEPSCs exhibited a typical dome-shaped clone structure, while pEPSCs clones that did not overexpress LEUTX were flatter. Moreover, LEUTXOE pEPSCs could be stably passaged for more than 40 generations under continuous induction conditions without spontaneous differentiation or state decline. LEUTX expression depends on Dox induction. When the inducer Dox is withdrawn, LEUTX expression cannot be induced. LEUTXOE pEPSCs cells flattened their morphology within 8 to 9 days and could not maintain the dome-shaped pluripotent clone morphology in the presence of Dox, indicating that the maintenance of cell pluripotency strictly depends on the continuous expression of LEUTX ( Figure 4 ).

[0098] Example 2 Overexpression of LEUTX Improves Pluripotency of pEPSCs

[0099] 1) LEUTX overexpression promotes the expression of genes related to pEPSCs pluripotency

[0100] qRT-PCR was used to quantitatively analyze the transcriptome level of LEUTX overexpressing cells. The specific experimental steps are as shown in step (3) of 4) in Example 1.

[0101] The primer sequences are as follows:

[0102] GADPH-F: Same as SEQ ID NO.6;

[0103] GADPH-R: Same as SEQ ID NO.7;

[0104] TFAP2C-F: 5'-GCTGCTCATGTAACCCTCCT-3'; SEQ ID NO.10;

[0105] TFAP2C-R: 5'-GTTGCCATCTCATTCCGTCC-3'; SEQ ID NO. 11;

[0106] DPPA5-F: 5'-AAGTCATGGTTTACGGTCCTTACTT-3'; SEQ ID NO. 12;

[0107] DPPA5-R: 5'-AAGTCTGCACATCCCTCGTTC-3'; SEQ ID NO.13;

[0108] STAT3-F: 5'-AAACTTGATGAAAAGTGCCTTCGTG-3'; SEQ ID NO.14;

[0109] STAT3-R: 5'-GGAATTTGACCAGCAATCTGACTTT-3'; SEQ ID NO.15;

[0110] DNMT3B-F: 5'-ATCAGAGGCCGCAGATCAAG-3'; SEQ ID NO.16;

[0111] DNMT3B-R: 5'-GTAGCTGAGAACTCCACGGG-3'; SEQ ID NO.17;

[0112] EOMES-F: 5'-AGCCTTTTGCAAAGGGGTTGT-3'; SEQ ID NO.18;

[0113] EOMES-R: 5'-GAGCCCTCGAAGACTCAGACC-3'; SEQ ID NO.19;

[0114] OTX2-F: 5'-TCTTCATGCGGGAAGAGGTGG-3'; SEQ ID NO.20;

[0115] OTX2-R: 5'-TGAACTCACTTCCCGAGCAGG-3'; SEQ ID NO. 21.

[0116] GAPDH was used as the internal reference gene, and all gene species were porcine.

[0117] Results and Discussion: Quantitative data showed that ( Figure 5 ), LEUTX overexpression significantly increased the expression levels of DPPA5, a key factor in establishing pluripotency, and TFAP2C, a core transcription factor that regulates zygotic genome activation (ZGA), compared with the control group (pEPSCs). It is worth noting that STAT3, a key factor in the LIF signaling pathway, was highly expressed in LEUTX-OE pEPSCs cells, indicating that LEUTX-OE pEPSCs are closer to In addition, the expression of genes related to differentiation, such as DNMT3B and OTX2, the core factors regulating embryonic organogenesis, and EOMES, an early differentiation marker involved in gastrulation, were downregulated, which also indirectly indicated that LEUTX overexpression enhanced the totipotency of pEPSCs.

[0118] 2) In vitro induced trophoblast cells (iTSC)

[0119] The core characteristic of cell totipotency is its bidirectional differentiation potential into both intraembryonic and extraembryonic lineages. To systematically evaluate the totipotency characteristics of cells induced by LEUTX overexpression, this study focused on their ability to differentiate into extraembryonic lineages (trophoblasts). Based on an in vitro trophoblast stem cell (TSC) induction system, wild-type (Control) and LEUTX-overexpressing pEPSCs were switched to pTSC (porcine trophoblast stem cell)-specific culture medium. The specific steps are as follows:

[0120] (1) preparing LEUTX-OE pEPSCs according to the method of the present invention;

[0121] (2) LEUTX-OE pEPSCs were maintained on mitomycin C-treated feeder cells. After 3-4 days of culture, the feeder cells were removed with collagenase. TrypLE TM Express enzyme (Thermo Fisher Scientific, 12604-013) digested into a single-cell suspension;

[0122] (3) Dilute Geltrex or Matrigel 100-fold with cold DMEM / F-12 medium and prepare immediately before use. Use a sufficient amount of the 100-fold diluted Geltrex or Matrigel to coat the culture plate, for example, add 1 ml to each well of a 6-well plate. Incubate in a humidified incubator at 37°C and 5% CO2 for at least 1 hour before use. This step aims to provide an ideal adhesion substrate for subsequent cell seeding.

[0123] (4) Seed cells at a density of 3,000 cells per well in 1X Geltrex or Matrigel-coated 6-well plates and culture them in pTSC medium without CHIR-99021. Change the medium every 2 days to initiate trophoblast differentiation.

[0124] (5) After culturing for about 7-8 days, the cells were washed twice with PBS and digested with 0.05% trypsin, followed by TrypLE TM Express enzyme (Thermo Fisher Scientific, 12604-013) digested into a single-cell suspension;

[0125] (6) Re-seed the cells at a density of 3,000 cells per well in a 1X Geltrex- or Matrigel-coated 6-well plate and replaced with pTSC medium containing 2 μM CHIR-99021 to further promote differentiation. Cells were collected at the designated time points for analysis.

[0126] (7) iTSCs are usually maintained in pTSC medium containing CHIR-99021 and passaged in 6-well plates;

[0127] (8) All the above cell culture conditions were 37°C, 20% O2 and 5% CO2;

[0128] (9) The pTSC culture medium was prepared using the following system: basal medium DMEM / F12 (Thermo Fisher, 11330032) supplemented with 1% B27, 0.5% GlutaMAX, 1% NEAA, 0.5% Pen-Strep, 0.2% FBS, 0.3% BSA, 1% ITS-X, 55 μM β-mercaptoethanol, 50 μg / mL Vc, 50 ng / ml EGF, 0.5 μM A83-01, 1 μM SB431542, 10 μM valproic acid (VPA), and 5 μM Y-27632.

[0129] Results and Discussion

[0130] The experimental results showed that after 12 days of induction in pTSC culture medium (iTSCs), both groups of cells showed typical TSC-like morphology, including loosening of intercellular connections, flattened and expanded cell bodies, and irregular colony edges. It is worth noting that the LEUTX overexpression group showed more obvious morphological transformation characteristics, with cell body expansion on the first day of induction and a larger clone area ( Figure 6 ), suggesting that its differentiation process is significantly accelerated.

[0131] 3) TSC core gene activation

[0132] qRT-PCR was used to quantitatively detect the activation of TSC core genes after induction of iTSCs in LEUTXOE pEPSCs and control cells. The specific experimental steps are as shown in step (3) of 4) in Example 1.

[0133] The primer sequences are as follows:

[0134] GADPH-F: Same as SEQ ID NO.6;

[0135] GADPH-R: Same as SEQ ID NO.7;

[0136] POU5F1-F: 5'-GAGTGAGAGGCAACCTGGAGAG-3'; SEQ ID NO. 22;

[0137] POU5F1-R: 5'-AGCAGCCTCAAAATCCTCTCGT-3'; SEQ ID NO. 23;

[0138] GATA3-F: 5'-GGGGTCCCCATTGGCATTTCT-3'; SEQ ID NO. 24;

[0139] GATA3-R: 5'-TGAACGGACAGAATCGACCCC-3'; SEQ ID NO. 25;

[0140] KRT7-F: 5'-TCGTGGTGCTGAAGAAGGAT-3'; SEQ ID NO.26;

[0141] KRT7-R: 5'-CCTTGGACTGCAGCTCTTTC-3'; SEQ ID NO. 27;

[0142] CDX2-F: 5'-GGAGCTGGAGAAGGAGTTTCA-3'; SEQ ID NO. 28;

[0143] CDX2-R: 5'-TGCAACTTCTTCTTGTTGATTTTC-3'; SEQ ID NO. 29;

[0144] ELF5-F: 5'-ACAGGAGGAGTTCATCGAGG-3'; SEQ ID NO.30;

[0145] ELF5-R: 5'-CTTTGATGGCAGCCTTGGTC-3'; SEQ ID NO.31;

[0146] TEAD4-F: 5'-TGGAGTTCTCTGCCTTCCTG-3'; SEQ ID NO.32;

[0147] TEAD4-R: 5'-CTCGGGGAACTTGTCGTAGA-3'; SEQ ID NO.33;

[0148] PGF-F: 5'-TGGAGTTCTCTGCCTTCCTG-3'; SEQ ID NO.34;

[0149] PGF-R: 5'-ATCTTCAGGAGCTGCATGGT-3'; SEQ ID NO. 35.

[0150] GAPDH was used as the internal reference gene, and all gene species were porcine.

[0151] Results and Discussion

[0152] qRT-PCR quantitative analysis showed that ( Figure 7 ). There were no significant differences in the expression levels of CDX2, GATA3, ELF5, and KRT7 between the two groups at the end of induction (day 12). However, the activation timing of core genes in the LEUTX overexpression group was significantly advanced: CDX2 was significantly upregulated on day 3 (5 days earlier than in the control group), and the activation of GATA3 and ELF5 was also advanced by 3-4 days. This suggests that LEUTX, by accelerating the initiation of trophoblast differentiation, endows pEPSCs with enhanced extraembryonic lineage differentiation potential, providing a key regulatory target for the construction of totipotent cell models.

[0153] 4) Blastocyst induction

[0154] One of the core evaluation dimensions of cell totipotency is its ability to simulate embryonic development in vitro and self-organize to form blastocyst-like structures. The blastocyst-like construction strategy of the present invention is based on the following technical approach: directly utilizing cells with bidirectional differentiation potential inside and outside the embryo (such as EPSCs or totipotent cells), and inducing them to self-organize to form blastocyst-like structures (such as Figure 8 The specific steps are as follows:

[0155] (1) preparing LEUTX-OE pEPSCs according to the method of the present invention;

[0156] (2) LEUTX-OE pEPSCs were maintained on mitomycin C-treated feeder cells. After 3-4 days of culture, the feeder cells were removed with collagenase. TrypLE TM Express enzyme (Thermo Fisher Scientific, 12604-013) digested into a single-cell suspension;

[0157] (3) Approximately 300,000 single cells were seeded into a 6-well ultra-low attachment plate. 1.5 mL of 4FXY medium was added to each well and cultured on a shaker at 50 rpm. On the second day, 1 mL of medium was added.

[0158] (4) On day 3, the cell aggregates formed by LEUTX-OE pEPSCs (at this point, the aggregate diameter reaches 50-100 μm) are transferred to iBlastoid induction medium and cultured for 3-5 days. The specific steps are as follows: transfer the liquid and aggregates in the well plate to a 1.5 mL EP tube, centrifuge at 500 g for 1 min, discard the supernatant, add blastocyst induction medium to resuspend, and then transfer to a new ultra-low adsorption 6-well plate for continued culture and replenish 1 mL of liquid every day. The culture conditions are 37°C and 5% CO2;

[0159] (5) All generated porcine blastocysts were manually separated by mouth pipette under a stereomicroscope, and blastocysts with a diameter of 200-300 μm and symmetrical morphology were selected for subsequent experiments.

[0160] (6) The 4FXY culture medium system is as follows: the basal culture medium is prepared by mixing Neurobasal medium (Gibco, 21103049) and DMEM / F12 medium (Thermo Fisher, 11330032) at a volume ratio of 1:1, supplemented with 0.5% N2 (Therom Fisher Scientific, 17502048), 1% B27, 1% GlutaMAX, 1% NEAA, 1% Pen-Strep, 5% KOSR, 0.15% FBS, 100 μM β-mercaptoethanol, 50 μg / mL Vc, 20 ng / mL IL-6, 20 ng / mL sIL-6 Receptorα, 20 ng / mL Activin A, 50 ng / mL hIGF1, 2.5 μM XAV939, and 5 μM Y-27632.

[0161] (7) The iBlastoid induction medium system was as follows: the basal medium was prepared by mixing Neurobasal medium (Gibco, 21103049) and DMEM / F12 medium (Thermo Fisher, 11330032) at a volume ratio of 1:1, supplemented with 0.5% N2 (Thermo Fisher, 17502048), 1% B27, 1% GlutaMAX, 1% NEAA, 1% Pen-Strep, 5% KOSR, 0.075% FBS, 100 μM β-mercaptoethanol, 50 μg / mL Vc, 10 ng / mL IL-6, 10 ng / mL sIL-6 Receptorα, 10 ng / mL Activin A, 5 ng / mL hLIF, and 50 ng / mL hIGF1.

[0162] Results and Discussion

[0163] The experimental results showed that only the LEUTX overexpression group formed a typical blastocyst cavity structure on the third day of induction, while the control group failed to form any cavity structure ( Figure 9 ), the blastocyst-like induction efficiency of the LEUTX overexpression group was close to 80%, which was significantly higher than that of the control group ( Figure 10 ). Figure 11 The results showed that the blastocysts induced on D5 and D6 were consistent with those of IVF (in vitro fertilization) blastocysts on E6.5 and E7.5 (days 6.5 and 8.5 of embryonic development after fertilization) in terms of morphological characteristics and size parameters, and the mean total cell number (110±25) and X / Y axis ratio (0.97±0.15) were not significantly different from those of natural blastocysts (111±28; 0.96±0.12). Figure 12 ), confirming that it has spatiotemporal regulation characteristics that are highly synchronized with natural embryonic development.

[0164] 5) Identification and analysis of blastocyst-like cells derived from totipotent stem cells

[0165] The porcine blastocysts generated in step (5) were collected and immunofluorescence staining was performed. GATA3 was used as a marker for trophoblasts (TE), SOX2 was used as a marker for epiblasts, and GATA6 was used as a marker for hypoblasts. The specific steps were as follows:

[0166] (1) Fixation: Place the porcine blastocyst in a fixative solution (0.4 g paraformaldehyde (PFA) dissolved in 10 ml PBS) at room temperature for 30 minutes.

[0167] (2) Washing: Wash three times with washing solution (0.05 g of polyvinyl alcohol (PVA) dissolved in 100 ml of PBS).

[0168] (3) Permeabilization: The porcine blastocysts were transferred to a permeabilization solution (20 μl Triton-X100 (Sigma Aldrich, T9284) dissolved in 10 ml PBS), allowed to stand at room temperature for 30 minutes, and then washed again three times with a washing solution.

[0169] (4) Closing: Transferring porcine blastocysts to QuickBlock TM The cells were placed in immunostaining blocking solution (Biyuntian, P0260) and allowed to stand at room temperature for 2 hours.

[0170] (5) Primary antibody incubation: Place the porcine blastocysts in dilutions containing the following antibodies and incubate overnight at 4°C:

[0171] SOX2 antibody (eBioscience, 14-9811-82), 1:100 dilution, rabbit antibody;

[0172] GATA6 antibody (CST, 5851), 1:100 dilution, rabbit antibody;

[0173] GATA3 antibody (Abcam, ab199428), 1:100 dilution, rabbit antibody;

[0174] (6) Washing: Wash again three times with washing solution.

[0175] (7) Secondary antibody incubation: Transfer the porcine blastocysts to an antibody diluent (1:500 dilution) containing fluorescent secondary antibody (the secondary antibody corresponding to the rabbit antibody is anti-rabbit AlexaFluor 549 from Beyotime) and incubate in the dark at room temperature for 1 hour.

[0176] (8) DAPI staining: Finally, the porcine blastocyst was placed on a glass slide with a DAPI-containing mounting solution (Biyuntian, P0131) for pressing.

[0177] Results and Discussion

[0178] Immunofluorescence staining revealed the spatial localization of blastocyst-like cell lineages, and found that SOX2-positive cells were polarized in the inner cell mass (ICM) region, GATA3-positive cells formed a continuous outer layer structure simulating TE, and GATA6-positive Hypo-like cells were detected inside the ICM. Figure 13 These results indicate that LEUTX overexpression can drive pEPSCs to self-organize into a blastocyst-like model with a clear three-lineage structure. This blastocyst-like model has trophoblast cells (GATA3-positive cells) continuously wrapped around the periphery, and the inner cell mass has a compartmentalized distribution of the epiblast (Epiblast, SOX2-positive cells) and hypoblast (Hypoblast, GATA6-positive cells).

[0179] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for obtaining porcine totipotent stem cells, characterized in that: The steps include: (1) Constructing a plasmid for overexpressing the LEUTX gene; the LEUTX gene sequence is shown in SEQ ID NO. 1; (2) Plasmids overexpressing the LEUTX gene were transfected into pEPSCs using electroporation technology to obtain a porcine expanded potential stem cell line overexpressing the LEUTX gene; (3) Using induced iTSC and blastocyst-like experiments, it was determined that pig expanded potential stem cells overexpressing the LEUTX gene are pluripotent.

2. A method for efficiently constructing porcine blastocysts using porcine totipotent stem cells, characterized in that: The following steps are involved: 1) preparing a porcine extended potential stem cell line overexpressing the LEUTX gene according to the method of claim 1; 2) The porcine extended potential stem cell line overexpressing the LEUTX gene was digested into single cells using TrypLE digestive enzyme, resuspended in 4FXY medium, and seeded into ultra-low attachment 6-well plates. Cell aggregates were pre-induced for 1-2 days. 3) On the third day of induction, when the aggregates reach a diameter of 50-100 μm, switch to blastocyst-like induction medium and continue culturing for 3-5 days to simulate the embryonic coelomic process; 4) At the end of differentiation, blastocysts with a diameter of 200-300 μm and symmetrical morphology were screened under a stereomicroscope and manually isolated and collected using a mouth pipette.

Citation Information

Patent Citations

  • Vector and method for improving pig cloning efficiency based on overexpression transcription factor

    CN115948476A

  • Cell culture medium formula for inducing porcine extended pluripotent stem cells to be differentiated into trophoblast stem cells and application of cell culture medium formula

    CN118703424A

  • Method and culture medium for inducing porcine embryonic stem cells to form porcine blastocysts

    CN119432720A

  • Compositions and methods for reprogramming cells and for somatic cell nuclear transfer using DUXC expression

    WO2018073787A2